SciELO - Scientific Electronic Library Online

 
vol.48 issue2Bioacessibility of phenolic compounds and antioxidant capacity in organic peppermint leavesEffect of n-3 fatty acids supplementation on serum lipid profile of rats author indexsubject indexarticles search
Home Pagealphabetic serial listing  

Services on Demand

Journal

Article

Indicators

Related links

  • On index processCited by Google
  • Have no similar articlesSimilars in SciELO
  • On index processSimilars in Google

Share


Revista chilena de nutrición

On-line version ISSN 0717-7518

Rev. chil. nutr. vol.48 no.2 Santiago Apr. 2021

http://dx.doi.org/10.4067/S0717-75182021000200163 

Artículo Original

Influencia del aceite de linaza (Linum usitatissimum) en expresión de genes para proteína desacoplante 3 en músculo esquelético y receptor activado por proliferadores peroxisómicos tipo alfa en hígado de ratas obesas

Influence of flaxseed (Linum usitatissimum) oil on the expression of the uncoupling protein 3 gene in skeletal muscle and the peroxisome proliferator-activated receptor alpha gene in the liver of obese rats

Lizbeth Hidalgo-Tufiño1 
http://orcid.org/0000-0003-4777-2609

Carmen Astuvilca1 
http://orcid.org/0000-0002-9215-2444

Guillermo Landeo2 
http://orcid.org/0000-0002-0517-4267

Haydeé Cárdenas-Quintana1 
http://orcid.org/0000-0001-8341-8581

María-Elena Villanueva1  * 
http://orcid.org/0000-0001-7900-6664

1Departamento de Nutrición, Facultad de Zootecnia, Universidad Nacional Agraria La Molina, Lima, Perú.

2Ministerio de Salud-Centro de Salud de Paucartambo. Pasco, Perú.

RESUMEN

El consumo de ácidos grasos poliinsaturados (AGPI) omega 3 tiene un prometedor potencial para el tratamiento de la dislipidemia y la obesidad, especialmente por su efecto sobre factores de transcripción como el receptor activado por proliferadores peroxisomales tipo alfa (PPARα) y sobre la actividad de la proteína desacoplante UCP3. Con el objetivo de buscar dicho efecto en un aceite rico en AGPI, ampliamente distribuido a nivel nacional, evaluamos el impacto de la suplementación dietaria con aceite de linaza (Linum usitatissimum) sobre la expresión de los genes UCP3 y PPARα en ratas Holtzman inducidas a obesidad. Los animales fueron divididos en 2 grupos, uno recibió dieta obesogénica (Grupo CO) y el otro recibió, además, aceite de linaza (Grupo AL). Las mediciones registradas fueron peso corporal, consumo de alimento, perfil lipídico y la expresión de los genes para el PPARα en el hígado y para UCP3 en el músculo esquelético.

Resultados:

La suplementación dietaria con aceite de linaza, incrementó significativamente la expresión del gen UCP3 en el músculo esquelético y mostró una tendencia no significativa a incrementar la expresión del gen PPARα en hígado, aunque también incrementó el peso corporal y de manera no significativa el consumo de alimentos,

Conclusión:

La suplementación dietaria con aceite de linaza influyó significativamente en la expresión del gen UCP3 en el músculo esquelético con un ligero, pero no significativo incremento en la expresión del gen PPARα en hígado de las ratas Holtzman con obesidad inducida.

Palabras clave: Aceite de linaza; AGPI; PPARα; UCP3

ABSTRACT

The consumption of omega-3 polyunsaturated fatty acids (PUFAs) holds a promising potential for treatment of dyslipidemia and obesity, especially due to its effect on transcription factors such as the peroxisomal proliferator-activated receptor type alpha (PPARα) and uncoupling protein 3 (UCP3) activity. In order to assess the effect of a widely distributed oil rich in PUFA, we evaluated the impact of a diet supplemented with flaxseed oil (Linum usitatissimum) on the expression of the UCP3 and PPARα genes in obesity-induced Holtzman rats. Animals were divided into 2 groups: the first group (Group CO) received an obesogenic diet, while the second group (Group AL) was supplemented with flaxseed oil in addition to the obesogenic diet. The measurements were body weight, food intake, lipid profile, and the expression of genes for PPARα and UCP3 in the liver and skeletal muscle, respectively.

