SciELO - Scientific Electronic Library Online

 
vol.54 número2Non-O157 Shiga toxin-producing Escherichia coli with potential harmful profiles to humans are isolated from the faeces of calves in UruguayDomestic dog and alien North American mink as reservoirs of infectious diseases in the endangered Southern river otter índice de autoresíndice de materiabúsqueda de artículos
Home Pagelista alfabética de revistas  

Servicios Personalizados

Revista

Articulo

Indicadores

Links relacionados

  • En proceso de indezaciónCitado por Google
  • No hay articulos similaresSimilares en SciELO
  • En proceso de indezaciónSimilares en Google

Compartir


Austral journal of veterinary sciences

versión impresa ISSN 0719-8000versión On-line ISSN 0719-8132

Austral j. vet. sci. vol.54 no.2 Valdivia  2022

http://dx.doi.org/10.4067/S0719-81322022000200055 

ORIGINAL ARTICLE

Captive collared peccary carries ESBL-producing diarrheagenic Escherichia coli pathotypes

Conrado Quiñonez Balbuenaa  

Carlos Tejeda Cruzb 

Carlos Ibarra Martínezb 

María Angela Oliva Llavenb 

Mariela Reyes Sosac 

Carlos Alfredo Carmona Gascad 

Sergio Martínez Gonzálezd 

Javier Gutiérrez Jiméneze 

Gerardo Uriel Bautista Trujillob  * 

aMaster of Science in Tropical Agropecuary Production, Autonomous University of Chiapas, Chiapas, Mexico.

bFaculty of Veterinary Medicine and Zootechnics CII, Autonomous University of Chiapas, Chiapas, Mexico.

cFaculty of Agronomic Sciences, Autonomous University of Chiapas, Chiapas, Mexico.

dAcademic Unit of Veterinary Medicine and Zootechnics, Autonomous University of Nayarit, Nayarit, México.

eInstitute of Biological Sciences, Chiapas University of Arts and Sciences, Chiapas, Mexico.

ABSTRACT

Collared peccaries (Pecari tajacu) roam the forests of natural areas in America. Wild collared peccary appears to be a carrier for bacteria associated with infections in humans and animals, however, the presence of diarrheagenic E. coli (DEC) pathotypes has not been studied in the captive collared peccary. This study aimed to study the prevalence of DEC, the susceptibility to antibiotics, and the frequency of β-lactamase genes (ESBL) in captive collared peccary faeces. DEC strains were identified in 44.4% (N=56) of the E. coli-carrying peccaries under study. The following DEC strains were identified: ETEC (35.7%), EAEC (28.6%), STEC (21.4%) and EPEC (14.3%). Most of the identified DEC strains belonged to clade I (58.9%). The genetic marker rfbO157 was not found in any STEC strain. Of the DEC strains, 67.9% (N=38) were considered multidrug resistant and were not susceptible to ampicillin (75%) nor to carbenicillin (51.8%). The combination of the genes blaTEM + blaCTX and blaTEM + blaSHV (6 strains respectively) was the most frequent among the DEC strains. It is concluded that captive collared peccaries are carriers of DEC strains that carry β-lactamase blaTEM, blaCTX and blaSHV genes and are not susceptible to ampicillin. Given the current efforts of the Wildlife Management Units (WMU) to reintroduce the collared peccary into natural areas, these captive collared peccaries act as carriers of diarrheagenic E. coli strains and therefore a potential source of gastrointestinal disease in humans and animals.

Key words: β-lactamase; carrier; diarrheagenic pathotypes; Pecari tajacu; wildlife management Unit

INTRODUCTION

The collared peccary Pecari tajacu is a gregarious species distributed from the southeast of the United States to Argentina. It is considered a predator and a seed disperser in tropical forests, deserts, and deforested areas (Marinho et al., 2019). Currently, the International Union for the Conservation of Nature (IUCN2019-1) and the Official Mexican Standard NOM-059-SEMARNAT-2010 (PROFEPA 2010) classify peccaries as a species of least concern (LC).

Collared peccaries roam the jungles and forests of Mexico. They are thus vulnerable to hunting and habitat destruction. Wildlife Management Units (WMU) have developed several strategies for the sustainable management of the species for the purpose of conservation, recovery, reproduction, and reintroduction (Sisk et al., 2007). Previous studies have shown that wild collared peccaries can carry bacteria and viruses associated with infections in humans and domestic animals, such as Clostridium perfringens type A and multiple serotypes of Salmonella spp. (Shender et al., 2009), shiga toxin-producing Escherichia coli (Jay- Russell et al., 2014), Mycobacterium hyopneumoniae, Pasteurella multocida, circovirus type 2 (PCV2) and herpesvirus type 1 (SuHV) (de Castro et al., 2014). The prevalence of Leptospira spp. (78%) in collared peccaries was recently reported, the most frequent serovars are bratislava, grippotyphosa, icterohaemorrhagiae and pomona (Montenegro et al., 2018). Collared peccaries have also been found to harbour classical swine fever virus (5%), porcine circovirus type 2 (7%) and vesicular stomatitis (33%). They also share pathogens with domestic and wild pigs (Sus scrofa) (Montenegro et al., 2018; Molina- Barrios et al., 2018).

Although some efforts have been made to understand the role of captive collared peccaries as pathogen carriers (de Carvalho et al., 2011), their role as carriers of diarrheagenic Escherichia coli (DEC) pathotypes is still unknown. The DEC group includes enterotoxigenic E. coli (ETEC), enteropathogenic E. coli (EPEC), enteroinvasive E. coli (EIEC), Shiga toxin-producing E. coli (STEC), enteroaggregative E. coli (EAEC), and diffusely adherent E. coli (DAEC), DEC pathotypes are associated with gastrointestinal infections in humans and animals (Croxen et al., 2013; Shabana et al., 2013; Tamayo et al., 2021). Enterohaemorrhagic E. coli (EHEC) is a subgroup of STEC strains associated with diarrhoea and haemorrhagic colitis, occasionally progressing to haemolytic uremic syndrome (HUS), which can have serious consequences in humans, including death (Oh et al., 2016). Escherichia coli can contain several antibiotic resistance genes, including those that encode extended spectrum β-lactamases (ESBL) (Faridah et al., 2020). Therefore, understanding the mechanisms of E. coli dissemination is a necessary step in finding a solution to the growing worldwide incidence of multidrug resistant (MDR) and extensively resistant (XDR) bacterial strains (Taghadosi et al., 2019).

