nueva página del texto (beta)
Inglés (pdf)
Articulo en XML
Traducción automática
Citado por SciELO 
Citado por Google 
Similares en
SciELO 
Similares en Google 
Permalink
Introduction
Grape vines, one of the major Chilean fruit crops, are mostly cultivated in the Central Valley because of its favorable regional agroecological conditions. The vast majority of table grapes grown in Chile are exported to the northern hemisphere. Vitis vinifera cv. ‘Thompson Seedless’ (‘Th. Seedless’) ranks as the second most important commercial grape variety, with a total crop value of US$ 234 million (ODEPA, 2016). However, since most table grapes are trained onto overhead arbors and due to the frequent changes to cool and wet weather conditions in the last growing seasons, ‘Th. Seedless’ table grape growers and fruit export traders have been affected by important pre- and postharvest Botrytis gray mold outbreaks. In fact, grape production decreased from 170,194 tons in 2012 to 132,465 tons in 2014 (ODEPA, 2016). In Chile, B. cinerea has caused blossom blight during the bloom period and fruit rot during the pre- and postharvest periods (Latorre et al., 2002).
The application of fungicide sprays from blooming until harvest is the essential measure taken to reduce Botrytis infection-related losses. However, B. cinerea can develop resistance to commonly used fungicides, an ability that is partly due to its relatively large genetic diversity and enormous capacity for asexual reproduction by means of conidia (Leroux et al., 2002).
Resistance to recently introduced fungicides, such as anilino-pyrimidines (APs), phenylpyrroles (PPs) and sterol biosynthesis inhibitors class III (SBIs-III; hydroxyanilides), has also been reported (Leroux et al. 2002; Moyano et al., 2004; Weber, 2010). Moreover, field resistance to novel succinate dehydrogenase inhibitor (SDHI) fungicides was detected soon after their introduction (Bardas et al., 2010). Molecular characterization of B. cinerea isolates that were sensitive or resistant to single-site fungicides showed the involvement of major genes of the fungus and a strong association between resistant phenotypes and point mutations (single nucleotide polymorphisms, SNPs) (De Miccolis Angelini et al., 2012). These results have been observed for several groups of fungicides, including SDHIs (Yin et al., 2012), SBIs-III (Fillinger et al., 2008) and quinone outside inhibitors (QoIs) (De Miccolis Angelini et al., 2012; Ishii et al., 2009).
During the last decade, pyrimethanil, azoxystrobin, boscalid, fenhexamid and fludioxonil fungicides have been used extensively to control gray mold disease in table grapes in Chile, and fungicide resistance of B. cinerea has been reported (Esterio et al., 2007, 2012, 2015; Latorre et al., 2002; Piqueras et al., 2014). We hypothesized that the frequency of multiple-resistance in B. cinerea populations would increase; thus, it would be crucial to monitor such frequency in table grape orchards to evaluate the risk of infection for specific areas and growing conditions and elaborate appropriate anti-resistance strategies. Therefore, the objectives of the present study were as follows: i) to screen the sensitivity of B. cinerea populations isolated from ‘Th. Seedless’ table grapes to azoxystrobin, boscalid, fenhexamid, fludioxonil and pyrimethanil and assess their resistance frequencies to these fungicides and ii) to investigate the point mutations associated with QoI, SDHI and SBI-III resistance in azoxystrobin-, boscalid- and fenhexamid-resistant isolates.
Materials and methods
Collection of B. cinerea isolates.
To detect fungicide resistance in B. cinerea, ‘Th. Seedless’ naturally infected flowers were sampled during the 2013 and 2014 growing seasons from fifteen orchards in three regions of the Central Valley of Chile (Valparaiso, Metropolitana and O'Higgins). Two hundred flowers (n=50/plate) per orchard were incubated for 3–5 days on water agar medium at 25 °C. Mycelia from the colonized flowers were transferred to potato dextrose agar medium and incubated at 22 °C under a diurnal regime (12-h light/12-h dark light cycle). Pure cultures were transferred to malt extract agar (MEA) medium and incubated at 20 °C. B. cinerea isolates were then single-spore cultured on MEA medium, and mycelia were stored in 15% glycerol at −80 °C.
