SciELO - Scientific Electronic Library Online

 
vol.48 número2The seasonal entrance of Penaeus setiferus and Penaeus duorarum postlarvae into Términos Lagoon, Campeche, MéxicoChilean benthic species identified as a new source of antibiotic substances índice de autoresíndice de materiabúsqueda de artículos
Home Pagelista alfabética de revistas  

Servicios Personalizados

Revista

Articulo

Indicadores

Links relacionados

  • En proceso de indezaciónCitado por Google
  • No hay articulos similaresSimilares en SciELO
  • En proceso de indezaciónSimilares en Google

Compartir


Latin american journal of aquatic research

versión On-line ISSN 0718-560X

Lat. Am. J. Aquat. Res. vol.48 no.2 Valparaíso mayo 2020

http://dx.doi.org/10.3856/vol48-issue2-fulltext-2424 

Research Article

Parental contribution in a cultivated stock for the spotted rose snapper Lutjanus guttatus (Steindachner, 1869) estimated by newly developed microsatellite markers

Ricardo Perez-Enriquez1 

Janeth A. Valadez-Rodríguez2 

Adriana Max-Aguilar1 

Silvie Dumas3 

Noe Diaz-Viloria3 

1Centro de Investigaciones Biológicas del Noroeste, La Paz, B.C.S., México

2Instituto Tecnológico de La Paz, La Paz, B.C.S., México

3Instituto Politécnico Nacional, Centro Interdisciplinario de Ciencias Marinas La Paz, B.C.S., México

ABSTRACT

The spotted rose snapper Lutjanus guttatus is a fishery relevant species from the eastern Pacific Ocean, with aquaculture potential. Species-specific genetic markers are needed for the genetic characterization of wild and cultivated populations to help management strategies. Eighteen hypervariable microsatellites were developed by Next Generation Sequencing and characterized in a wild population sample. Genetic diversity was high (observed heterozygosity = 0.88 ± 0.050; the number of alleles per locus = 13.4 ± 1.3) and few loci departed from the Hardy-Weinberg Equilibrium, leaving 14 loci potentially suitable for population genetic studies. A reduced panel of five loci was tested in a cultivated stock to determine the parentage of progeny (embryonated eggs; n = 413), to estimate the temporal contribution of each parental broodstock. The above resulted in the successful assignment of 95.6% of the progeny to its parental couple, representing 17 out of the 24 possible families. Two of the four females produced most of those progeny (97.3%). These females, which reproduced throughout the season, did not spawn on consecutive days. The contribution of males was evenly distributed during the season and occurred on successive days. Some microsatellites can be used in other lutjanids (L. peru, L. argentiventris, and Hoplopagrus guentherii).

Keywords: Lutjanus guttatus; population genetics; embryonic eggs; genetic markers; parentage assessment; reproductive performance

INTRODUCTION

The spotted rose snapper, Lutjanus guttatus (Steindachner, 1869), is a demersal marine finfish with a wide distribution range along the eastern Pacific Ocean from the Gulf of California in Mexico to Ecuador (Fischer et al., 1995). It is a valuable fishing resource in the region (Herrera-Ulloa et al., 2010; Sarabia-Méndez et al., 2010; Correa-Herrera & Jiménez-Segura, 2013), with a high potential for aquaculture (Ibarra-Castro et al., 2013). Lutjanus guttatus is a batch spawner with asynchronous ovarian development during a long reproductive season comprising peak spawning periods in April, August and October (Arellano-Martínez et al., 2001; Sarabia-Méndez et al., 2010). Little is known regarding the spawning contribution of females and males daily.

Microsatellite genetic markers are a necessary tool for the genetic characterization of wild populations that can be used, for example, to improve their management, in rehabilitation programs, and stock identification (Hallerman, 2003). They are also important in aquaculture as they can be used to determine female spawning frequency. Thus, the effective parental contribution [e.g., red sea bream Pagrus major (Perez-Enriquez et al., 1999), California yellowtail Seriola lalandi (Smith et al., 2015), gilthead seabream Sparus aurata (García-Fernández et al., 2018)], which due the disproportion in male to female contributions, large family size variance and null female spawners in the broodstock can lead to the potential accumulation of inbreeding within the hatchery (Blonk et al., 2009; Domingos et al., 2014). Other markers, such as Single Nucleotide Polymorphisms (SNPs), have shown reliable results for parentage testing in aquaculture species [e.g., shrimp (Perez-Enriquez & Max-Aguilar, 2016)]. However, for L. guttatus there is no previous genomic information available.

The present study aimed to obtain a set of microsatellite markers for future population genetic studies of L. guttatus and to test a reduced panel to estimate the temporal parental contribution in a cultivated stock of the species.