Results:

Diet supplemented with flaxseed oil significantly increased the expression of the UCP3 gene in the skeletal muscle and showed a non-significant tendency to increase the expression of the PPARα gene in the liver. Although the body weight of the animals in Group AL increased, there was no significant increase in food consumption as compared to that of animals in Group CO.

Conclusion:

Flaxseed oil significantly increased the expression of UCP3 in skeletal muscle, with a slight but non-significant increase in the expression of PPARα in the liver of obesity-induced Holtzman rats.

Key words: Flaxseed oil; Obesity; PPARα; UCP3

INTRODUCCIÓN

En el marco de los desórdenes metabólicos, la obesidad destaca por su relevancia. Esta enfermedad, de carácter multifactorial, involucra tanto elementos genéticos como ambientales y está intrínsecamente ligada a la dislipidemia1,2. Existe abundante evidencia que relaciona a los nutrientes y otros factores dietarios con una amplia gama de modificaciones en marcadores epigenéticos, sin embargo, los mecanismos moleculares de estas interacciones no han sido totalmente dilucidados3,4. En este contexto, toman gran relevancia aquellos nutrientes con el potencial de ser alternativas nutraceúticas para el tratamiento de la dislipidemia, como es el caso de los ácidos grasos poliinsaturados (AGPI) de la familia omega 3. Su consumo ha sido relacionado con resultados sanitarios positivos en enfermedades cardiovasculares, diabetes, cáncer, entre otros5. Los AGPI causan efecto en factores claves del control del balance energético como el receptor activado por proliferadores peroxisomiales tipo alfa (PPARα, por sus siglas en inglés)6.

La familia PPAR constituye factores de transcripción activados por ligandos que regulan la expresión de genes relacionados con el metabolismo de lípidos y glucosa. Sus isoformas (PPARα, PPARβ/δ y PPARγ) se diferencian en términos de distribución, ligandos y función fisiológica. Los PPARα se expresan en tejidos con alta actividad metabólica, principalmente en el hígado y músculo esquelético. Su activación, ya sea por ligandos naturales o farmacológicos (como fibratos), implica un cambio de conformación en ellos, que resulta en la activación de genes relacionados con el metabolismo de los ácidos grasos, promoviendo la oxidación de los mismos, actividad que se da principalmente en el hígado y que previene la esteatosis durante el hambre o el ayuno prolongado6. En general, la activación de los PPARα promueve el gasto energético, disminuye el almacenamiento de grasa y, además de su efecto sobre el metabolismo lipídico que nos ocupa, se le atribuyen efectos cardioprotectores6,7; la activación de los PPAR influye en otros procesos como el metabolismo de la glucosa, de lipoproteínas, de aminoácidos, y en la inflamación hepática8.

Las proteínas desacoplantes mitocondriales (UCP, por sus siglas en inglés) son una familia de proteínas transportadoras de protones presentes en la membrana interna de la mitocondria. Disminuyen la eficiencia metabólica de la fosforilación oxidativa al promover la fuga de protones, disipando así la diferencia de potencial electroquímico en forma de calor. La UCP1 (también denominada termogenina) es la de mayor capacidad para disipar energía, y se encuentra de forma abundante en el tejido adiposo pardo9. Por otro lado, la UCP3 se expresa además de en el tejido adiposo pardo, en músculo esquelético y corazón (siendo estos dos últimos tejidos donde primordialmente se le estudia)10. Si bien es cierto que su función sigue siendo objeto de estudios, se la ha relacionado positivamente con la protección de la mitocondria frente al estrés oxidativo y el control del gasto energético y muy especialmente con el aumento de transporte y oxidación de los ácidos grasos11. Se han observado incrementos en su expresión en el músculo en respuesta al ejercicio prolongado y ante el incremento de los niveles de ácidos grasos circulantes durante el ayuno prolongado, exposición al frio, dieta alta en grasas y tras la administración directa de ácidos grasos10.

El aceite de linaza (Linum usitatissimum) es un cultivo con un alto contenido de AGPI omega 3, particularmente en ácido α-linolénico (ALA)12. No se conoce el efecto del uso de esta fuente específica de aceite vegetal en la expresión de genes para UCP3 y PPARα, pero sí sobre el efecto de otras fuentes vegetales de aceite como chia, sacha inchi o rosa mosqueta, ricos también en ALA, sobre una mayor expresión de desaturasas de la elongación de AGPI, sobre la actividad de enzimas antioxidantes y sobre la expresión y unión al ADN de PPARα13. Si bien el ALA es nuestro interés prioritario, por ser el principal componente de los ácidos grasos del aceite de linaza, éste contiene también cantidades menores de otros AGPI, y otros estudios han demostrado efecto de otras fuentes que los contienen, sobre PPARα8,14.