This study aimed to identify the role of captive collared peccaries as a carrier of ESBL-producing diarrheagenic Escherichia coli pathotypes. This would allow designing sanitary measures to mitigate the potential of collared peccaries to spread pathogens of public health importance as a consequence of their management and a possible reintroduction to natural areas. The objective of this research was to study the prevalence of diarrheagenic Escherichia coli pathotypes that colonise the intestine of collared peccaries (Pecari tajacu) in captivity. In addition, this study aimed to find out if the DEC strains identified in captive collared peccaries are associated with antibiotic resistance and, if so, the genes involved. To do this, the susceptibility of DEC strains to commonly used antibiotics and the frequency of genes that encode extended spectrum β-lactamases (ESBL) were determined.

MATERIAL AND METHODS

PECCARY SAMPLING

Between the autumn of 2017 and the summer of 2019, 140 clinically healthy collared peccaries with no record of antibiotic therapy were selected among a group kept in 11 intensive wildlife management units (WMU) in the state of Chiapas, Mexico. The specimens of these WMU were obtained by purchase, donation, under protection or loan, and their origin may be wild or captivity. Animal studies were approved by the Ethics Committee of the University of Sciences and Arts of the state of Chiapas (approval #049/02-2018).

In the WMU, an average of 25 peccaries were kept in roofless cages averaging 8 x 24 meters in size, with floors made of dirt, logs or twigs, and walls commonly made of stone and steel mesh. Their daily diet consisted mainly of seasonal agricultural waste and food waste from homes, restaurants and markets: ears of corn, plant waste such as rhizomes (ginger, sugar cane, bamboo, among others), tubers (potato, cassava, sweet potato, carrot, jicama, radishes, among others), bulbs (onion, leek, garlic, among others) and fruits (cucumber, tomato, papaya, watermelon, among others); water was supplied ad libitum in concrete or wood drinking troughs.

ISOLATION OF E. COLI AND IDENTIFICATION OF DEC STRAINS

The peccaries were transferred to a wooden corridor (average measurements: 1 m high, 1.20 m long and 60 cm wide) with a liftgate at each end to carry out the sampling. Faeces samples were collected by introducing a swab into the rectum of the animal, and then into agar gel medium or Stuart transport medium (Copan Diagnostics, Inc.) for transfer to the laboratory. The swabs were inoculated onto Eosin Agar and Methylene Blue (BD-BBI™) plates and vatted at 37 °C for 24 hours. Up to 10 lactose fermenting colonies were selected and analysed by standard biochemical tests. Plates of MacConkey Agar with sorbitol were used simultaneously to promote the growth of EHEC serotype O157: H7. The genetic identification of the E. coli strains was carried out by amplifying the uidA gene (Tsai et al., 1993).

IDENTIFICATION OF DIARRHEAGENIC PATHOTYPES OF E. COLI BY POLYMERASE CHAIN REACTION (PCR)

In the PCR, the E. coli strain ATCC® 25922 TM was used as a negative control. The following strains were used as positive control: STEC EDL933 (O157: H7), EAEC 042 (044: H18), ETEC H10407 (O78: H11), EPEC E2348-69 (O127: H6) and EIEC E11 (O124NM). The strains were provided by Dr. Teresa Estrada García from CINVESTAV, Mexico, and were kept in the bacteriological collection of the University of Sciences and Arts of Chiapas (Universidad de Ciencias y Artes) (Gutiérrez-Jiménez et al., 2015). To obtain the DNA, the selected colonies were suspended in 1 mL of deionized water and the preparation was boiled for 10 min. The suspension was centrifuged at 10,000 rpm for 5 min and the supernatant containing DNA was removed and stored at -80 °C. Specific primers were used to amplify the Enteroaggregative E. coli (EAEC) aap, aggR, and AAprobe genes using the technique described by Cerna (Cerna et al., 2003).

For Shiga toxin-producing E. coli (STEC) (stx1 and stx2 genes), Enteropathogenic E. coli (EPEC) (bfpA and eaeA genes), Enterotoxigenic E. coli (ETEC) (lt and st genes), and Enteroinvasive E. coli (EIEC) (ial gene), the targets and conditions used were those previously described (López-Saucedo et al., 2003). Shiga toxin-producing E. coli O157 was studied by amplifying the rfb gene (specific O-polysaccharide) (Paton & Paton, 1998).

The E. coli strains were classified by quadruplex PCR into seven phylogroups: A, B1, B2, C, D, E, F, and the crypto Clado I, based on the presence or absence of the genes chuA, yjaA, arpA and trpA, as well as the TSPE4 C2 DNA fragment (Clermont et al., 2013). The amplification of the extended spectrum β-lactamase genes blaTEM, blaSHV, blaCTXM, blaOXA and blaCMY was carried out using the primers and conditions previously reported (Ahmed et al., 2007). Table 1 shows the sequences of the primers and the PCR conditions used in this study.

ANALYSIS OF ANTIMICROBIAL SUSCEPTIBILITY

The following antimicrobial susceptibility discs (BD BBL™ Sensi-Disc™) were used with first-line antibiotics commonly used of different antimicrobial categories: β-lactam: ampicillin (AMP; 10 µg), carbenicillin (CAR; 100 µg) and oxacillin (OXA; 1 µg); aminoglycosides: amikacin (AMK; 30 µg), netilmicin (NET; 30 µg) and gentamicin (GEN; 10 µg); cephalosporins: cephalothin (CEF; 30 µg) and cefotaxime (CTX; 30 µg); quinolones: ciprofloxacin (CIP; 5 µg) and norfloxacin (NOR; 10 µg); phenicols: chloramphenicol (CHL; 30 µg); folate inhibitors: trimethoprim-sulfamethoxazole (SXT; 25 µg); furans: nitrofurantoin (NIT; 300 µg); Tetracyclines: Tetracycline (TET; 30 µg). β-lactam-resistant strains were subsequently analysed using the disc diffusion method with amoxicillin-clavulanic acid discs (AMC; 20/10 µg). The antibiotics and the disk diffusion method were used following the recommendations of the Clinical and Laboratory Standards Institute (Wayne, 2020). The E. coli strain ATCC® 25922 TM was used as a negative control and STEC EDL933 (O157: H7) as the positive control. Escherichia coli strains (including intermediate and resistant phenotypes) not susceptible to at least three antibiotics and from different antimicrobial categories were classified as multidrug resistant strains (MDR), while strains not susceptible to at least one antibiotic and belonging to each of the tested antimicrobial categories were classified as Extensively Drug-Resistant (XDR) (Magiorakos et al., 2012).