MATERIALS AND METHODS

Biological material

Fin clips of 10 Lutjanus guttatus individuals were collected in 2011 at the eastern coast of the Baja California Peninsula, Mexico, and preserved in 70% ethanol. Genomic DNA was obtained (Aljanabi & Martinez, 1997), and a DNA mix was sent to the Savannah River Ecology Laboratory, University of Georgia, U.S.A., for microsatellite screening by Next Generation Sequencing (Illumina library preparation and sequencing, bioinformatics analysis and primer design). A set of 48 primer pairs (tetra- and pentanecleotides) was tested in these 10 individuals. PCR was done in volumes of 11 μL containing 1 μL DNA as template (20 ng μL1), 1 × Taq Buffer, 1.5 mM MgCl2, 0.25 mM dNTPs, 0.4 μM of each forward and reverse primers (Macrogen, Korea), 0.025 U μL1 Taq polymerase (Promega, UK), and Milli-Q water. PCR thermal conditions (C1000 thermal cycler, Bio-Rad) were: 94°C for 2 min; 30 cycles at 94°C for 45 s, annealing temperature for 45 s, and 72°C for 1 min; then a final extension at 72°C for 10 min. The annealing temperature for each primer was calculated using the formula Ta = 4(C+G) + 2(A+T) - 5. The PCR products were separated on polyacrylamide gel electrophoresis (5%, 7.5 M urea; 1800 V, 50 mA, and 50 W). Fragments were visualized using Sybr-Gold within a 1% agarose matrix and scanned (FMBIOIII, Hitachi).

Genetic markers selection

A set of 18 microsatellite loci, showing reliable amplification patterns, was selected for characterization on the same 10 individuals, and their sequences (Macrogen) were deposited in GenBank (Table 1). PCR reactions were done in 20 μL volumes with the use of an M13 primer (5′-TGTAAAACGACGGCCAGT) labeled with the fluorophores 6-FAM, VIC, NED or PET at 1.6 μM, reverse primers at 1.6 μM, and forward primers having an extension of the M13 sequence at the 5'-end at 0.4 μM (Schuelke, 2000) (Table 1). The rest of the components were at the same concentrations as above. The amplification conditions were the same as above, but the final extension was set with eight additional cycles of 94°C for 30 s, M13-annealing at 53°C for 45 s, and 72°C for 45 s. Two μL of PCR products were added with 0.25 μL of LIZ500 Size Standard (Applied Biosystems) and 9.75 μL de HiDiformamide, placed in a 96-well microplate and put into the ABI 3130 automated DNA sequencer. The genotypes were obtained using the software Gene Mapper version 4.0 (Applied Biosystems).

Table 1 Characterization of a set of 18 microsatellites isolated from Lutjanus guttatus (F: forward; R: reverse). 

Locus Primer sequence (5′-3′) Repeat motif Fl Ta (°C) Allelic size range (pb) na Ho He HWE Bonf GenBank accesion CA
Lgut07 F: M13-TGATAATAACCATGCCCATATTTCC ATCT PET 63 270-338 10.0 0.778 0.902 0.141 N.S. ME416120 Lp
R: GCTTGTTCAGATTCAACCGC
Lgut15b F: M13-ACTCTGGTCTGGAGATTGGG ATGG PET 58 259-327 14.0 0.900 0.963 0.443 N.S. MF416121 Lp. La
R: TCAATCACGACAACAGTGACG
Lgut16b F: M13-GAGGTGTCTGTAATCTACAAATTCACC ATCT PET 63 233-331 13.0 1.000 0.958 1.000 N.S. MF416122 -
R: TCAACATTCTAACTGACTGTTTAGGC
Lgut18a b F: M13-AAACACTGGGTCTGGGTTGG AAAG 6FAM 56 235-317 14.0 0.900 0.947 0.620 N.S. MF416123 Lp, La
R: TCAACACTTGTTGGCTTCCC
Lgut19b F: M13-TGAATCAGCGACTCTGACAGC ATCT NED 58 291-422 18.0 0.900 0.984 0.185 N.S. MF416124 l.p, La, Hg
R: AOCCAGACTOGCTGTGCC
Lgut21a b F: M l3-AAGGAGGACTTTATTCCATCAGC ATCT 6FAM 60 231-363 14.0 0.900 0.947 0.561 N.S. MF416125 Lp, La
R: GGTGGACAGTTGGTTCATCC
Lgut26b F: M13-CCATCCTGGTTAGGTTGTTGC ATCT VIC 63 242-305 14.0 0.800 0.963 0.055 N.S. MF416126 Lp, La, Hg
R: GCAACCAAGAACTTCACTGTAACC
Lgut30a b F:M13-TCCTTTACATAGTTGTAATTGAGGAGG ATCT VIC 63 436-502 12.0 0.900 0.947 0.545 N.S. MF416127 -
R: ATCGGCACTATTGCATGTGG
Lgut32 F: M13-TCTTGCACACCAGATTCTTATGG ATCT NED 63 181-311 17.0 0.700 0.984 < 0.001 * MF416128 -
R: TCAAGATTTAAAGAGACATTTCACCC
Lgut34a b F: M13-GGTTTATTCAAATACACTGGTGCC ATCT PET 60 371-430 13.0 1.000 0.947 1.000 N.S. ME416129 Lp, La
R: CAGCTCCAAACCACTTCGC
Lgut37b F: M13-TTTCAAGGGCATTTATGTGGC ATCT VIC 58 364-424 10.0 0.800 0.911 0.150 N.S. MF416130 Lp
R: AAGATGCTCCGTAAGGTATCGC
Lgut38b F: M13-AAGAACTCTTGAGACAGTTGGGC ATCT PET 60 207-303 13.0 0.900 0.947 0.605 N.S. MF416131 Hg
R: TGTGTTTGTGTGAATTCTTGGC
Lgut39a b F: M13-AGGTCACATGACGACAGACG ATCT 6FAM 56 264-326 12.0 1.000 0.932 1.000 N.S. MF416132 Hg
R: TGCAGCTTTAAACATCCACG
Lgut40 F: M13-AAGACTATCGACTGCTGGTGTCC ATGG VIC 63 226-335 13.0 0.700 0.953 0.005 N.S. MF416133 -
R: GCAAAGTTAGGGCACAACATCC
Lgut43b F: Ml3-TTTGGGAATTATGTTCATTTGC ATCT 6FAM 56 236-292 11.0 0.900 0.942 0.638 N.S. N.A.c Lp
R: ATGCAAATGTTGTGCCTGC
Lgut44b F: Ml3-CGTGTCACATCTCTGTGTTAATGC AAGAG NED 63 263-352 17.0 0.800 0.984 0.026 N.S. MF416134 Lp, La
R: TGACGCGTCTCTGATTACCC
Lgut46b F: M13-AAGGACAGCAAAGAGGCTCG ACGTG NED 58 215-270 10.0 1.000 0.916 0.822 N.S, MF416135 -
R: GAGCTGCACATCAGGAGGG
Lgut47 F: M13-GCTGTCATCAACGCTACTGC ATATT 6FAM 56 236-297 16.0 0.900 0.968 0.445 N.S. MF416136 -
R: AAATGGGCCTCAAATGGC
Mean - - - 13.4 0.877 0.950 - -