El objetivo de la presente investigación fue determinar el efecto de la suplementación dietaria con aceite de linaza en la expresión de genes para UCP3 en músculo esquelético y de PPARα en tejido hepático y sobre el perfil lipídico en ratas Holtzman con obesidad inducida.

MATERIALES Y MÉTODOS

Animales de experimentación y tratamiento

Se seleccionaron 24 ratas Holtzman adultas macho, con una edad promedio de 53,4±0,3 días y peso promedio de 234±1,2 g. Los animales fueron alojados en jaulas en un ambiente de temperatura controlada (23-25 °C), con un ciclo de luz/oscuridad de 12:12h, con agua y alimento ad libitum. El experimento duró 89 días y consistió de dos etapas. La primera duró 30 días, en la que los animales recibieron una dieta obesogénica que consistió de 85% de alimento basal (Dieta estándar para ratas; conteniendo 17% de proteína, 4% de fibra, 6% de grasa y 2,9% de otros nutrientes, proporcionada por la planta de alimentos de la Universidad Nacional Agraria La Molina, y un 15% de manteca vegetal, para lograr un total de 20% de grasa en la medición del extracto etéreo de la dieta (tabla 1) (Condiciones similares a la dieta hipercalórica empleada por Miotto et al15 para inducir la obesidad). Al finalizar esta primera etapa se midió el índice de Lee, como un parámetro antropométrico predictor de la obesidad, considerando un valor superior a 0,300 como indicador de obesidad de los animales16, según la siguiente fórmula:

Tabla 1 Contenido nutricional de la dieta. 

Componentes Alimento base (%) Manteca vegetal (%) Mezcla final (dieta obesogénica) (%)
Proteína digestible 14.45 0.00 14.45
Fibra 3.40 0.00 3.40
Grasa 5.1 15.0 20.1
EM (Mcal/Kg.) 2.47 1.35 3.82
Lisina Dig. 0.78 0.00 0.78
MET+CIS digestible 0.83 0.00 0.83
Fósforo disponible 0.31 0.00 0.31
Calcio 0.54 0.00 0.54

Contenido del alimento base proporcionado por el Programa de Investigación y Proyección Social en Alimentos. UNALM, y modificación para obtener dieta obesogénica (Condiciones similares a la dieta hipercalórica empleada por Miotto et al15).

peso corporal(g)3largo corporal hocicoano (cm)

El índice de Lee promedio fue de 0,320±0,002, siendo superior a 0,300 que indicaba que las ratas estaban obesas. En la segunda etapa, los animales fueron aleatoriamente asignados a dos tratamientos: uno con dieta obesogénica (Grupo CO, n= 12) y otro con dieta obesogénica suplementada con aceite de linaza (Grupo AL, n= 12); este tratamiento tuvo una duración de 59 días y se midió el perfil lipídico al final del periodo, utilizando el kit Mission Cholesterol Meter17. Ambas dietas presentaron un contenido calórico equivalente. La duración de la primera etapa dependió de los tiempos requeridos para que los animales llegaran homogéneamente a obesidad según el índice de Lee arriba indicado. Se asignaron 12 animales por tratamiento.

Las muestras de aceite de linaza se obtuvieron de fuentes comerciales, la composición química del mismo se determinó siguiendo el método ISO12966-1: 201418 (Tabla 2).

Tabla 2 Composición de los ácidos grasos del aceite de linaza. 

Ácidos grasos Porcentaje (%)
Ácido linolénico (C18: 3n3) 56,8
Ácido linoleico (C18: 2n6) 13,7
Ácido oleico (C18: 1n9) 17,8
Ácido esteárico (C18: 0) 3,3
Ácido palmítico (C16: 0) 4,9

Composición de ácidos grasos determinada por cromatografía líquida (HPLC) siguiendo el método ISO12966-1: 2014.