Table1. Primers used in this study. 

Primer pair Sequence (5’-3’) Target Encoded protein Size (bp) Reference
uidAF AAAACGGCAAGAAAAAGCAG uidA β-glucuronidase 147 (Tsai et al., 1993)
uidAR ACGCGTGGTTAACAGTCTTGCG
aapF CTTGGGTATCAGCCTGAATG aap Aggregative adherence fimbria 310 (Cerna et al., 2003)
aapR AACCCATTCGGTTAGAGCAC
aggF CTAATTGTACAATCGATGTA aggR Transcriptional activator 457 (Cerna et al., 2003)
aggR AGAGTCCATCTCTTTGATAAG
AA probeF CTGGCGAAAGACTGTATCAT AA probe Anti-aggregation protein transporter 629 (Cerna et al., 2003)
AA probeR CAATGTATAGAAATCCGCTGTT
ltFf GGCGACAGATTATACCGTGC lt Heat-labile enterotoxin 450 (López-Saucedo et al., 2003)
ltRr CGGTCTCTATATTCCCTGTT
stFf ATT TTTCTTTCTGTATTGTCTT st Heat-stable enterotoxin 190 (López-Saucedo et al., 2003)
stRr CACCCGGTACAAGCAGGATT
bfpAf AATGGTGCTTGCGCTTGCTGC bfpA Bundle-forming pili 324 (López-Saucedo et al., 2003)
bfpAr GCCGCTTTATCCAACCTGGTA
eaeAf GACCCGGCACAAGCATAAGC eaeA Structural gene for intimin 384 (López-Saucedo et al., 2003)
eaeAr CCACCTGCAGCA ACA AGA GG
Ialf GGT ATG ATG ATG ATG AGT CCA ial Invasion-associated locus 650 (López-Saucedo et al., 2003)
Ialr GGA GGC CAA CAA TTA TTT CC
Stx1F CTGGATTTAATGTCGCATAGTG stx1 Shiga toxin 1 150 (López-Saucedo et al., 2003)
Stx1R AGAACGCCCACTGAGATCATC
Stx2F GGCACTGTCTGAAACTGCTCC stx2 Shiga toxin 2 255 (López-Saucedo et al., 2003)
Stx2R TCGCCAGTTATCTGACATTCTG
O157F CGGACATCCATGTGATATGG rfbO157 Polisacárido específico O 259 (Paton & Paton, 1998)
O157R TTGCCTATGTACAGCTAATCC
chuA.1b ATGGTACCGGACGAACCAAC chuA Membrane hemin receptor 288 (Clermont et al., 2013)
chuA.2 TGCCGCCAGTACCAAAGACA
yja.1b CAAACGTGAAGTGTCAGGAG yjaA Stress response protein 211 (Clermont et al., 2013)
yja.2b AATGCGTTCCTCAACCTGTG
ArpAgpE.f GATTCCATCTTGTCAAAATATGCC arpA Regulator of acetyl CoA synthetase 301 (Clermont et al., 2013)
ArpAgpE.r GAAAAGAAAAAGAATTCCCAAGAG
trpAgpC.1 AGTTTTATGCCCAGTGCGAG trpA Operon leader peptide 219 (Clermont et al., 2013)
trpAgpC.2 TCTGCGCCGGTCACGCCC
trpBA.f CGGCGATAAAGACATCTTCAC trpA (control interno) Operon leader peptide 489 (Clermont et al., 2013)
trpBA.r GCAACGCGGCCTGGCGGAAG
TSPE4C2 f CACTATTCGTAAGGTCATCC TspE4.C2 Anonymous DNA fragment 152 (Clermont et al., 2013)
TSPE4C2 r AGTTTATCGCTGCGGGTCGC
blaTEMf ATAAAATTCTTGAAGACGAAA blaTEM beta-lactamase TEM 1080 (Ahmed et al., 2007)
blaTEMr GACAGTTACCAATGCTTAATC
blaSHVf TTATCTCCCTGTTAGCCACC blaSHV beta-lactamase SHV 795 (Ahmed et al., 2007)
blaSHVr GATTTGCTGATTTCGCTCGG
blaCTXM f CGCTTTGCGATGTGCAG blaCTXM beta-lactamase CTX M 550 (Ahmed et al., 2007)
blaCTXM r ACCGCGATATCGTTGGT
blaOXAf TCAACTTTCAAGATCGCA blaOXA beta-lactamase OXA 591 (Ahmed et al., 2007)
blaOXAr GTGTGTTTAGAATGGTGA
blaCMYf GACAGCCTCTTTCTCCACA blaCMY beta-lactamase CMY 1000 (Ahmed et al., 2007)
blaCMYr TGGAACGAAGGCTACGTA

STATISTICAL ANALYSIS

The prevalence of E. coli pathotypes, identified phylogenetic groups, resistance to antibiotics and the frequency of ESBL genes were analysed using descriptive statistics. The proportion of molecular markers among DEC strains was determined by binomial test. The two-tailed Fisher’s exact test was used to test for associations between the categorical variables (when the expected frequencies were under 5), with a significance level of P<0.05. The statistical analysis was carried out using the IBM SPSS statistical package (Chicago SPSS Inc).

RESULTS

IDENTIFICATION OF DIARRHEAGENIC E. COLI

One hundred and twenty-six (90%) strains of E. coli were isolated from faecal samples of 140 captive collared peccaries. DEC strains were identified in 44.4% (N = 56) of the peccaries carrying E. coli. Among the DEC strains, ETEC (35.7%) was the category with the highest prevalence, followed by EAEC (28.6%), STEC (21.4%) and EPEC (14.3%). The PCR analysis showed a statistically significant prevalence for the ETEC and EAEC categories. No EHEC strain was detected on MacConkey/sorbitol agar plates, these strains did not carry the eae and hlyA genes, and the genetic marker rfbO157 was not amplified by PCR in any of the STEC strains (table 2).