In vitro fungicide assays.
In vitro responses of B. cinerea isolates to azoxystrobin, boscalid, fenhexamid, fludioxonil and pyrimethanil were determined. The EC50 values (the effective concentrations that inhibited the conidial germ tube growth by 50% relative to the control) of fenhexamid (Teldor® 50% WP, Bayer CropScience AG, Monheim, Germany) and fludioxonil (Scholar® 23% SC, Syngenta S.A., Monthey, Switzerland), were determined by spotting aliquots (20 μl) of suspension containing 5×105 conidia ml−1 on 1% MEA medium, either without or amended with increasing concentrations of fungicide: 0, 0.01, 0.1, 1, 10 and 100 μg ml−1. For the QoI fungicide azoxystrobin (Quadris®, 25% CS, Syngenta S.A., Monthey, Switzerland), the alternative oxidase inhibitor salicylhydroxamic acid (SHAM, Sigma-AldrichLaboratories Inc., St. Louis, USA) was added to the MEA medium at a concentration of 100 μg ml−1. For the pyrimethanil (Scala® 40% SC, Bayer CropScience AG, Monheim, Germany) assay, 0.5% sucrose agar medium was used instead of the MEA medium to exclude amino acids, and for the SDHI fungicide boscalid (Cantus® 50% WG, BASF SE, Ludwigshafen, Germany), 0.5% yeast extract agar medium was used to prevent the interference of sugars with the assay (Weber and Hahn, 2011). For each isolate and fungicide concentration tested, growth was measured after 16 h using a 6331 Nauborn Wetzlar microscope (Will®, Germany) fitted with a 10x objective and an eyepiece reticule at 100x final magnification. Each test was performed 2–3 times. The EC50 values were calculated by regressing the relative inhibition of conidial germination against the log10-transformed fungicide concentrations. To measure cross-resistance between pairs of fungicides, the correlation coefficients (r) of the EC50 values of all fungicides were calculated. The EC50 values were log10 transformed before analysis. All statistical analyses were conducted using InfoStat statistical software V. 2014 (Di Rienzo et al., 2014). The fungicide resistance or sensitivity of the isolates was tested as described previously using the following discriminatory fungicide concentrations (per ml): 100 mg of azoxystrobin supplemented with SHAM, 10 mg of boscalid, 1 mg of fenhexamid, 1 mg of fludioxonil and 10 mg of pyrimethanil (Weber and Hahn, 2011).
Genetic characterization.
SNPs were searched in specific key genes of resistance to QoIs, SDHIs and SBI-IIIs in B. cinerea isolates. For all assays, DNA was extracted from mycelium as previously described by Veloukas et al. (2011).
Analysis of a partial sequence of the cytochrome b (cyt b) gene from azoxystrobin-resistant (AzoR) and azoxystrobin-sensitive (AzoS) isolates.
The PCR primers cytb-BcF and cytb-BcR (Table 1) were used to amplify a cyt b gene fragment containing the codons 137 (carrying the G137R mutation) and 143 (carrying the G143A mutation) from randomly selected AzoR and AzoS B. cinerea isolates. The primers cytb129-F and cytb129-R (Table 1) were used to amplify a 978 bp fragment of the cyt b gene containing the codon 129 (carrying the F129L mutation). Additionally, as a specific diagnostic tool, the allele-specific PCR primers BcAR-F and BcAR-R (Table 1) were used to amplify a 260 bp fragment containing the G143A mutation only on AzoR B. cinerea isolates. The PCR amplifications were conducted using the parameters described by Jiang et al. (2009). The PCR products were examined by electrophoresis on a 1.5% agarose gel in 1× Tris-acetate-EDTA (TAE) buffer (De Miccolis Angelini et al., 2012).