El aceite de linaza fue administrado una vez al día de forma oral, usando jeringas hipodérmicas de 1 ml de capacidad, los animales tratados recibieron 1 ml/Kg (peso/volumen) de aceite de linaza19. Al finalizar el experimento, las ratas se mantuvieron en ayunas por 12h, luego, anestesiadas con ketamina (70 mg/kg) y xilazina (12 mg/kg) vía intraperitoneal, para ser finalmente sacrificadas vía sobredosis de pentobarbital intracardiaco. Se extrajeron los músculos gastrocnemios y los hígados. Las muestras fueron almacenadas en nitrógeno líquido a -80 °C. Es preciso mencionar que tanto el protocolo de anestesia-sacrificio, como el experimento en su totalidad fueron aprobados por el Comité de Ética y Bienestar Animal de la Facultad de Medicina Veterinaria de la Universidad Nacional Mayor de San Marcos (UNMSM).

Extracción de ácido ribonucleico (ARN) y análisis cuantitativo de la reacción en cadena de la polimerasa de transcripción inversa en tiempo real (qRT-PCR)

Las muestras descongeladas fueron almacenadas en solución de estabilización RNAlaterTM, luego el ARN fue extraído con reactivo TRIzol20. El total de ARN fue cuantificado usando espectrofotometría de microvolumen en NanoDropOneTM (Thermo Fisher Scientific®) a 260 nm y 280 nm. Los valores de ARN fueron considerados apropiados para continuar21. Las muestras óptimas mostraron bandas nítidas en la corrida electroforética22. Luego las muestras fueron tratadas con Turbo DNA-freeTM (Thermo Fisher Scientific®). El cADN fue sintetizado a partir del ARN usando un kit de transcripción reversa Thermo Fisher Scientific®, siguiendo las instrucciones del fabricante23. La cuantificación del cADN se realizó por qRT-PCR usando SYBR Green (Sigma-Aldrich®) en un termociclador Quant Studio24. Los valores de expresión relativa fueron determinados usando ARN ribosomal 18S y el método comparativo 2-ΔΔCt.

Como gen endógeno o gen de referencia, se probaron dos genes, 18S y beta actina. El elegido para normalizar la expresión de los genes de interés UCP3 y PPARα en esta investigación fue el gen 18S, debido a que tuvo una mejor eficiencia que el de beta actina.

Los cebadores forward y reverse utilizados para el gen 18S fueron las siguientes secuencias 5’-GGAGAGGGAGCCTGAGAAAC-3’ y 5’-CAATTACAGGGCCTCGAAAG-3’ respectivamente, con una eficiencia del 100,4%. Las secuencias forward y reverse para el gen de interés UCP3 fueron 5’-ATGCATGCCTACAGAACCAT-3’ y 5’CTGGGCCACCATCCTCAGCA3’ respectivamente, con una eficiencia del 107,4% y por último para el segundo gen de interés PPARα las secuencias respectivas tanto para forward y reverse fueron 5’-AATCCACGAAGCCTACCTGA-3’ y 5’-GTCTTCTCAGCCATGCACAA-3’ respectivamente con una eficiencia de 112%.

Análisis estadístico

Todos los resultados se presentan como valores promedio ± error estándar de la media (SEM). Para evaluar los efectos de la suplementación dietaria con aceite de linaza sobre el peso, respecto a la ingesta de alimento, se aplicó la prueba T de Student a todas las muestras independientes utilizando el paquete estadístico SPSS (versión gratuita 23). Además, la expresión génica se analizó con la prueba T de Student para muestras independientes, entre el grupo de control obeso y el grupo que recibió la suplementación con aceite de linaza, a través del programa Graph PadPrism 7.0. El nivel de significancia fue preestablecido en un valor p<0,05.

RESULTADOS

Se presentan los resultados como media de n= 12 por tratamiento para casi todas las variables a excepción de los resultados de expresión génica el cual n= 6, este número fue tomado aleatoriamente entre las 12 unidades de cada tratamiento, apoyados en el trabajo realizado por Saande et al.25.

La composición de los ácidos grasos del aceite de linaza se puede observar en la tabla 1. El mayor porcentaje (56,8%) corresponde a ácido linolénico (C18: 3n3).

Peso corporal e ingesta de alimentos

Con respecto al peso corporal, la suplementación con aceite de linaza no mostró ningún efecto de reducción del peso corporal, mostrando, por el contrario, un aumento significativo con respecto al grupo control (407±8,92, versus 453±3,91), dicho aumento de peso estuvo acompañado de un ligero y no significativo aumento en la ingesta de alimentos.