Table 2 DEC strains and their virulence genes isolated in Pecari tajacu from Chiapas, Mexico. 

PCR was used to determine the phylogenetic group of DEC strains isolated in captive collared peccary. Among the identified strains of E. coli (N= 56), the highest number of DEC strains were grouped in Clade I (58.9%), followed by the phylogroup B2 (10.7%) and A (8.9%). Some DEC strains could not be assigned to any known phylogroup (21.4%).

ANTIMICROBIAL SUSCEPTIBILITY OF DEC STRAINS

Three-thirds of the DEC strains were not susceptible to the antibiotic ampicillin (75%), while half of the strains were not susceptible to carbenicillin (51.8%). Resistance to ampicillin was also found in EAEC (81.3%), ETEC (80%), EPEC (62.5%) and STEC (50%) (table 3). Among the DEC strains not susceptible to ampicillin, 88.1% (N= 37) were susceptible to the antibiotic amoxicillin-clavulanic acid. Sixty-seven-point nine per cent (67.9%; N = 38) of the DEC strains were not susceptible to at least one antibiotic in three different categories of antimicrobials; thereby, these strains were considered Multidrug Resistant (MDR). No DEC strain was classified as Extensively Drug-Resistant (XDR). In general, most of the strains were susceptible mainly to chloramphenicol (94.6%), gentamicin (92.9%), amoxicillin-clavulanic acid (91.1%), sulfamethoxazole trimethoprim (89.3%) and tetracycline (87.5%).

The PCR was used to determine the frequency of genes encoding β-lactamase in the 42 DEC strains not susceptible to ampicillin. The combination of the genes blaTEM + blaCTX and blaTEM + blaSHV (6 strains respectively) was the most frequent among the DEC strains, followed by the combination of the blaTEM and blaCTX genes (4 strains respectively). The blaTEM (N=3) and blaCTX (N=3) genes were amplified more frequently among ETEC strains not susceptible to ampicillin. In the EAEC strains, both blaTEM + blaCTX genes were amplified (N=3). In STEC strains susceptible to ampicillin, both blaTEM + blaCTX and blaTEM + blaSHV genes were amplified (2 strains, respectively) (table 4).

Table 3 Antimicrobial non-susceptibility of DEC strains (56). 

Antimicrobial Diarrheagenic Escherichia coli pathotypes % non-susceptibility (n)
DEC ETEC EAEC STEC EPEC
(N=56) (N=20) (N=16) (N=12) (N=8)
AMP 75 (42) 80 (16) 81.3 (13) 50 (6) 62.5 (5)
AMC 8.9 (5) 10 (2) 0 16.7 (2) 12.5 (1)
CAR 51.8 (29) 60 (12) 37.5 (6) 50 (6) 62.5 (5)
OXA 10.7 (6) 15 (3) 6.3 (1) 16.7 (2) 0
AMK 12.5 (7) 5 (1) 12.5 (2) 25 (3) 12.5 (1)
GEN 5.4 (3) 5 (1) 6.3 (1) 8.3 (1) 0
NET 33.9 (19) 45 (9) 31.3 (5) 25 (3) 25 (2)
CEF 10.7 (6) 5 (1) 12.5 (2) 16.7 (2) 25 (2)
CTX 32.1 (18) 30 (6) 31.3 (5) 25 (3) 50 (4)
CIP 37.5 (21) 40 (8) 50 (8) 33.3 (4) 12.5 (1)
NOR 30.4 (17) 35 (7) 37.5 (6) 25 (3) 12.5 (1)
CHL 3.6 (2) 10 (2) 0 8.3 (1) 12.5 (1)
SXT 5.4 (3) 5 (1) 0 8.3 (1) 12.5 (1)
NIT 12.5 (7) 5 (1) 12.5 (2) 25 (3) 12.5 (1)
TET 8.9 (5) 5 (1) 6.3 (1) 25 (3) 0

AMP; Ampicillin, AMC; Amoxicillin-clavulanic acid, CAR; Carbenicillin, OXA; Oxacillin, AMK; Amikacin, GEN; Gentamicin, NET; Netilmicin, CEF; Cephalotin, CTX; Cefotaxime, CIP; Ciprofloxacin, NOR; Norfloxacin, CHL; Chlorampphenicol, SXT; Trimethoprim-sulfamethoxazole, NIT; Nitrofurantoin, TET; Tetracycline.

Table 4 Genes of extended spectrum β-lactamase producing DEC strains isolated in collared peccary. 

DEC groups (n) Non susceptible profile β-lactamase gene
AMP Gene Number of isolates
DEC (56) 42 blaTEM 4
blaCTX 4
blaTEM+blaCTX 6
blaTEM+blaSHV 6
ETEC (20) 16 blaTEM 3
blaCTX 3
blaTEM+blaSHV 2
EAEC (16) 13 blaTEM+blaCTX 3
blaTEM 1
blaTEM+blaSHV 1
STEC (12) 6 blaTEM+blaCTX 2
blaTEM+blaSHV 2
EPEC (8) 5 blaCTX 1
blaTEM+blaCTX 1
blaTEM+blaSHV 1

DISCUSSION

In several countries of the Americas, sustainable strategies for the conservation, reproduction, and reintroduction of collared peccary have been proposed through Wildlife Management Units (WMU) (Sisk et al., 2007). The present study showed that 44.4% of the E. coli strains isolated in collared peccary faeces kept in WMU are carriers of genes that encode virulence factors of diarrheagenic pathotypes, mainly ETEC (lt and st) and EAEC (aap and AA probe), followed by STEC non-O157 (stx1 and stx2) and EPEC (bfpA and eaeA). The DEC virulence is mainly based on the ability to produce isoforms of the encoded protein related to infections in humans (Taghadosi et al., 2018; Angulo et al., 2021; Alfinete et al., 2022). These results are consistent with previous studies demonstrating that the wild collared peccary is a carrier of bacteria associated with humans and domestic animals. In the southern areas of the United States, isolates of Clostridium perfringens type A and multiple Salmonella serotypes were reported in wild Pecari tajacu (Shender et al., 2009), in addition to other possible Salmonella and STEC non-O157 serotypes (Jay- Russell et al., 2014). Other bacteria have been reported in the collared peccary, such as Mycoplasma hyopneumoniae, P. multocida (de Castro et al., 2014), Brucella and different serovars of Leptospira (Mendoza et al., 2007; Montenegro et al., 2018). However, to date there are no reports on the prevalence of diarrheagenic pathotypes of E. coli in captive collared peccary.