M13 is the sequence 5′TGTAAAACGACGGCCAGT included at the beginning of the forward primer. Fl: fluorophore; Ta: annealing temperature; na: number of alleles per locus; Ho: observed heterozygosity; He: expected heterozygosity; HWE: the probability of deviation from Hardy-Weinberg Equilibrium; Bonf: Significance after Bonferroni correction (N.S.: non-significant; *significant values); N.A.: not available. CA: positive cross-amplification with Lutjanus peru (Lp), Lutjanus argentiventris (La) and Hoplopagrus guentherii (Hg). GenBank accession numbers are provided.

aLoci used for the parental contribution analysis

bLoci suitable for population genetics studies

cThe amplification of this locus for sequencing failed

Allele frequencies per locus were calculated with the program Arlequin version 3.5 (Excoffier & Lischer, 2010), and used to estimate genetic diversity parameters [number of alleles per locus; observed (Ho) and expected (He) heterozygosities] and Hardy-Weinberg Equilibrium (HWE) (Exact test using a Markov chain: 50,000 dememorizations, 100,000 steps). The potential presence of null alleles, stuttering, or allele drop-out was assessed with the program Micro-Checker (Van-Oosterhout et al., 2004).

Cross-amplification of microsatellites was tested in three lutjanid species: red snapper Lutjanus peru (Nichols & Murphy, 1922) (n = 5), yellow snapper Lutjanus argentiventris (Peters, 1869) (n = 4), and greenbar snapper Hoplopagrus guentherii (Gill, 1862) (n = 1), all collected from the Gulf of California.

Broodstock management

The 10 individuals of L. guttatus described in the previous section (six males, four females) were kept in a maturation tank equipped with an external spawn collector, at the Centro Interdisciplinario de Ciencias Marinas-IPN, México. They were fed daily at satiation with sardines and squid. During the reproductive season of 2011 (June-October), spontaneous spawning was obtained. For each collected spawn, viable embryonated eggs were separated from dead eggs by buoyancy. A fraction of those was collected and preserved in 1.5 mL microcentrifugation tubes with 70% ethanol. From a total of 36 spawns, the embryonated eggs from 14 spawning events were sampled for DNA analysis (12, 13, 14 July; 4, 14, 22 August; 8, 9, 10 September; 14, 15, 16, 20, 21 October).

The embryonated eggs were individually separated using a microscope (Olympus CX31), and only those from the late gastrula developmental stage were selected, as earlier stages failed to amplify PCR products adequately. Remnants of ethanol were evaporated, and embryonated eggs were put into individual tubes with 18 μL of MilliQ water. They were preserved at −20°C. For DNA release, embryonated eggs were unfrozen, smashed with a plastic pestle and centrifuged at 1,533 g for 1 min. The supernatant was used as a DNA template. A total of 32 embryonated eggs from each of the 14 spawning events were used for genotyping.

Parentage testing

Based on their polymorphism, allelic range, electro-pherogram peak quality and the possibility of multiplexing, five loci were selected for genotyping (Table 1). The forward primer (without the M13 extension) from the microsatellite was labeled with a fluorescent label at 5′ (Thermo Fisher Scientific) (6FAM-Lgut18, PET-Lgut21, 6FAM-Lgut30, NED-Lgut34 and VIC-Lgut39). For adults, PCR multiplex reactions were conducted in 21 μL volumes containing 1 μL DNA (20 ng μL-1), 1 × Taq buffer, 1.5 mM MgCl2, 0.35 mM dNTPs, 0.3 μM of each primer and 0.07 U μL-1 Taq polymerase. For embryonated eggs, PCR reactions were done using the same quantities but in a volume of 23 μL with 3 μL of DNA. PCR thermal conditions were as follows: 94°C for 2 min, 42 cycles of 94°C for 45 s, 60°C for 45 s and 72°C for 1 min, and a final extension at 72°C for 10 min. Products were electrophoresed on an ABI 3130 automated DNA sequencer. Alleles were sized using the LIZ500 Size Standard (Applied Biosystems) and read using GeneMapper 4.0 software (Applied Biosystems).