Niveles de mARN de genes asociados al metabolismo energético

La figura 1-A, muestra la expresión relativa del gen para la proteína desacoplante 3 (UCP3), de músculo gastrocnemio en el Grupo AL en comparación con el Grupo CO y la figura 1-B muestra la expresión relativa del gen para PPARα analizada desde la matriz del hígado. La suplementación dietaria con aceite de linaza incrementó significativamente la expresión del gen para UCP3 (P<0,05). Sin embargo, no incrementó de forma significativa la expresión del gen para PPARα.

Figura 1-A Expresión relativa del gen UCP3 en músculos esquelético de ratas después de 59 días de tratamiento con suplementación con aceite de linaza y control. Los resultados se expresan como valores promedio ± SEM; n=6. Se aplicó la prueba T-Student para muestras independientes. * Significa que hubo diferencia significativa entre los grupos (p <0,05). 

Figura 1-B Expresión relativa del gen PPARα en hígado de ratas después de 59 días de tratamiento con suplementación con aceite de linaza y control. Los resultados se expresan como valores promedio ± SEM; n=6. Se aplicó la prueba T-Student para muestras independientes. 

DISCUSIÓN

Los animales del Grupo AL, que recibieron una dieta obesogénica suplementada con aceite de linaza, exhibieron un aumento significativo del peso corporal promedio en comparación al Grupo CO, que solo recibió una dieta obesogénica. Así como un ligero, y no significativo incremento en la ingesta, ello podría tener explicaciones de su efecto sobre los diversos factores condicionantes del apetito y la saciedad, los que son bastante amplios y complejos y su estudio está en un pleno e interesante desarrollo. Sin embargo, nuestros resultados con aceite de linaza coinciden con lo reportado por Abdelhalim et al26 quienes también observaron un significativo incremento en el peso corporal de ratas sometidas a una dieta alta en grasa suplementada con aceite de linaza, al compararlas con grupos control con una dieta basal y con una dieta alta en grasa sin suplementación. Por otro lado, ambos casos difieren de lo reportado por Sundaram et al12 en cuyo modelo se evaluaron los efectos de distintas dietas altas en grasa sobre el peso corporal de ratones. Las mencionadas dietas, estuvieron compuestas por distintos aceites: pobres, moderados o ricos en AGPI omega 3, observándose un incremento significativo del peso corporal y una reducción en la ingesta de alimentos en todos los grupos con dieta alta en grasa en comparación al control (dieta basal), pero no encontró diferencias significativas entre los grupos altos en grasa, con respecto al tipo de grasa o la cantidad de AGPI omega 3 disponible. En cambio, Vijaimohan et al19 sí reportaron un descenso significativo en el peso corporal de ratas con una dieta alta en grasa suplementada con aceite de linaza en comparación con la misma dieta sin el suplemento. Sin embargo, el efecto de la suplementación dietaria de AGPI omega 3 sobre el peso corporal en humanos tiene aún resultados controversiales y no concluyentes27,28, al igual que en ratas gestantes no obesas29. Existe evidencia publicada referida al efecto del PPARα sobre la expresión de enzimas relacionadas a la oxidación de los ácidos grasos y sobre el efecto que tienen los AGPI en la expresión de dicho factor de transcripción8, buscamos un efecto en el metabolismo de ratas inducidas a obesidad, aunque el tema de la obesidad, no es solo un problema de peso corporal en sí, sino de muchas consecuencias metabólicas. Los diversos estudios al respecto, pocas veces resultan en disminución de peso si no hay disminución de calorías ingeridas, pero en general, muestran resultados con respecto a otras variables metabólicas.

En el grupo que recibió la suplementación con aceite de linaza, rico en ALA, se observó un incremento significativo en la expresión del gen para UCP3 en el músculo esquelético en comparación con el grupo que recibió solo la dieta obesogénica rica en grasas. Esto concuerda con lo observado por investigadores como Lee et al30 que, en un modelo de cultivo de células musculares murinas, mostraron que la suplementación con EPA y DHA incrementó la expresión de mARN para UCP3 y, en modelos humanos, también se ha observado que la suplementación con AGPI omega 3 en adultos mayores incrementa significativamente la expresión del gen para UCP3 en el músculo esquelético31. También hay en la literatura evidencia que relaciona el aumento de los niveles circulantes de ácidos grasos, independientemente de la fuente de los mismos, con una mayor expresión de UCP3 en el músculo cardiaco y esquelético10,32,33,34.