The present study demonstrated a higher prevalence of virulence genes of DEC pathotypes in captive collared peccaries compared with the prevalence of stx1, eaeA and hlyA showed in a study conducted on wild collared peccaries (Jay-Russell et al., 2014). This suggests that captive peccaries are more exposed to these pathogens. Wild peccaries may have suitable environmental conditions such as the type of habitat and availability of food resources (Hernández-Pérez, 2019). The population density of wild peccaries is also much lower. In the WMU containing collared peccary, food and vegetables are frequently introduced and it cannot be ruled out that plant material can spread diarrheagenic E. coli strains; there is evidence that these products can be a reservoir of multidrug resistant bacteria harbouring antibiotic resistance and virulence genes (Richter et al., 2021).

The presence of livestock also plays an important role in the dissemination of this bacteria to the environment and could be the main link in the contamination route to collared peccaries. There is evidence of domestic animals acting as carriers of strains of DEC mainly cattle (Gutema et al., 2021), sheep, and goats (Shabana & Al-Enazi, 2020), birds (Kimura et al., 2021) and pigs (Misumi et al., 2021). In Mexico, DEC strains have been reported in humans and animals (Rivas-Ruiz et al., 2020; Tamayo-Legorreta et al., 2020). In southeastern Mexico, where the WMU of the collared peccaries under study are located, this type of DEC strains have been reported in captive green iguanas (Bautista-Trujillo et al., 2020).

A PCR-based phylogenetic group assay was performed as proposed by Clermont et al. (2013). The highest frequencies of the ETEC, EAEC, STEC stx1 and STEC stx2 pathotypes, as well as EPEC, were found in Clade I, with lower frequencies in phylogroups B2 and A. Some strains could not be assigned to a known clade. A previous study on the characterisation of E. coli isolated in wastewater found the highest frequency of EPEC in phylogroup B2, followed by B1, C and A, while STEC strains were grouped in phylogroup B1 (Cho et al., 2018). Clonal lineage strains in diarrheic poultry, in Tunisia, which could constitute a risk of their transfer to healthy animals and humans, enteropathogenic (EPEC) and extraintestinal (ExPEC) infections mainly belonging to the phylogroups B2 (Jouini et al., 2021). The concentration of environmental strains into different groups could be explained by the phylogenetic variability of E. coli, based on their genetic content and diverse lineage. A consequence of this is the difficulty to associate pathogenic strains and commensals to a specific phylogroup, which is why the use of molecular techniques with greater clonal discrimination power for DEC strains such as MLST and PFGE is suggested (Su et al., 2021). In the present study, most (75%) of the DEC strains isolated in captive collared peccary were not susceptible to ampicillin, while 51.8% were not susceptible to carbenicillin. Overall, more than half of the DEC strains were not susceptible to at least one antibiotic from three different categories tested (MDR), mainly beta-lactams, aminoglycosides, cephalosporins, fluoroquinolones and nitrofurantoin. Resistance to beta-lactams such as ampicillin was observed in DEC isolated from canaries (Kimura et al. 2021), pigs (Misumi et al., 2021) and bovines, cow meat and humans (Gutema et al., 2021). In Mexico, multidrug resistant E. coli infections are a common occurrence, and the incidence of DEC strains resistant mainly to ampicillin and tetracycline has been reported in bovine faeces (Navarro et al., 2018), beef and pork (Martínez-Vázquez et al., 2018), as well as in humans (Castro et al., 2019). There is evidence that the constant oral-faecal transmission of antibiotic-resistant E. coli between animals, humans, and the environment, favours the horizontal transfer of resistance genes between different microorganisms sharing the same niche (Abdel- Rhman et al., 2021; Puvača & Frutos, 2021). This could be the hypothesis of a possible route of dissemination of multidrug resistant DEC strains among captive collared peccaries; however, further research is required.

Other antibiotic resistance genes have been reported in E. coli from livestock such as those from the polymyxins family (Ilbeigi et al., 2021), however, efficacy is poorly understood in the veterinary practice in Mexico (Martínez et al., 2020). In the present study, most of the DEC strains isolated in the captive collared peccary were not susceptible to beta-lactams. The presence of genes coding for β-lactamase was evidenced in DEC strains isolated in captive collared peccary, mainly blaTEM, blaCTX and blaSHV. These findings are consistent with those reported by other authors who found the blaTEM, blaCTX and blaSHV genes in multidrug-resistant diarrheagenic E. coli strains in humans and animals (Quino et al., 2020; Shafiq et al., 2021). The results confirm that captive collared peccaries can act as carriers of multiresistant Escherichia coli containing genes associated with ESBL. Further research is required to make a genetic characterization of bla profiles and carbenicillin-hydrolyzing ß-lactamases. This study reported the presence of DEC in captive collared peccaries. The ETEC, EAEC, STEC stx1, STECstx1 stx2 and EPEC pathotypes, carrying ESBL genes, were identified in captive collared peccary faeces, with resistance characteristics against beta-lactam antibiotics. The information from this work contribute to develop sanitary strategies for the management of collared peccary in captivity. Further research on the risk factors associated with the prevalence of DEC in captive peccary would allow to better understand how bacteria spread among captive animals and to reduce their capacity to act as carriers of DEC strains.

ACKNOWLEDGEMENTS

The authors would like to thank the personnel of the Wildlife Management Units of the State of Chiapas, Mexico, for the assistance provided. Permission to handle the animals under study was given by the personnel of the Wildlife Management Units. Financial support was partially granted to JG-J by the Program or Strengthening Educational Quality of the University of Science and Arts of the State of Chiapas (grant number C/PFCE-2016-07MSU0002G-13-43). Also, financial support was partially granted to QB-B by the National Council of Science and Technology (Conacyt).