The combined non-exclusion probability for the five loci set was estimated by the program Cervus 3.0.7 (Kalinowski et al., 2007). Parentage analyses for each of the 14 spawning events were performed by probabilistic and direct exclusion approaches using Cervus 3.0.7 (Kalinowski et al., 2007) and Vitassign (Vandeputte et al., 2006), respectively, to estimate the number of contributing males and females. Those cases, in which the parentage assignment by Cervus and Vitassign coincided. Still, there were some loci showing mismatches; they were treated as putative mutations either by the change in the number of repeats or by null alleles. The mutation rate per locus was calculated, dividing the number of mutations by twice the number of genotypes in the progeny at each locus. The mutation rate was also calculated for males and females.

RESULTS

The 18 microsatellite loci showed reliable genotyping patterns in the Lutjanus guttatus broodstock, resulting in high genetic diversity (na = 13.4 ± 1.3; Ho = 0.88 ± 0.05; Table 1). Three loci departed from HWE (only one after the Bonferroni correction) (Table 1), which can be explained by the potential presence of null alleles, rather than by stuttering or allele drop-out, as indicated by the Micro-Checker analysis. Fourteen loci are available to assess population genetic structure in wild L. guttatus (N. Diaz-Viloria, unpublish. data), and several loci are potentially useful for the other snapper species (Table 1).

For parentage assignment, 413 embryonated eggs were used. The combination of direct and probabilistic (95% CL) exclusion methods resulted in 95.6% of the progeny (n = 395) assigned to a single parental couple, leaving 4.3% unassigned. Seventeen families (out of 24) were represented in the progeny (Table 2).

Table 2 The number of progenies assigned to each potential family in the spawning events of July to October, using the probabilistic (95% confidence level) and direct exclusion methods. 

Female Male Number of individuals Female Male Number of individuals
1170 M 54 1170 M 61
1538 M 8 1538 M 46
4953_H 2924 M 39 4B67_H 2924 M 30
6720 M 14 6720 M 8
7A62_M 54 7A62_M 53
3C42_M 2 3C42_M 15
1170_M 0 1170_M 0
1538_M 1 1538_M 0
2C30_H 2924 M 4 IF70_H 2924 M 1
6720 M 0 6720_M 0
7A62_M 3 7A62_M 0
3C42_M 2 3C42_M 0
Total number of individuals 395
Total number of families with progeny 17

The reproductive season within the breeding tank spanned from June to November, with a peak number of spawns occurring in October. Most males (7A62-M, 1170-M, 1538-M and 2924-M) reproduced throughout the season and during consecutive days (Fig. 1a). In contrast, most of the progeny (n = 384; 97.2%) were produced by only two of the four females (4B67-H and 4953-H), and spawning did not occur on consecutive days (Fig. 1b), indicating that females (at least 4B67-H) spawn every other day.

Figure 1 The proportion of breeders contributing to progeny during the spawning events of July-October 2011. a) Males, b) females. 

Unexpected genotypes were observed in several families, resulting in a deviation from the expected Mendelian proportions (Table 3). As it is unlikely that these genotypes come from genotyping errors (the sequencer sizing differences observed in four duplicated samples was between 0-0.7 units in at least four loci), they appear to be a consequence of both null and mutated alleles. Considering a null allele as a mutation event, the mutation rate per locus varied between a maximum of 1.2×10-1 in Lgut21 to a minimum of 7.7×10-3 in Lgut34, for a mean of 4.5×10-2. Null-allele events were three times larger than changes in the number of repeats. While all the mutations in Lgut21 and Lgut39 were due to null alleles, there was a combination of null alleles and base pairs gains in the other loci (Table 3). In Lgut18 and Lgut30, the most common change was a gain in four base pairs (equivalent to one microsatellite repeat). The mutation rates were, on average, almost twice higher for females than males (Table 4).

Table 3 Goodness of fit test (χ2) for Mendelian inheritance proportions of genetically assigned progeny in Lutjanus guttatus broodstock. 