Table 1 PCR primers used in this study
| Gene | Primer pair | Sequences (5’ – 3’) | PCR product (bp) |
|---|---|---|---|
| erg27 | Fnx.42 | GGTATTCCTCCGATTGTGGA | 1156 |
| Fnx.1197 | TAAAGGCATCAGCTCGTGTG | ||
| Fnx.844 | GAGCTGAGATCTTGGGGATG | 1164 | |
| Fnx.2007 | TGTGTATGATGTACGGCCAAC | ||
| cyt b | BcAR-F | GGCAAATGTCACTGTGAGC | 260 |
| BcAR-R | ACCATCTCCATCCACCATACCT | ||
| cytb-BcF | TAAAGTGGTATAACCCGACGG | 1768/564 | |
| cytb-BcR | CCATCTCCATCCACCATACCT | ||
| cytb129-F | GCATAAAGCATTGGGGCTAA | 978 | |
| cytb129-R | CCGTCTGGCGTCACTATAAAT | ||
| sdhB | IpBcBeg | CCACTCCTCCATAATGGCTGCTCTCCGC | 953 |
| IpBecEnd2 | CTCATCAAGCCCCCTCATTGATATC | ||
| H272L | GGCAGCTTTGGATAACAGCATGAGTTTGTACAGAGATC | 120 | |
| H272R | GGCAGCTTTGGATAACAGCATGAGTTTGTACAGATGGC | 120 | |
| H272Y | GGCAGCTTTGGATAACAGCATGAGTTTGTACAGATAT | 120 | |
| H272-rev | GCCATTTCCTTCTTAATCTCCGC | -- | |
| N230I-fw | GACCCAGCACCAGAAGGAAAAG | 150 | |
| N230I-rev | GATAGCTGGTCCCAAGTACTCCTCACGG | ||
| P225F-fw | GTATTCTCTGCGCATGCTGCTCGACATCAAGC | 144 | |
| P225-rev | AAGCTGCCTTACGTTCTTCC |
DNA sequence analysis of the succinate dehydrogenase subunit B (sdhB) gene from boscalid-resistant (BosR) and boscalid-sensitive (BosS) isolates.
A fragment containing codons 225 and 272 in the sdhB gene was amplified from randomly selected BosR and BosS B. cinerea isolates using the IpBcBeg and IpBcEnd2 primers (Table 1), and the PCR products were sequenced and compared with the sdhB gene reference sequence (Gene ID: 5428850, GenBank). For the detection of each of the five polymorphisms, a primer-introduced restriction analysis polymerase chain reaction (PIRA-PCR) technique was used (Veloukas et al., 2011). For this purpose, the PCR products were amplified with primer pairs P225F-fw and P225-rev, N230I-fw and N230I-rev, H272L-fw and H272-rev, H272R-fw and H272-rev, and H272Y-fw and H272-rev (Table 1) and digested with the enzymes HindIII, BamHI, BglII, HhaI, and EcoRV, respectively. Digestion solutions consisted of 5 μl of PCR product, 0.5 unit of each enzyme and 1 unit of the respective enzyme buffer in a total reaction volume of 10 μl. Digestions were performed overnight at 37 °C. The PCR and digested product were separated by electrophoresis on a 2% agarose gel in 1× TAE buffer and visualized after SYBR® Safe DNA gel staining under UV light (Veloukas et al., 2011).
Analysis of erg27 gene sequences from fenhexamid-resistant (FenR) and fenhexamid-sensitive (FenS) isolates.
Randomly selected FenR and FenS B. cinerea isolates were analyzed for specific key genes of resistance to SBI-IIIs. PCR amplification was performed using two specific primer pairs to amplify partially overlapping fragments of the erg27 gene of B. cinerea: Fnx.42 and Fnx.1197, and Fnx.844 and Fnx.2007 (Table 1). PCR amplifications were conducted using the parameters described by De Miccolis Angelini et al. (2014).
All PCR products (AzoR, BosR and FenR) were sequenced by an external service (Macrogen USA Corp, DNA Sequencing Service, Maryland, USA), and the DNA sequence analysis was performed using the software Vector NTI suite 7.
Results
Collection of B. cinerea isolates.
A total of 526 monosporic B. cinerea isolates were obtained from the fifteen ‘Th. Seedless’ orchards sampled (Valparaiso n=171; Metropolitana n=180; O’Higgins n=175).
Fungicide resistance frequency distribution among locations.