REFERENCES

Abdel-Rhman, S. H., Elbargisy, R. M., & Rizk, D. E. (2021). Characterization of integrons and quinolone resistance in clinical Escherichia coli isolates in Mansoura City, Egypt. International Journal of Microbiology, 2021. https://doi.org/10.1155/2021/6468942Links ]

Ahmed, A. M., Motoi, Y., Sato, M., Maruyama, A., Watanabe, H.,Fukumoto, Y., & Shimamoto, T. (2007). Zoo animals as reservoirs of gram-negative bacteria harboring integrons and antimicrobial resistance genes. Applied and Environmental Microbiology, 73(20). https://doi.org/10.1128/AEM.01054-07Links ]

Alfinete, N., Bolukaoto, J. Y., & Barnard, T. G. (2022). Virulence and phylogenetic analysis of enteric pathogenic Escherichia coli isolated from children with diarrhoea in South Africa. International Journal of Infectious Diseases, 114. https://doi.org/10.1016/j. ijid.2021.11.017Links ]

Angulo, U. A., Gutiérrez, J. J., & Canizalez, R. A. (2021). Non-diarrheagenic and diarrheagenic E. coli carrying supplementary virulence genes (SVG) are associated with diarrhea in children from Mexico. Microbial pathogenesis, 157. https://doi.org/10.1016/j.micpath.2021.104994Links ]

Bautista-Trujillo, G. U., Gutiérrez-Miceli, F. A., Mandujano-García, L., Oliva-Llaven, M. A., Ibarra-Martínez, C., Mendoza-Nazar, P., Ruiz- Sesma, B., Tejeda-Cruz, C., Pérez-Vázquez, L. C., Pérez-Batrez, J. E., Vidal, J. E., & Gutiérrez-Jiménez, J. (2020). Captive green iguana carries diarrheagenic Escherichia coli pathotypes. Frontiers in Veterinary Science, 7. https://doi.org/10.3389/fvets.2020.00099Links ]

Castro, A. M., Mercado-Alquicira, C., Cervantes-Olmos, R. A., & Arzate-Barbosa, P. (2019). Comparative study between diarrheagenic Escherichia coli virotypes from Mexico City and San Luis Potosí. Revista Médica Del Hospital General de México, 82(2). https://doi. org/10.24875/hgmx.m19000022Links ]

Cerna, J. F., Nataro, J. P., & Estrada-Garcia, T. (2003). Multiplex PCR for detection of three plasmid-borne genes of enteroaggregative Escherichia coli strains. Journal of Clinical Microbiology, 41(5), 2138-2140. https://doi.org/10.1128/JCM.41.5.2138-2140.2003Links ]

Cho, S., Hiott, L. M., Barrett, J. B., McMillan, E. A., House, S. L.,Humayoun, S. B., Adams, E. S., Jackson, C. R., & Frye, J. G. (2018). Prevalence and characterization of Escherichia coli isolated from the upper oconee watershed in Northeast Georgia. PLoS ONE, 13(5). https://doi.org/10.1371/journal.pone.0197005Links ]

Clermont, O., Christenson, J. K., Denamur, E., & Gordon, D. M. (2013). The Clermont Escherichia coli phylo-typing method revisited: Improvement of specificity and detection of new phylo-groups. Environmental Microbiology Reports, 5(1), 58-65. https://doi. org/10.1111/1758-2229.12019Links ]

Croxen, M. A., Law, R. J., Scholz, R., Keeney, K. M., Wlodarska, M.,& Finlay, B. B. (2013). Recent advances in understanding enteric pathogenic Escherichia coli. In Clinical Microbiology Reviews 26(4). https://doi.org/10.1128/CMR.00022-13Links ]

de Carvalho, M. A. G., Santos, P. S., da Cunha Nogueira, S. S., Lessa, F., Almeida, V. D. A., Leça-Junior, N. F., Salvarani, F. M., Lobato,F. C. F., & Nogueira-Filho, S. L. G. (2011). Necrotic enteritis in collared (Pecari tajacu) and white-lipped (Tayassu pecari) peccaries. Journal of Zoo and Wildlife Medicine, 42(4). https://doi. org/10.1638/2010-0212.1Links ]

de Castro, A. M. M. G., Brombila, T., Bersano, J. G., Soares, H. S., de Souza Silva, S. O., Minervino, A. H. H., Ogata, R. A., Gennari,S. M., & Richtzenhain, L. J. (2014). Swine infectious agents in Tayassu pecari and Pecari tajacu tissue samples from Brazil. Journal of Wildlife Diseases, 50(2). https://doi.org/10.7589/2013-01-021Links ]

Faridah-Hayyun, D., Dewi, E. K., Fatimah, M. H. E., & Plumeriastuti, H. (2020). A review of antimicrobial resistance (AMR) of Escherichia coli on livestock and animal products: Public health importance. Systematic Reviews in Pharmacy, 11(11), 1210-1218. [ Links ]

Gutema, F. D., Rasschaert, G., Agga, G. E., Jufare, A., Duguma, A. B., Abdi, R. D., Duchateau, L., Crombe, F., Gabriël, S., & de Zutter, L. (2021). Occurrence, molecular characteristics, and antimicrobial resistance of Escherichia coli O157 in cattle, beef, and humans in Bishoftu Town, Central Ethiopia. Foodborne Pathogens and Disease, 18(1). https://doi.org/10.1089/fpd.2020.2830Links ]

Gutiérrez-Jiménez, J., Luna-Cazáres, L. M., Mendoza-Orozco, M. I., Díaz- Marina, G. de J., Burguete-Gutiérrez, J. C., & Feliciano-Guzmán, J. M. (2015). Organización, mantenimiento y preservación de la Colección de Cultivos Bacterianos del Instituto de Ciencias Biológicas de la Universidad de Ciencias y Artes de Chiapas (UNICACH), México. Revista de La Sociedad Venezolana de Microbiología, 35(2). [ Links ]

Hernández-Pérez, E. L. (2019). Distribución potencial del cerdo asilvestrado, Sus scrofa (Artiodactyla: Suidae) y el pecarí de collar, Pecari tajacu (Artiodactyla: Tayassuidae) en la región de Laguna de Términos, México. Revista de Biología Tropical, 67(6). https:// doi.org/10.15517/rbt.v67i6.37006Links ]