Family Locus Parental genotypes n Genotypes in the progeny and observed number of individuals in parenthesis χ2 Unexpected genotypes n Mutated or null allele
Male Female
3C42-M/4B67-H Lgut18 247/263 247/251 14 247/247 (2) 247/251 (1) 263/247 (7) 263/251(4) 6.0a 251/267 1 26.3 (S, 4)
Lgut21 275/349 248/307 12 275/248 (0) 275/307 (5) 349/248 (1) 349/307 (6) 8.7a 349/349 2 248 (D, null)
Lgut30 427/475 448/464 13 427/448 (2) 427/464 (6) 475/448 (2) 475/464 (3) 3.3a 431/464 1 427 (S, 4)
Lgut34 383/389 376/385 15 383/376 (9) 383/385 (2) 389/376 (2) 389/385 (2) 9.8* –– ––
Lgut39 272/281 248/264 15 272/248 (7) 272/264(1) 281/248(3) 281/264(4) 5.0 –– ––
7A62-M/4B67-H Lgut18 218/238 247 251 53 218/247(11) 218/251 (14) 238/247(15) 238/251 (13) 0.7 –– ––
Lgut21 250/287 248/307 33 250/248 (2) 250/307(15) 287/248 (3) 287/307(13) 16.3* a 250/250 9 248 (D, null)
287/287 11
Lgut30 444/472 448/464 44 444/448 (8) 444/464(11) 472/448(16) 472/464 (9) 3.5a 448/464 3 444 (S, 4)
448/475 1 472 (S, 3)
456/472 1 448,464 (D, 8, −8)
464/464 1 444,472 (S, null)
Lgut34 381/411 376/385 52 381/376(11) 381/385(17) 411/376(8) 411/385(16) 4.2 376/385(1) 381 (S,-5 or 4)
Lgut39 264/297 248/264 53 264/248 (8) 264/264(14) 297/248(17) 297/264(14) 3.2 –– ––
7A62-M/4953-H Lgut18 218/238 226/284 54 218/226(13) 218/284(16) 238/226(13) 238/284(12) 0.7 –– ––
Lgut21 250/287 270/291 53 250/270(16) 250/291 (9) 287/270(16) 287/291 (12) 2.6 291/291 1 250,287 (S, null)
Lgut30 444/472 448/452 49 444/448(10) 444/452(11) 472/448(12) 472/452(16) 1.7 448/452 1 444 (S, 4)
Lgut34 381/411 378/396 54 381/378(19) 381/396(7) 411/378(13) 411/396(15) 5.6 –– ––
Lgut39 264/297 285/289 54 264/285 (14) 264/289(16) 297/285(13) 297/289(11) 0.96 –– ––
1170-M/4B67-H Lgut18 255/296 247/251 61 255/247(17) 255/251 (15) 296/247(15) 296/251 (14) 0.31 –– ––
Lgut21 217/287 248/307 35 217/248 (2) 217/307(14) 287/248 (4) 287/307(15) 15.4*,a 217/217 10 248 (D, null)
287/287 16
Lgut30 420/440 448/464 53 420/448(17) 420/464 (8) 440/448(15) 440/464(13) 3.4a 431/464 1 420 (S, 11) or 440 (S, −9)
440/440 2 448,464 (D, null)
440/452 1 448 (D, 4)
440/456 1 448,464 (D, 8, −8)
Lgut34 391/411 376/385 60 391/376(16) 391/385(17) 411/376(12) 411/385(15) 0.4a 376/385 1 391 (S, −15, −6) or 411 (S,-35,-26)
Lgut39 264/272 248/264 61 264/248 (19) 264/264(13) 272/248(12) 272/264(17) 2.14 –– ––
1170-M/4953-H Lgut18 255/296 226/284 49 255/226(17) 255/284 (8) 296/226(10) 296/284(14) 4.0 230/255 4 226 (D, 4)
230/296 1
Lgut21 217/287 270/291 51 217/270(15) 217/291 (13) 287/270(10) 287/291 (13) 1.0 270/270 1 217, 287 (S, null)
Lgut30 420/440 448/452 33 420/448 (7) 420/452 (9) 440/448 (9) 440/452 (8) 0.3 420/456 2 452 (D, 4)
444/448 1 440 (S, 4)
Lgut34 391/411 378/396 51 391/378(11) 391/396 (13) 411/378(15) 411/396(12) 0.7 411/411 1 378, 396 (D, null)
Lgut39 264/272 285/289 51 264/285(13) 264/289(13) 272/285 (8) 272/289(17) 3.2 264/264 3 285, 289 (D, null)
1538-M/4N67-H Lgut18 230/251 247/251 46 230/247(12) 230/251 (17) 251/247(17) 251/251 (0) 16.8* –– ––
Lgut21 286/307 248/307 35 286/248 (0) 286/307(11) 307/248 (0) 307/307 (24) 44.7*,a 286/286(11) 248 (D, null)
Lgut30 464/479 448/464 36 464/448 (9) 464/464(14) 479/448 (5) 479/464 (8) 4.7*,a 448/483 (2); 452/464(1); 452/479(1); 456/479(1); 464/483 (1); 464/486(1); 467/479(1) 479 (S, 4); 448 (D, 4); 448 (D, 4); 448 (S, 8) or 464 (S, - 8); 479 (S, 4); 479 (S, 7); 464 (D, 3)
Lgut34 363/378 376/385 46 363/376(13) 363/385(12) 378/376 (9) 378/385(12) 0.78 –– ––
Lgut39 268/272 248/264 46 268/248 (8) 268/264(14) 272/248(14) 272/264(10) 2.3 –– ––
1538-M/4953-H Lgut18 230/251 226/284 8 230/226 (3) 230/284 (0) 251/226(2) 251/284(3) 3.0 –– ––
Lgut21 286/307 270/291 8 286/270 (3) 286/291 (2) 307/270 (0) 307/291 (3) 3.0 –– ––
Lgut30 464/479 448/452 6 464/448 (3) 464/452(1) 479/448(1) 479/452(1) 2.0 –– ––
Lgut34 363/378 378/396 8 363/378 (1) 363/396 (2) 378/378 (3) 378/396 (2) 1.0 –– ––
Lgut39 268/272 285/289 8 268/285 (1) 268/289 (0) 272/285 (6) 272/289(1) 11.0 –– ––
2924-M/4B67-H Lgut18 267/271 247/251 18 267/247 (0) 267/251 (0) 271/247(13) 271/251 (5) 25.1*,a 247/247 (5); 251/251(7) 267 (S, null)
Lgut21 262/300 248/307 19 262/248 (2) 262/307(11) 300/248 (0) 300/307 (6) 14.9*,a 262/262 (3); 300/300 (6) 248 (D, null)
Lgut30 431/483 448/464 30 431/448 (7) 431/464(9) 483/448 (6) 483/464 (8) 0.67 –– ––
Lgut34 376/391 376/385 30 376/376 (7) 376/385 (5) 391/376(11) 391/385(7) 2.5 –– ––
Lgut39 277/293 248/264 30 277/248 (5) 277/264 (5) 293/248(13) 293/264 (7) 5.7 –– ––
2924-M/4953-H Lgut18 267/271 226/284 18 267/226 (0) 267/284 (0) 271/226(11) 271/284(7) 19.8*,a 226/226(13); 230/271 (1); 284/284 (7) 267 (S, null); 226 (D, 4);267(S, null)
Lgut21 262/300 270/291 39 262/270(11) 262/291 (9) 300/270 (9) 300/291 (10) 0.28 –– ––
Lgut30 431/483 448/452 39 431/448 (7) 431/452(15) 483/448 (8) 483/452 (9) 4.0 –– ––
Lgut34 376/391 378/396 39 376/378 (7) 376/396(12) 391/378(7) 391/396(13) 3.2 –– ––
Lgut39 277/293 285/289 39 277/285(11) 277/289 (9) 293/285(10) 293/289 (9) 0.28 –– ––
6720-M/4B67-H Lgut18 251/300 247/251 8 251/247(5) 251/251(1) 300/247 (0) 300/251 (2) 7.0 –– ––
Lgut21 270/283 248/307 6 270/248 (1) 270/307 (3) 283/248 (2) 283/307 (0) 3.3*,a 283/283 (2) 248,307 (D, null)
Lgut30 431/440 448/464 8 431/448 (0) 431/464(3) 440/448 (4) 440/464(1) 5.0 –– ––
Lgut34 354/380 376/385 8 354/376 (2) 354/385 (3) 380/376 (2) 380/385(1) 1.0 ~ ––
l.gul39 281/301 248/264 8 281/248(2) 281/264(3) 301/248 (2) 301/264(1) 1.0 –– ––
6720-M/4953-H Lgut18 251/300 226/284 14 251/226 (2) 251/284(3) 300/226 (6) 300/284 (3) 2.6 –– ––
Lgut21 270/283 270/291 14 270/270 (4) 270/291 (5) 283/270 (3) 283/291 (2) 1.4 –– ––
Lgut30 431/440 448/452 13 431/448(4) 431/452(3) 440/448 (2) 440/452 (4) 0.85a 444/448(1) 440 (S, 4)
Lgut34 354/380 378/396 12 354/378 (2) 354/396 (0) 380/378 (8) 380/396 (2) 12.0*,a 356/396 (2) 354 (S, 2)
Lgut39 281/301 285/289 14 281/285(5) 281/289(2) 301/285 (2) 301/289 (5) 2.6 –– ––