En el presente estudio se observó, un ligero, pero no significativo incremento en la expresión hepática de PPARα en el grupo suplementado con aceite de linaza, rico en ALA que se considera un precursor del EPA y DHA. Rincon-Cervera et al13 compararon los efectos de la suplementación con aceite de linaza con la suplementación con un aceite mixto de linaza y pescado (rico en ALA, EPA y DHA). Según reportaron, el primer grupo no exhibió un incremento en la expresión hepática de PPARα, mas el segundo grupo sí. La vía metabólica de elongación-desaturación mediante la cual ALA es convertida en DHA y EPA, ha sido descrita en el hígado tanto de ratas como humanos, sin embargo, esta tiende a ser muy pobre29. Tanto los estudios de suplementación con ALA, como los estudios con isotopos estables de ALA han concluido que la taza de conversión a EPA en adultos varones es muy limitada (aproximadamente 8%) y la conversión a DHA es muy baja (<0,1%). En mujeres, la conversión fraccional a DHA es mayor (9%), lo cual podría ser parcialmente debido a una menor utilización de ALA para la beta oxidación en mujeres y una posible interacción del estrógeno con la Δ6-desaturasa35.

Aunque en el presente estudio no se observó una relación significativa entre la suplementación con ALA y la expresión de PPARα, existe evidencia en la literatura que hace esta conexión. González-Mañán et al36 probaron la suplementación con aceite de chía (Salvia hispánica), otra fuente rica en ALA, en ratas, encontrando que éste incrementó los valores plasmáticos, hepáticos y en el tejido adiposo de ALA, EPA y DHA al mismo tiempo que un incremento significativo en la expresión hepática de PPARα. Del mismo modo, se ha reportado que la suplementación dietaria con aceite de linaza en cabras, causó un incremento en la expresión hepática de PPARα. Esta evidencia contradictoria es tan solo prueba de que se requieren más estudios, los índices de conversión de ALA en EPA y DHA son variables.

Si bien los mecanismos moleculares no han sido totalmente dilucidados, y parte de los efectos que se atribuyen a UCP3 se relacionan con la reducción del estrés oxidativo12, existe evidencia que vincula la activación de PPARα con la regulación positiva de UCP3; es el caso de lo publicado por Song et al37 que evaluaron los efectos de la activación de PPARα sobre UCP3, tanto en modelos in vivo como en cultivos celulares, reportando que, en comparación a los controles, las ratas tratadas con ligando para PPARα mostraron incremento en la expresión de UCP3, indicando una cercana relación metabólica entre ambos factores36.

CONCLUSIÓN

La suplementación dietaria con aceite de linaza (Linum usitatissimum) si bien no mostró un efecto reductor del peso corporal en ratas Holtzman inducidas a obesidad, y se observó un ligero incremento en la ingesta de alimentos, éste no resultó estadísticamente significativo; sin embargo, sí incrementó significativamente la expresión del gen UCP3 en el músculo esquelético, y mostró una clara tendencia, aunque no significativa, a incrementar la expresión del gen PPARα en el hígado lo cual indicaría una clara conexión metabólica entre ambos genes y confirmaría potenciales efectos positivos del consumo de aceite de linaza sobre obesidad.

Financiamiento: Estudio financiado como tesis de Maestría en Nutrición, por convenio 183-2015 FONDECYT-CONCYTEC Fondo Nacional de Desarrollo Científico, Tecnológico y de Innovación Tecnológica -Consejo Nacional de Ciencia, el Tecnología E Innovación Tecnológica.

REFERENCIAS

1. Haidar Y, Cosman B. Obesity epidemiology. Clin Colon Rectal Surg. 2011; 24: 205-210. [ Links ]

2. Howard B V, Ruotolo G, Robbins DC. Obesity and dyslipidemia. Endocrinol Metab Clin North Am. 2003; 32: 855-867. [ Links ]

3. Müller M, Kersten S. Nutrigenomics: goals and strategies. Nat Rev Genet. 2003; 4: 315-322. [ Links ]

4. Malcomson FC, Mathers JC. Nutrition, epigenetics and health through life. Nutr Bull. 2017; 42: 254-265. [ Links ]

5. Shahidi F, Ambigaipalan P. Omega-3 polyunsaturated fatty acids and their health benefits. Annu Rev Food Sci Technol. 2018; 9: 345-381. [ Links ]