Fungicide resistance monitoring of the 526 isolates, based on discriminatory concentrations of azoxystrobin, boscalid, fenhexamid, fludioxonil and pyrimethanil, identified 14 resistant phenotypes. Among the 526 isolates, 106 (20.15%) were sensitive to all fungicides tested. Resistance to single fungicides was distributed as follows: 35 (6.65%) isolates were resistant to azoxystrobin, 14 (2.66%) to boscalid, 20 (3.8%) to fenhexamid, and 35 (6.65%) to pyrimethanil. Resistance to two fungicides was distributed as follows: 134 (25.4%) isolates were resistant to azoxystrobin and pyrimethanil, 29 (%5.5%) to azoxystrobin and fenhexamid, 10 (1.9%) to azoxystrobin and boscalid, 8 (1.5%) to pyrimethanil and fenhexamid, and 6 (1.14%) to pyrimethanil and boscalid, and only one (0.19%) isolate was resistant to fenhexamid and boscalid. Resistance to three or more fungicides was distributed as follows: 68 (12.9%) isolates were resistant to fenhexamid, azoxystrobin and pyrimethanil, 27 (5.1%) to boscalid, azoxystrobin and pyrimethanil, and 8 (1.52%) to azoxystrobin, boscalid, fenhexamid and pyrimethanil (Fig. 1). Among the three regions in Central Chile from north to south, Valparaiso (n=171), Metropolitana (n=180) and O’Higgins (n=175), the frequencies of sensitive isolates to all fungicides were 48.15%, 21.11% and 5.88%, respectively. From north to south, the frequency of resistant isolates to azoxystrobin, boscalid, fenhexamid and pyrimethanil ranged from 31.6% to 86.3%, 11.1% to 18.85%, 26.3% to 36.5%, and 30.4% to 73.14%, respectively. No fludioxonil-resistant isolates were found among the 526 isolates tested.
Figure 1 Frequency distribution of the different B. cinerea phenotype populations isolated from fifteen ‘Thompson Seedless’ orchards in three regions of the Central Valley of Chile.
To investigate the point mutations associated with QoI, SDHI and SBI-III resistance for azoxystrobin, boscalid and fenhexamid, 30 each of AzoR, AzoS, BosR, BosS, FenR and FenS B. cinerea isolates were randomly selected.
Molecular characterization of a partial sequence of the cyt b gene from randomly selected AzoR and AzoS B. cinerea isolates.
Two types of cyt b gene fragments were obtained from the PCR amplification with the primers cytb-BcF and cytb-BcR in all the B. cinerea isolates tested. Fourteen (23.3%) isolates amplified a cyt b gene fragment of 1768 bp containing four introns (Bcbi-67/68, Bcbi-131/132, Bcbi-143/144 and Bcbi-164), and 46 (76.66%) isolates amplified a cyt b gene fragment of 564 bp containing three introns (Bcbi-67/68, Bcbi-131/132 and Bcbi-164). After the PCR products were sequenced, the G143A mutation was detected only in the 564 bp fragment of the AzoR B. cinerea isolates. This point mutation is known to affect azoxystrobin sensitivity in many fungal species. None of the AzoR isolates tested carried the Bcbi-143/144 intron in the cyt b gene. None of the 1768 bp fragments contained the G143A mutation. The allele-specific primers BcAR-F and BcAr-R produced a 260 bp fragment only in AzoR B. cinerea isolates, indicating that they all carried the G143A point mutation (Fig. 2). The G137R and F129L point mutations were not detected in any of the B. cinerea isolates tested.
Molecular characterization of the DNA sequence of the sdhB gene from randomly selected BosR and BosS B. cinerea isolates.
The analysis of the DNA sequence of the sdhB gene from BosR B. cinerea isolates showed that the CAC codon (histidine) changed to TAC (tyrosine) in 12 BosR isolates (H272Y) and to CGC (arginine) in 18 BosR isolates (H272R). Except for the two point mutations at position 272 in BosR isolates, all 60 isolates analyzed had identical deduced amino acid sequences in the sdhB gene. All PCR reactions with the forward primers H272R and H272Y and the common reverse primer H272-rev amplified a 120 bp product. The digestion of the PCR products amplified by primer pair H272R-fw/H272-rev with HhaI resulted in two fragments of 85 and 35 bp only for isolates possessing the H272R mutation. The digestion of the PCR products amplified by primer pair H272Y-fw/H272-rev with EcoRV resulted in two fragments of 85 and 35 bp only for isolates that lacked the H272Y mutation, whereas in isolates with the H272Y mutation, the PCR products remained undigested. Results showed that H272R was the predominant mutation associated with BosR B. cinerea isolates.