n: number of progeny in the family. Families with four or less progeny not shown. UP: unexpected genotypes. MA: probably mutated allele with its ancestor (S: male, D: female) and base pair difference in parenthesis.

aUnexpected genotypes not considered;

*Significant values (P < 0.05).

Table 4 Number of genotypes per parent (progeny per parent × 5 loci), non-scored genotypes from progeny, number of mutated and null alleles, and estimated mutation rate. 

Parent ID Genotypes per parent Non-scored progeny genotypes Mutations Null Mutation rate (×10-2)
Male 3C42-M 95 3 2 0 2.2
7A62-M 550 7 6 2 1.5
1170-M 590 31 3 2 0.9
1538-M 275 2 5 0 1.8
2924-M 370 2 0 34 9.2
6720-M 110 0 3 0 2.7
Mean 331.7 7.5 3.2 6.3 3.1
Female 2C30-H 50 0 1 6 14
4B67-H 1080 15 6 74 7.5
4953-H 855 28 6 4 1.2
IF70-H 5 2 0 0 0
Mean 497.5 11.3 3.3 21 5.7

DISCUSSION

The usefulness of microsatellites as genetic markers for parentage assignment has been demonstrated in more than 20 cultivated fish species (Yue & Xia, 2014). The capability of correct assignment is dependent on several characteristics of the genetic markers, of which their variability is one of the most relevant (Vandeputte & Haffray, 2014). The five high-variable microsatellites selected (with a combined probability of non-exclusion in the order of 106) were enough to confidently determine, by both exclusion methods, the parentage of 92% of the progeny from a relatively small Lutjanus guttatus broodstock, supporting the usefulness of this reduced panel, for the assessment of multiple spawning events. The use of new genetic markers, such as SNPs, is an alternative for parentage testing in relevant aquaculture such as shrimp (Perez-Enriquez & MaxAguilar, 2016), and oysters (Lapègue et al., 2014). Routine genotyping platforms are available; however, these types of platforms are not yet available for L. guttatus. Other techniques (e.g., KASP, Taqman, HRM) are not economically feasible for more than 50 SNPs.