Ilbeigi, K., Askari Badouei, M., Vaezi, H. & Khatereh Kafshdouzan. (2021). Molecular survey of mcr1 and mcr2 plasmid mediated colistin resistance genes in Escherichia coli isolates of animal origin in Iran. BMC Research Notes. 14(107). https://doi.org/10.1186/ s13104-021-05519-6Links ]

Jay-Russell, M. T., Hake, A. F., Rivadeneira, P., Virchow, D. R., & Bergman, D. L. (2014). Enteric human pathogens of wild boar, feral swine, and javelina (Order: Artiodactyla). Proceedings of the Vertebrate Pest Conference, 26. https://doi.org/10.5070/v426110701Links ]

Jouini, A., Klibi, A., & Maaroufi, A. (2021). First Detection of Human ST131-CTX-M-15-O25-B2 Clone and High-Risk Clonal Lineages of ESBL/pAmpC-Producing E. coli Isolates from Diarrheic Poultry in Tunisia. Antibiotics, 10 (670). https://doi.org/10.3390/ antibiotics10060670Links ]

Kimura, A. H., Koga, V. L., de Souza Gazal, L. E., de Brito, B. G., de Brito, K. C. T., Navarro-Ocaña, A., Nakazato, G., & Kobayashi, R. K. T. (2021). Characterization of multidrug-resistant avian pathogenic Escherichia coli: an outbreak in canaries. Brazilian Journal of Microbiology, 52(2). https://doi.org/10.1007/s42770-021-00443-0 Links ]

López-Saucedo, C., Cerna, J. F., Villegas-Sepulveda, N., Thompson, R., Velazquez, F. R., Torres, J., Tarr, P. I., & Estrada-Garcia, T. (2003). Single multiplex polymerase chain reaction to detect diverse loci associated with diarrheagenic Escherichia coli. Emerging Infectious Diseases, 9(1), 127-131. https://doi.org/10.3201/eid0901.01-0507Links ]

Magiorakos, A. P., Srinivasan, A., Carey, R. B., Carmeli, Y., Falagas, M. E., Giske, C. G., Harbarth, S., Hindler, J. F., Kahlmeter, G., Olsson- Liljequist, B., Paterson, D. L., Rice, L. B., Stelling, J., Struelens, M.J., Vatopoulos, A., Weber, J. T., & Monnet, D. L. (2012). Multidrug- resistant, extensively drug-resistant and pandrug-resistant bacteria: An international expert proposal for interim standard definitions for acquired resistance. Clinical Microbiology and Infection, 18(3). https://doi.org/10.1111/j.1469-0691.2011.03570.xLinks ]

Marinho, P. H., da Silva, M. D., & Lisboa, C. M. C. A. (2019). Presence of the collared peccary Pecari tajacu (Artiodactyla, Tayassuidae) in the far Northeast of its Brazilian distribution. Neotropical Biology and Conservation, 14(4). https://doi.org/10.3897/neotropical.14.e48716Links ]

Martínez, M, R., Gastélum-Acosta, M., & Osuna-Álvarez, L. E. (2020). Actividad antimicrobiana de ceftolozano-tazobactam y ceftazidima- avibactam contra bacilos gramnegativos clínicamente relevantes aislados en México. Gaceta médica de México. 156(6). https://doi. org/10.24875/gmm.19005335Links ]

Martínez-Vázquez, A. V., Rivera-Sánchez, G., Lira-Méndez, K., Reyes- López, M. Á., & Bocanegra-García, V. (2018). Prevalence, antimicrobial resistance and virulence genes of Escherichia coli isolated from retail meat in Tamaulipas, Mexico. Journal of Global Antimicrobial Resistance, 14. https://doi.org/10.1016/j.jgar.2018.02.016Links ]

Mendoza, P., Mayor, P., Gálvez, H. A., Céspedes, M. J., & Jori, F. (2007). Antibodies against Leptospira spp. in captive collared peccaries, Peru. In Emerging Infectious Diseases 13(5). https://doi.org/10.3201/ eid1305.060027Links ]

Misumi, W., Funamori, T., Hamada, K., Iwamoto, J., Fujisono, S., Chitose, K., & Kusumoto, M. (2021). Association between antimicrobial treatment and resistance of pathogenic escherichia coli isolated from diseased swine in kagoshima prefecture, Japan. Journal of Veterinary Medical Science, 83(3). https://doi.org/10.1292/jvms.20-0338Links ]

Molina-Barrios, R., Luevano-Adame, J., Henao-Díaz, Y. A., Giménez- Lirola, L., Piñeyro, P., Magtoto, R., Cedillo-Cobián, J., Díaz-Rayo, C., Hernández, J., & Zimmerman, J. (2018). Collared peccary (Pecari tajacu) are susceptible to porcine reproductive and respiratory syndrome virus (PRRSV). Transboundary and Emerging Diseases, 65(6). https://doi.org/10.1111/tbed.12944Links ]

Montenegro, O. L., Roncancio, N., Soler-Tovar, D., Cortés-Duque, J., Contreras-Herrera, J., Sabogal, S., Acevedo, L. D., & Navas-Suárez, P. E. (2018). Serologic survey for selected viral and bacterial swine pathogens in colombian collared peccaries (Pecari tajacu) and feral pigs (Sus scrofa). Journal of Wildlife Diseases, 54(4). https://doi. org/10.7589/2017-09-236Links ]

Navarro, A., Cauich-Sánchez, P. I., Trejo, A., Gutirrez, A., Díaz, S. P., Martha, D. C., Cravioto, A., & Eslava, C. (2018). Characterization of diarrheagenic strains of Escherichia coli isolated from cattle raised in three regions of Mexico. Frontiers in Microbiology, 9(OCT). https://doi.org/10.3389/fmicb.2018.02373Links ]

Oh, K.-H., Shin, E., Jung, S.-M., Im, J., Cho, S.-H., Hong, S., Yoo, C.-K.,& Chung, G. T. (2016). First isolation of hybrid Shigatoxigenic and Enterotoxigenic Escherichia coli (STEC/ETEC) strain harboring stx2 and elt genes in Republic of Korea. Japanese Journal of Infectious Diseases, JJID-2016. [ Links ]