Molecular characterization of erg27 gene sequences from randomly selected FenR and FenS B. cinerea isolates.
Two SNPs in the erg27 gene sequence were found only in FenR B. cinerea isolates that were always associated with the replacement of a phenylalanine with serine (F412S, 90%) or valine (F412V, 10%) in the position 142. No mutations were associated with FenS B. cinerea isolates.
Cross-resistance relationships.
With the exception of fludioxonil, the correlation coefficients of the EC50 values for all other fungicide combinations were medium to high, ranging from 0.48 (azoxystrobin vs. pyrimethanil, Valparaiso region) to 0.91 (fenhexamid vs. pyrimethanil, Valparaiso region), and were significant (P<0.001) (Table 2).
Table 2 Cross-resistance patterns among azoxystrobin, boscalid, fenhexamid and pyrimethanil in Botrytis cinerea isolates from ‘Thompson Seedless’ orchards
| Region | Fungicide | Fungicide | |||||||
|---|---|---|---|---|---|---|---|---|---|
| azoxystrobin | boscalid | fenhexamid | pyrimethanil | ||||||
| r | P | r | P | r | P | r | P | ||
| azoxystrobin | – | – | 0.53 | <0.0001 | 0.63 | <0.0001 | 0.48 | <0.0001 | |
| Valparaíso | boscalid | – | – | – | – | 0.88 | <0.0001 | 0.87 | <0.0001 |
| fenhexamid | – | – | – | – | – | – | 0.91 | <0.0001 | |
| azoxystrobin | – | – | 0.8 | <0.0001 | 0.79 | <0.0001 | 0.7 | <0.0001 | |
| Metropolitana | boscalid | – | – | – | – | 0.87 | <0.0001 | 0.68 | <0.0001 |
| fenhexamid | – | – | – | – | – | – | 0.84 | <0.0001 | |
| azoxystrobin | – | – | 0.85 | <0.0001 | 0.87 | <0.0001 | 0.86 | <0.0001 | |
| O'Higgins | boscalid | – | – | – | – | 0.69 | <0.0001 | 0.58 | <0.0001 |
| fenhexamid | – | – | – | – | – | – | 0.86 | <0.0001 | |
Discussion
Among the three regions in Central Chile from north to south (from Valparaiso to O'Higgins), the frequency of sensitive isolates decreased from 48.15% to 5.88% (Fig. 1). In addition, 19.77% of the isolates tested were resistant to one fungicide, 35.74% were resistant to two, 22.81% were resistant to three, and only 1.52% were resistant to four fungicides. Similar results were found by Latorre and Torres (2012), in 214 B. cinerea isolates collected from commercial vineyards with previous use of anilino-pyrimidines, DMIs, and hydroxyanilides.
Among the three regions, the frequency of multiple-resistant B. cinerea phenotypes increased from 30.40% in Valparaiso to 81.70% in O'Higgins (Fig. 1), indicating that the risk of development of multiple resistance in B. cinerea found in table grape populations in Central Chile is higher where the environmental conditions are more favorable for Botrytis infection. In O'Higgins, the most cool and wet of the three regions, it is common for table grape growers to apply 6-7 fungicide sprays per season. In Valparaiso, the most warm and dry of the three regions, only 4-5 applications are required. These differences modulate the selective pressure exerted by the fungicides on the B. cinerea populations in the different regions.
Six of 10 B. cinerea isolates collected in the three regions showed resistance to azoxystrobin. In the sensitivity test, all 336 AzoR isolates showed high resistance to azoxystrobin, ranging from 102 to >1000 μg ml−1. Similar results were reported by Yin et al. (2012).