The reproductive pattern of males, most of them reproducing throughout the season and during consecutive days, has also been observed in the California yellowtail Seriola lalandi Valenciennes, 1833 (Smith et al., 2015). In wild L. guttatus females, asynchronous development of the gonads and partial spawning behavior has been described (Arellano-Martínez et al., 2001). The overrepresentation of females should be taken into account for hatchery management as an unbalanced family size that can lead to an increased inbreeding rate (Perez-Enriquez et al., 1999; García-Fernández et al., 2018).

Parentage assessment within a day of a spawning event by using the DNA extracted from fish embryonated eggs is recommended using a mechanical method rather than a chemical method as in other fish species [e.g., gilthead seabream Sparus aurata (García-Fernández et al., 2018); zebrafish Danio rerio (Westerfield, 2007)]. However, the selection of embryonated eggs posterior to gastrula for DNA analysis is critical for PCR success, as similar results were reported for the gilthead seabream (García-Fernández et al., 2018).

Mutations and null alleles in microsatellites are a common phenomenon resulting in failed assignments (Ellegren, 2000). The mean mutation rate obtained in our study (102 per locus per generation) is higher than other fish species, such as the carp Cyprinus carpio with 104 (Yue et al., 2007), or various salmonids with 102-105 (Shaikhaev & Zhivotovsky, 2014). Despite the high mutation rate, five high-variable microsatellites were enough to confidently determine, by direct exclusion, the parentage of progeny from a relatively small broodstock of the spotted rose snapper. For a larger broodstock, the number of genetic markers can be increased to minimize the non-exclusion probability (in the order of magnitude of 106 in the present study), using the remaining markers developed for the species (Table 1).

The estimation of the contribution of males and females of broodstocks kept in communal tanks is relevant for the implementation of selective breeding programs (García-Fernández et al., 2018). A more intensive and extended in time genotyping that gives a better genetic representation of the gene pool of the selected broodstock has been suggested for the red sea bream Pagrus major (Nugrohoa & Taniguchi, 2004) and the barramundi Lates calcarifer (Domingos et al., 2014). This information will also be important for the definition of the breeding goal, not only if the plan is focused on the improvement of reproductive traits, but also for other characteristics (growth, stress resistance, meat quality, others) (Gjedrem, 2012).

As an additional contribution, the genetic markers panel will also be useful for genetic studies in wild populations focused on their management in other lutjanid species.

ACKNOWLEDGMENTS

This work was partially supported by CONACYT, Mexico [grant number CB-2015-1-257019 to NDV]. S. Avila provided technical support for the genetic analysis. Thanks to R. Peña, R. Martínez Moreno, I. Miguel Hernández, and I. Zavala Leal for spawn collections. S. Dumas is a COFAA-IPN and EDI-IPN fellow. N. Diaz-Viloria is an EDI-IPN fellow.

REFERENCES

Aljanabi, S.M. & Martinez, I. 1997. Universal and rapid salt-extraction of high-quality genomic DNA for PCR-based techniques. Nucleic Acids Research, 25: 4692-4693. [ Links ]

Arellano-Martínez, M., Rojas-Herrera, A., García-Domínguez, F., Ceballos-Vázquez, B.P. & Villalejo-Fuerte, M. 2001. Reproductive cycle of the spotted rose snapper Lutjanus guttatus (Steindachner, 1869) in the Guerrero coast, Mexico. Revista de Biología Marina y Oceanografía, 36: 1-8. [ Links ]

Blonk, R.J.W., Komen, J., Kamstra, A., Crooijmans, R.P.M.A. & Van Arendonk, J.A.M. 2009. Levels of inbreeding in group mating captive broodstock populations of common sole, (Solea solea) inferred from parental relatedness and contribution. Aquaculture, 289: 26-31. doi: 10.1016/j.aquaculture.2009.01.012 [ Links ]

Correa-Herrera, T. & Jiménez-Segura, L.F. 2013. Biología reproductiva de Lutjanus guttatus (Perciformes: Lutjanidae) en el Parque Nacional Natural Utría, Pacífico Colombiano. Revista de Biología Tropical, 61: 829-840. [ Links ]

Domingos, J.A., Smith-Keune, C. & Jerry, D.R. 2014. Fate of genetic diversity within and between generations and implications for DNA parentage analysis in selective breeding of mass spawners: A case study of commercially farmed barramundi, Lates calcarifer. Aquaculture, 424-425: 174-182. [ Links ]

Ellegren, H. 2000. Microsatellite mutations in the germline: implications for evolutionary inference. Trends in Genetics, 16: 551-558. [ Links ]

Excoffier, L. & Lischer, H.E.L. 2010. Arlequin suite ver 3.5: a new series of programs to perform population genetics analyses under Linux and Windows. Molecular Ecology Resources, 10: 564-567. [ Links ]