6. Kersten S. Integrated physiology and systems biology of PPARα. Mol Metab. 2014; 3: 354-371. [ Links ]

7. Grygiel-Górniak B. Peroxisome proliferator-activated receptors and their ligands: nutritional and clinical implications - A review. Nutr J. 2014; 13: 1-10. [ Links ]

8. Echeverría F, Ortiz M, Valenzuela R, Videla LA. Long-chain polyunsaturated fatty acids regulation of PPARs, signaling: Relationship to tissue development and aging. PLEFA. 2016; 114: 28-34. [ Links ]

9. Brondani LA, Assmann TS, de Souza BM, Bouças AP, Canani LH, Crispim D. Meta-analysis reveals the association of common variants in the uncoupling protein (UCP) 1–3 genes with body mass index variability. Plos One. 2014; 9 : e96411. [ Links ]

10. Pohl EE, Rupprecht A, Macher G, Hilse KE. Important trends in UCP3 investigation. Front Physiol. 2019; 10: 470-480 [ Links ]

11. Busiello RA, Savarese S, Lombardi A. Mitochondrial uncoupling proteins and energy metabolism. Front Physiol. 2015; 6: 36. [ Links ]

12. Sundaram S, Bukowski MR, Lie W-R, Picklo MJ, Yan L. High-fat diets containing different amounts of n3 and n6 polyunsaturated fatty acids modulate inflammatory cytokine production in mice. Lipids. 2016; 51: 571-582. [ Links ]

13. Rincón-Cervera MA, Valenzuela R, Hernández-Rodas MC, Barrera C, Espinos, A, Marambio M et al. Vegetable oils rich in alpha linolenic acid increment hepatic n-3 LCPUFA, modulating the fatty acid metabolism and antioxidant response in rats. PLEFA. 2016; 111, 25-35. [ Links ]

14. Reyna GS, Valenzuela R, Villanueva ME. Action of flavonoids on conversion of long chain polyunsaturated fatty acids from essential fatty acids. Rev Chil Nutr. 2018; 45: 153-162. [ Links ]

15. Miotto PM, Horbatuk M, Proudfoot R, Matravadia S, Bakovic M, Chabowski A, et al. α-Linolenic acid supplementation and exercise training reveal independent and additive responses on hepatic lipid accumulation in obese rats. Am J Physiol Endocrinol Metab. 2017; 312: E461-E470. [ Links ]

16. Bernardis LL. Prediction of carcass fat, water and lean body mass from Lee's “nutritive ratio” in rats with hypothalamic obesity. Experientia. 1970; 26: 789-790. [ Links ]

17. Okoduwa S, Umar I, James D, Inuwa H. Anti-diabetic potential of ocimum gratissimum leaf fractions in fortified diet-fed streptozotocin treated rat model of type-2 diabetes. Medicines. 2017; 4: 73. [ Links ]

18. International Organization Standardization -ISO. ISO 12966-1:2014 - Animal and vegetable fats and oils –– Gas chromatography of fatty acid methyl esters –– Part 1: Guidelines on modern gas chromatography of fatty acid methyl esters: https://www.iso.org/standard/52294.htmlLinks ]

19. Vijaimohan K, Jainu M, Sabitha KE, Subramaniyam S, Anandhan C, Shyamala Devi CS. Beneficial effects of alpha linolenic acid rich flaxseed oil on growth performance and hepatic cholesterol metabolism in high fat diet fed rats. Life Sci. 2006; 79: 448-454. [ Links ]

20. Thermo Fisher Scientific. TRIzolTM Reagent User Guide. Doc. Part No. 15596026. PPS Pub. No. MAN0001271. http://tools.thermofisher.com/content/sfs/manuals/trizol_reagent.pdfLinks ]

21. Díaz-Alonso C, Garrote-Santana H, Amor-Vigil A, Suárez-González Y, González-Mugica R. Ribonucleic acid quantification for the performance of RT- PCR technique. Rev Cubana Hematol Inmunol Hemoter. 2013; 3: 298-303. [ Links ]

22. Rizk NM. Effect of high fat diet on skeletal muscle uncoupling protein 3 and hypothalamic neuropeptide Y expression in rats. Int J Diabetes Metab. 2010; 18: 73-80. [ Links ]

23. Applied Biosystems. High Capacity cDNA Reverse Transcription Kits For 200 and 1000 Reactions. Part Number 4375575 Rev. E. https://www.thermofisher.com/document-connect/document-connect.html?url=https://assets.thermofisher.com/TFS-Assets/LSG/manuals/cms_042557.pdfLinks ]