Among the 60 randomly selected isolates, only the AzoR isolates harbored the G143A point mutation, in agreement with many previous studies (Yin et al., 2012). None of the AzoR isolates tested carried the Bcbi-143/144 intron; the presence of this intron in the cyt b gene prevents the occurrence of G143A-mediated resistance (Grasso et al., 2006; Yin et al., 2012) in many fungal species. Moreover, as only 23.3% of the 60 B. cinerea isolates contained the Bcbi-143/144 intron, this low percentage indicates that B. cinerea populations from ‘Th. Seedless’ in Chile hold a high inherent risk of development of resistance to QoI fungicides.
In the present study, we detected an unpredictably high frequency of pyrimethanil-resistant B. cinerea isolates: five out of 10 B. cinerea isolates collected showed resistance to pyrimethanil with EC50 values from 10.2 to 62.1 μg ml−1. Among the anilinopyrimidine fungicides, cyprodinil was used for a limited number of seasons for gray mold control in table grapes in Chile, until resistant populations emerged. Latorre et al. (2002) reported that 38.5% of the B. cinerea population was resistant to anilino-pyrimidines in vineyards following four fungicide applications in a two-year period. Afterwards, in a survey conducted between 2007 and 2011, the frequency of anilino-pyrimidine-resistant isolates increased from 45% to 77.4% (Latorre and Torres, 2012). Even though in the last decade, Switch® (cyprodinil + fludioxonil) has been the most widely used botryticide in table grape Botrytis control, it is likely that selection for cyprodinil resistance has occurred in Chile despite the presence of fludioxonil in the sprayed fungicides. On the other hand, it would also be due to the use of other anilino-pyrimidine fungicides registered for gray mold control in table grapes.
The resistance to AP fungicides is stable and without fitness costs because it does not affect the vital components of the fungal cells; several studies have documented the existence of strong cross-resistance between AP fungicides in B. cinerea (Zhang et al., 2009).
Fenhexamid has been available for use on table grapes and vegetable crops since 1999 and has become a key component of gray mold disease management in Chile. Despite the fact that B. cinerea strains with reduced sensitivity to fenhexamid have been detected in Chile, it did not lead to a total field control failure (Esterio et al., 2007, 2012).
Four of 10 B. cinerea isolates collected in the three regions showed resistance to fenhexamid, and in the sensitivity test, the EC50 value of 149 FenR isolates ranged from 1.25 to 299 μg ml−1. After partial sequencing of the erg27 gene in the randomly selected FenR B. cinerea isolates, 90% (n=27) possessed the F412S substitution, and 10% (n=3) possessed the F412V substitution. The F412S and F412V mutations had already been reported in Chilean B. cinerea-resistant isolates from table grapes (Esterio et al., 2012). Reduced survival in the field has been reported for fenhexamid-resistant strains. The effect of F412 mutations in the high FenR B. cinerea isolates would impact their survival capacity, limiting their dispersal and persistence, particularly when overwintering under field conditions (Billard et al., 2012).
Boscalid is a recently introduced member of SDHIs, which are effective in controlling diseases caused by B. cinerea. In the present study, two out of 10 B. cinerea isolates collected in the three regions showed resistance to boscalid. The EC50 values ranged from 15.04 to >1000 μg ml−1. Our results showed that H272R was the predominant mutation associated with the randomly selected BosR B. cinerea isolates; 60% (n=18) possessed the H272R substitution and 40% (n=12) possessed the H272Y substitution, in agreement with previous studies conducted on grapevines where sdhB H272Y and sdhB H272R were the most frequent mutations in B. cinerea populations treated with boscalid (Esterio, 2014; Veloukas et al., 2011; Yin et al., 2011). In Champagne vineyards (Walker et al. 2013), due to the availability of other classes of botryticides and the limited use of SDHIs, boscalid resistance frequency has not become widespread, and the emergence of the moderately resistant mutants sdhB H272Y and sdhB H272R has been favored over more resistant mutants.
In Chile, Piqueras et al. (2014) reported a high boscalid resistance in Botrytis isolates associated with the H272L point mutation. Esterio et al. (2015) reported the detection of the H272R/Y/L and P255L/H point mutations in table grapes at frequencies of 52.8%, 35.42%, 2.1%, 6.25% and 4.16%, respectively. The introduction of new SDHI fungicides in Chile, such as fluopyram, may modify the structure of local B. cinerea populations. In fact, no cross-resistance has been detected between pyridine-carboxamides (e.g., boscalid) and pyridinyl-ethyl-benzamides (e.g., fluopyram) in sdhB H272Y and sdhB H272R mutants; this new family of fungicides may therefore be very useful for the control of these prevalent mutants (Veloukas and Karaoglanidis, 2012).