Fischer, W., Krupp, F., Schneider, W., Sommer, C., Carpenter, K. & Niem, V. 1995. Guía FAO para la identificación de especies del Pacífico centro-oriental. Vertebrados. FAO, Rome. [ Links ]

García-Fernández, C., Sánchez, J.A. & Blanco, G. 2018. Early assessment of gilthead sea bream (Sparus aurata) spawning dynamics by mini-broodstocks. Aquaculture Research, 49: 36-47. [ Links ]

Gjedrem, T. 2012. Selection and breeding programs in aquaculture. Springer, Berlin. [ Links ]

Hallerman, E.M. 2003. Population genetics: principles and applications for fisheries scientists. American Fisheries Society, Bethesda. [ Links ]

Herrera-Ulloa, A., Chacón-Guzmán, J., Zúñiga-Calero, G. & Jiménez-Montealegre, R. 2010. Spotted rose snapper (Lutjanus guttatus) aquaculture research and development as a socio-economic alternative for Costa Rican fishing communities. Journal of the World Aquaculture Society, 41(2): 20-22. [ Links ]

Ibarra-Castro, L., Martínez-Cordero, F.J. & Álvarez-Lajonchère, L. 2013. Financial analysis of pilot-scale egg production of spotted rose snapper, Lutjanus guttatus. Aquaculture Economics & Management, 17: 171-183. [ Links ]

Kalinowski, S.T., Taper, M.L. & Marshall, T.C. 2007. Revising how the computer program CERVUS accommodates genotyping error increases success in paternity assignment. Molecular Ecology, 16(5): 1099-1106. [ Links ]

Lapègue, S., Harrang, E., Heurtebise S., Flahauw, E., Donnadieu, C., Gayral, P. et al. 2014. Development of SNP genotyping arrays in two shellfish species. Molecular Ecology Resources, 14: 820-830. [ Links ]

Nugrohoa, E. & Taniguchi, N. 2004. Daily change of genetic variability in hatchery offspring of red sea bream during spawning season. Fisheries Science, 70: 638-644. [ Links ]

Perez-Enriquez, R. & Max-Aguilar, A. 2016. Pedigree traceability in whiteleg shrimp (Litopenaeus vannamei) using genetic markers: a comparison between microsatellites and SNPs. Ciencias Marinas, 42: 227-235. [ Links ]

Perez-Enriquez, R., Takagi, M. & Taniguchi, N. 1999. Genetic variability and pedigree tracing of a hatchery-reared stock of red sea bream (Pagrus major) used for stock enhancement, based on microsatellite DNA markers. Aquaculture, 173: 411-421. [ Links ]

Sarabia-Méndez, M., Gallardo-Cabello, M., Espino-Barr, E. & Anislado-Tolentino, V. 2010. Characteristics of population dynamics of Lutjanus guttatus (Pisces: Lutjanidae) in Bufadero Bay, Michoacán, Mexico. Hidrobiologica, 20: 147-157. [ Links ]

Schuelke, M. 2000. An economic method for the fluorescent labeling of PCR fragments. Nature Bio-technology, 18: 233-234. [ Links ]

Shaikhaev, E.G. & Zhivotovsky, L.A. 2014. The evolution of microsatellite loci in salmonid fishes. Russian Journal of Genetics, 50: 853-859. [ Links ]

Smith, E.K., Drawbrige, M. (MS), Hyde, J. (PhD) & Geoffrey, M. (PhD). 2015. Evaluation of reproductive strategies in California yellowtail (Seriola dorsalis) using genetic parentage analyses. Thesis, 6. doi: 10.22371/02.2015.021 [ Links ]

Vandeputte, M. & Haffray, P. 2014. Parentage assignment with genomic markers: a major advance for understanding and exploiting genetic variation of quantitative traits in farmed aquatic animals. Frontiers in Genetics, 5: 432. [ Links ]

Vandeputte, M., Mauger, S. & Dupont-Nivet, M. 2006. An evaluation of allowing for mismatches as a way to manage genotyping errors in parentage assignment by exclusion. Molecular Ecology Resources, 6: 265-267. [ Links ]

Van-Oosterhout, C., Hutchinson, W.F., Wills, D.P.M. & Shipley, P. 2004. Micro-Checker: software for identifying and correcting genotyping errors in microsatellite data. Molecular Ecology Notes, 4: 535-538. [ Links ]

Westerfield, M. 2007. The zebrafish book. A guide for the laboratory use of zebrafish (Danio rerio). University of Oregon Press, Eugene. [ Links ]

Yue, G.H. & Xia, J.H. 2014. Practical considerations of molecular parentage analysis in fish. Journal of the World Aquaculture Society, 42: 89-103. [ Links ]

Yue, G.H., David, L. & Orban, L. 2007. Mutation rate and pattern of microsatellites in common carp (Cyprinus carpio L.). Genetica, 129: 329-331. [ Links ]

Received: August 27, 2019; Accepted: November 21, 2019

Corresponding author: Ricardo Perez-Enriquez (rperez@cibnor.mx)

Corresponding editor: Fernando Vega

Creative Commons License This is an Open Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License, which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.