Paton, A. W., & Paton, J. C. (1998). Detection and characterization of Shiga toxigenic Escherichia coli by using multiplex PCR assays for stx 1, stx 2, eaeA, enterohemorrhagic E. coli hlyA, rfb O111, and rfb O157. Journal of Clinical Microbiology, 36(2), 598-602. [ Links ]

Puvača, N., & Frutos, R. de L. (2021). Antimicrobial resistance in escherichia coli strains isolated from humans and pet animals. Antibiotics, 10(1). https://doi.org/10.3390/antibiotics10010069Links ]

Quino, W., Mestanza, O., Caro-Castro, J., Hurtado, C. V., & Gavilán, R.G. (2020). Resistoma y genómica comparativa de aislados clínicos de Escherichia coli diarreogénica en Lima, Perú. Revista Peruana de Medicina Experimental y Salud Pública, 37(4). https://doi. org/10.17843/rpmesp.2020.374.5240Links ]

Richter, L., Plessis, E. du, Duvenage, S., & Korsten, L. (2021). High prevalence of multidrug resistant Escherichia coli isolated from fresh vegetables sold by selected formal and informal traders in the most densely populated Province of South Africa. Journal of Food Science, 86(1). https://doi.org/10.1111/1750-3841.15534Links ]

Rivas-Ruiz, C. M., Cantú-Soto, E. U., Maldonado-Mendoza, I. E., Figueroa-López, A. M., Anduro-Jordan, J. A., Luna-Nevarez, P.,& López-Castro, P. A. (2020). Detection of Shiga toxin-producing Escherichia coli in asymptomatic cattle in the southern Sonora, Mexico. Ecosistemas y Recursos Agropecuarios, 7(2). https://doi. org/10.19136/era.a7n2.2240Links ]

Shabana, I. I., Zaraket, H., & Suzuki, H. (2013). Molecular studies on diarrhea-associated Escherichia coli isolated from humans and animals in Egypt. Veterinary Microbiology, 167(3-4). https://doi. org/10.1016/j.vetmic.2013.08.014Links ]

Shabana, I. I., & Al-Enazi, A. T. (2020). Investigation of plasmid-mediated resistance in E. coli isolated from healthy and diarrheic sheep and goats. Saudi Journal of Biological Sciences, 27(3). https://doi. org/10.1016/j.sjbs.2020.01.009Links ]

Shafiq, M., Huang, J., Shah, J. M., Ali, I., Rahman, S. U., & Wang, L. (2021). Characterization and resistant determinants linked to mobile elements of ESBL-producing and mcr-1-positive Escherichia coli recovered from the chicken origin. Microbial Pathogenesis, 150. https://doi.org/10.1016/j.micpath.2020.104722Links ]

Shender, L. A., Glock, R. D., & Spraker, T. R. (2009). Salmonellosis in a free-ranging population of javelinas (Pecari tajacu) in south Central Arizona. Journal of Wildlife Diseases, 45(4). https://doi. org/10.7589/0090-3558-45.4.941Links ]

Sisk, T. D., Castellanos V, A. E., & Koch, G. W. (2007). Ecological impacts of wildlife conservation units policy in Mexico. Frontiers in Ecology and the Environment, 5(4). https://doi. org/10.1890/1540-9295(2007)5[209:EIOWCU]2.0.CO;2 [ Links ]

Su, Z., Zhang, L., Sun, H., Hu, Y., Fanning, S., Du, P., Cui, S., & Bai, L. (2021). Characterization of non-O157 Shiga toxin-producing Escherichia coli cultured from cattle farms in Xinjiang Uygur Autonomous Region, China, During 2016-2017. Foodborne Pathogens and Disease. https://doi.org/10.1089/fpd.2020.2843Links ]

Taghadosi, R., Shakibaie, M.R., & Ghanbarpour R. (2018). Serogroups, subtypes and virulence factors of shiga toxin producing Escherichia coli isolated from human, calves and goats in Kerman, Iran. Gastroenterololy Hepatology Bed Bench, 11(1). PMID: 29564067; PMCID: PMC5849120. [ Links ]

Taghadosi, R., Shakibaie, M. R., & Hosseini-Nave, H. (2019). Antibiotic resistance, ESBL genes, integrons, phylogenetic groups and MLVA profiles of Escherichia coli pathotypes isolated from patients with diarrhea and farm animals in south-east of Iran. Comparative Immunology, Microbiology and Infectious Diseases, 63. https://doi. org/10.1016/j.cimid.2019.01.004Links ]

Tamayo, E. M., García-Radilla., & Alpuche-Aranda, C. M. (2021). Diarrheagenic Escherichia coli pathotypes isolated from a swine farm in a region of Morelos state, Mexico. Salud Pública de México, 63(1). https://doi.org/10.21149/11268Links ]

Tsai, Y. L., Palmer, C. J., & Sangermano, L. R. (1993). Detection of Escherichia coli in sewage and sludge by polymerase chain reaction. Applied and Environmental Microbiology, 59(2). https:// doi.org/10.1128/aem.59.2.353-357.1993Links ]

Wayne, P. A. (2020). Clinical and Laboratory Standards Institute (CLSI). Performance Standards for Antimicrobial Susceptibility Testing. 30th ed. CLSI Supplement M100. [ Links ]

[2]

Received: October 20, 2021; Accepted: January 12, 2022

*Corresponding author: GU Bautista-Trujillo; gerardourielbautista@ gmail.com

COMPETING INTERESTS STATEMENT

The authors declare that this study was carried out in the absence of commercial or financial relationships that could be interpreted as a potential conflict of interest and all persons gave their informed consent prior to their inclusion in the study.

AUTHOR CONTRIBUTIONS CQ-B, CT-C and GUB-T conceived and design of the study. CQ-B, CI-M, MO-Ll, MR-S and GUB-T obtained faecal samples from peccaries, as well laboratory work. CAC-G and JG-J determine virulence genes and phylogenetic analyses. GB-T, CAC-G, SM-G and JG-J performed the statistical analysis and wrote the first draft of the manuscript. All authors contributed to manuscript revision, read, and approved the submitted version.

Creative Commons License This is an open-access article distributed under the terms of the Creative Commons Attribution License