In the present study, azoxystrobin and pyrimethanil resistance frequencies in B. cinerea isolates collected from the three regions were only 7.0% (35 out of 526 isolates), but the frequency of the double-resistant AzoR+PyrR phenotype reached 25.4% (134 out of 526 isolates). The development of multiple-resistance to chemically unrelated fungicides has been reported in different B. cinerea populations (Weber, 2011).
On the other side, in the Metropolitana and O'Higgins regions, the detected frequencies of the multiple-resistant B. cinerea phenotypes AzoR+PyrR+FenR and AzoR+PyrR+BosR were only 10.56% and 10%, and 21.7% and 8.5%, respectively. The frequencies of these two B. cinerea multiple-resistant phenotypes (AzoR+PyrR+FenR and AzoR+PyrR+BosR) were much lower than the dual AzoR+PyrR B. cinerea phenotype frequency, the AzoR+PyrR+BosR phenotype being the least frequent in both regions. Additionally, in the present study, a very low multiple-resistant AzoR+PyrR+FenR+BosR phenotype frequency was detected (Fig. 1). These results suggest that the increase in the fitness cost observed in this study in the B. cinerea multiple-resistant phenotypes may be due to the simultaneous presence of the erg27 (F412S or F412V) and/or sdhB (H272R/Y) gene mutations (Fig. 1). Veloukas et al. (2014) reported that most of the isolate groups with multiple-resistance to SDHIs and QoIs, associated with different sdhB mutations and the G143A mutation, suffered significant fitness costs.
In the present study, no fludioxonil-resistant isolates were detected among the 526 isolates tested using inhibition growth assays, and the EC50 values ranged from 0.01 to 0.27 μg ml−1. These results indicate that fludioxonil still holds a high potential for B. cinerea control in table grapes in Chile. Similar results were found by Myresiotis et al. (2007), who did not find fludioxonil-resistant isolates among the B. cinerea populations resistant to azoxystrobin and pyrimethanil, while few fludioxonil-resistant populations from strawberry fields were observed by Fernández-Ortuño et al. (2013). High levels of fludioxonil resistance have only been detected in laboratory mutants and were linked to a decrease in fitness, probably due to the polygenic control of the resistance, as shown by Vignutelli et al. (2002), or the reduced competitive ability of the fludioxonil-resistant strains compared with the wild-type strains (Ziogas and Kalamarakis, 2001). The development of fludioxonil resistance in the field might have detrimental effects on the survival of the pathogen.
Maintaining the effectiveness of fludioxonil, fenhexamid and boscalid against B. cinerea by delaying resistance development, and delaying resistance evolution to QoIs and APs by limiting the number of fungicide applications in table grapes for gray mold control programs in the Central Valley of Chile, should be required for the successful control of the disease. Resistance monitoring is therefore essential to detect the emergence of new resistant phenotypes on the ‘Th. Seedless’ B. cinerea populations.
To maintain the effectiveness of the available fungicides for the future, strict resistance management strategies are required. These include good crop management and sanitation measures to reduce the risk of gray mold infection, such as suitable use of nitrogen fertilizers, restraint of canopy humidity through manipulations, adequate cluster thinning, and removal of infected fruits and inoculum reservoirs. To limit selection for resistance, rotation between fungicides of different classes and limitation of treatments with the same class of compounds to one per season should be mandatory, with a possible exception for fludioxonil, which has a low risk of specific resistance. However, these rules are often broken by table grape growers, and fungicides are often used excessively. One of the reasons the rules are broken is the maximum number of detectable pesticide residues on the fruit that are imposed by international retailers, which limits the available options for fungicide rotations. Furthermore, fludioxonil and SDHIs are sold in Chile mixed with other fungicides, restricting the flexibility to optimize the spraying programs. The availability of quick cultivation-based and molecular tests allows a rapid evaluation of resistance, including the prevalence of resistance mutations before and after treatments, to help devise locally adapted resistance management programs.