24. Biassoni R, Raso A. Quantitative real-time PCR methods and protocols: Humana Press, New York; 2016 [ Links ]

25. Saande CJ, Bries AE, Pritchard SK, Nass CA, Reed CH, Rowling MJ et al. Whole egg consumption decreases cumulative weight gain in diet-induced obese rats. J Nutr. 2020; 150: 1818-1823. [ Links ]

26. Abdelhalim S, Hegazi M, El-Bagoury M. Influence of Moringa oleifera flaxseed oil and atorvastatin on hyperlipidemic male albino rats. J Cancer Biomed Res. 2019; 1: 13-23. [ Links ]

27. Martínez-Victoria E, Yago MD. Omega 3 polyunsaturated fatty acids and body weight. Br J Nutr. 2012; 107: S107-S116. [ Links ]

28. Rosas-Nexticapa M, Caballero-Rodríguez DA, Herrera-Meza S, Acosta-Mesa H-G, Santiago-Roque I, Valverde L, et al. Supplementation effect of omega-3 fatty acids in overweight and obese Mexican schoolchildren. Interciencia. 2017; 42: 698-704. [ Links ]

29. Reyna S, Gonzáles C, Valenzuela R, Villanueva ME. Effect of purple corn extract on gene expression of srebp-1, Δ5d y Δ6d in mammary gland of nursing rats supplemented with chia oil (Salvia Hispánica L.). Rev Chil Nutr. 2016; 43: 296-302. [ Links ]

30. Lee M-S, Kim I-H, Kim Y. Effects of eicosapentaenoic acid and docosahexaenoic acid on uncoupling protein 3 gene expression in C2C12 muscle cells. Nutrients. 2013; 5: 1660-1671. [ Links ]

31. Yoshino J, Smith GI, Kelly SC, Julliand S, Reeds DN, Mittendorfer B. Effect of dietary n-3 PUFA supplementation on the muscle transcriptome in older adults. Physiol Rep. 2016; 4: e12785. [ Links ]

32. Boudina S, Han YH, Pei S, Tidwell TJ, Henrie B, Tuinei J et al. UCP3 regulates cardiac efficiency and mitochondrial coupling in high fat-fed mice but not in leptin-deficient mice. Diabetes. 2012; 61: 3260-3269. [ Links ]

33. Bevilacqua L, Ramsey JJ, Hagopian K, Weindruch R, Harper M-E. Long-term caloric restriction increases UCP3 content but decreases proton leak and reactive oxygen species production in rat skeletal muscle mitochondria. Am J Physiol Endocrinol Metab. 2005; 289: E429-E438. [ Links ]

34. Pheiffer C, Jacobs C, Patel O, Ghoor S, Muller C, Louw J. Expression of UCP2 in Wistar rats varies according to age and the severity of obesity. J Physiol Biochem. 2016; 72: 25-32. [ Links ]

35. Williams CM, Burdge G. Long-chain n−3 PUFA: plant v. marine sources. Proc Nutr Soc. 2006; 65: 42-50. [ Links ]

36. González-Mañán D, Tapia G, Gormaz JG, D’Espessailles A, Espinosa A, Masson L, et al. Bioconversion of α-linolenic acid to n-3 LCPUFA and expression of PPAR-alpha, acyl coenzyme A oxidase 1 and carnitine acyl transferase I are incremented after feeding rats with α-linolenic acid-rich oils. Food Funct. 2012; 3: 765-772. [ Links ]

37. Song JW, Kim HJ, Lee H, Kim J, Kwak Y-L. Protective effect of peroxisome proliferator-activated receptor α activation against cardiac ischemia-reperfusion injury is related to upregulation of uncoupling protein-3. Oxid Med Cell Longev. 2016; 2016: 3539649. [ Links ]

Recibido: 18 de Julio de 2020; Revisado: 31 de Octubre de 2020; Aprobado: 20 de Diciembre de 2020

*Dirigir correspondencia: María Elena Villanueva Espinoza, Departamento Académico de Nutrición, Facultad de Zootecnia, Universidad Nacional Agraria La Molina. Av. Talara 418, 1-E-1 Jesús María, Lima, Perú. Código Postal 15072. Email: mvillanueva@lamolina.edu.pe

Creative Commons License This is an Open Access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.