SciELO - Scientific Electronic Library Online

 
vol.17 número6High-level soluble expression of the functional peptide derived from the C-terminal domain of the sea cucumber lysozyme and analysis of its antimicrobial activityA novel chloroplastic isopentenyl diphosphate isomerase gene from Jatropha curcas: Cloning, characterization and subcellular localization índice de autoresíndice de materiabúsqueda de artículos
Home Pagelista alfabética de revistas  

Servicios Personalizados

Revista

Articulo

Indicadores

Links relacionados

  • En proceso de indezaciónCitado por Google
  • No hay articulos similaresSimilares en SciELO
  • En proceso de indezaciónSimilares en Google

Compartir


Electronic Journal of Biotechnology

versión On-line ISSN 0717-3458

Electron. J. Biotechnol. vol.17 no.6 Valparaíso nov. 2014

http://dx.doi.org/10.1016/j.ejbt.2014.09.002 

RESEARCH ARTICLE

Molecular cloning and expression analysis of the MaASR1 gene in banana and functional characterization under salt stress

 

Hongxia Miaoa, Yuan Wanga, Juhua Liua, Caihong Jiaa, Wei Hua, Peiguang Sunb, Zhiqiang Jinb, *, Biyu Xua, *

a Key Laboratory of Tropical Crop Biotechnology, Ministry of Agriculture, Institute of Tropical Bioscience and Biotechnology, Chinese Academy of Tropical Agricultural Sciences, Haikou 571101, China
b Key Laboratory of Genetic Improvement of Bananas, Hainan Province, Haikou Experimental Station, Chinese Academy of Tropical Agricultural Sciences, Haikou 570102, China


ABSTRACT

Background

Abscisic acid (ABA)-, stress- and ripening-induced protein (ASR) is plant-specific hydrophilic transcriptional regulators involved in sucrose stress and wounding in banana. However, it is not known whether banana ASR genes confer salt stress tolerance. The contexts of the study was to analysis the sequence characterization of banana ASR1, and identify its expression patterns and function under salt stress using quantitative real-time PCR (qPCR) and overexpression in Arabidopsis. The purpose was to evaluate the role of banana ASR1 to salt stress tolerance employed by plants.

Results

A full-length cDNA isolated from banana fruit was named MaASR1, and it had a 432 bp open reading frame (ORF) encoding 143 amino acids. MaASR1 was preferential expression in roots and leaves compared to low expression in fruits, rhizomes and flowers. Under salt stress, the expression of MaASR1 quickly increased and highest expression level was detected in roots and leaves at 4 h, and then gradually decreased. These results suggested that MaASR1 expression was induced under salt stress. MaASR1 protein was localized in the nucleus and plasma membrane. MaASR1 was transformed to Arabidopsis and verified by southern and northern analysis, transgenic lines L14 and L38 integrated one and two copies of MaASR1, respectively, while overexpression in transgenic lines provided evidence for the role of MaASR1 to salt stress tolerance.

Conclusions

This study demonstrated that overexpression of MaASR1 in Arabidopsis confers salt stress tolerance by reducing the expression of ABA/stress-responsive genes, but does not affect the expression of the ABA-independent pathway and biosynthesis pathway genes.

Keywords: ASR; Banana; Expression patterns; Salt resistance


 

1. Introduction

High salt levels affect the growth and development of most plant species and cause significant losses in crop yield; however, plants also self-regulate to cope with the negative responses of such salt stress [1], [2] and [3]. The major response of plants to salt stress includes abscisic acid (ABA) stress signals, perception, and transduction that involve a complex network of both positively and negatively regulating genes, including ABA biosynthesis, signaling, and transcriptional regulation [4]. However, genes involved in ABA reception and downstream transduction have not been well characterized.

An ABA-, stress-, and ripening-induced (ASR) protein acting as a downstream component of a common transduction pathway for ABA signals was first screened from tomato (Solanum lycopersicum) ripe fruit [5]. Subsequently, at least 24 ASR genes were identified in various species of gymnosperms [6] and [7], monocots [8] and [9], and dicots [10] plants but lacked orthologs in Arabidopsis thaliana [11]. All known ASR genes were shown to possess sequence-specific Zn2 +-dependent DNA binding activity at the N-terminus and a nuclear localization signal at the C-terminus [12]. Subcellular fractionation experiments indicated that the ASR protein is located in the nucleus [10] and cytoplasm [13].

The expression of ASR in various species is not only involved in plant development, but also responds to abiotic stresses [10], [11], [14] and [15]. The high expression of the litchi LcASR (accession no. JX291143) from 0 h at harvest time to 24 h is involved in fruit senescence, ripening, and dehydration [10]. A lily ASR (accession no. ACF57792) is preferentially expressed in the vegetative cell for pollen maturation [14], whereas its expression was induced by ABA, NaCl, or dehydration stress treatment [15]. In wheat, the TaASR1 transcript level increased after treatments with PEG6000, ABA, and H2O2 [16]. Moreover, heterologous or homologous expression of ASR genes from litchi [10], lily [15], wheat [16], maize [17], tobacco [18], rice [19], and tomato [20] conferred abiotic stress resistance by altering the expression of ABA/stress-responsive genes in transgenic plants. However, it is not known whether banana ASR genes confer abiotic stress tolerance by altering the expression of ABA/stress-responsive genes.

Banana (Musa acuminata L.) plays important roles in tropical and subtropical fruit production and agricultural economy. However, banana plant has shallow roots and a permanent green canopy, and is especially sensitive to unfavorable conditions, such as high salt, drought, and cold [21], [22], [23] and [24]. Therefore, understanding the molecular mechanisms of the abiotic stress response is necessary for genetic improvement of stress resistance in banana. Although studies in M. acuminata L. A. Colla and Musa balbisiana L. A. Colla have highlighted mAsr members' role in sucrose stress and wounding [21], the expression patterns and functional characterization of ASR genes in M. acuminata L. AAA group, cv. 'Dwarf Cavendish' (a commercially important Cavendish cultivar) under salt stress remain unknown.

In this study, we obtained a full-length ABA-, stress-, and ripening inducible gene named MaASR1 from banana based on a cDNA fragment that originated from a single clone of a forward suppression subtractive hybridization (SSH) cDNA library of banana fruit [8]. We showed that MaASR1 expression was induced in banana plants under salt stress and overexpression of MaASR1 in A. thaliana improves its tolerance to salt stress. These results suggested that MaASR1 plays an important role in salt stress tolerance.

2. Materials and methods

2.1. Plant materials

The ex vitro plants of banana (M. acuminata L. AAA group, cv. 'Dwarf Cavendish') (ITC 0002) ('Dwarf Cavendish' as known as 'Brazilian') were obtained from the banana tissue culture center (Institute of Banana and Plantain, Chinese Academy of Tropical Agricultural Sciences, Danzhou, Hainan, China). Ex vitro banana plants were grown at 28°C with 70% humidity, 200 µmol·m- 2·s- 1 light intensity, and 16 h light/8 h dark cycle. Ex vitro plants with uniform growth at the five-leaf stage were selected and twelve were divided into four groups for salt treatment. Banana grown in soil were irrigated with half-strength Hoag land's solution [25] supplemented with 300 mM NaCl for 0 h, 2 h, 4 h, and 6 h. All samples were separately frozen in liquid N2 and stored at -70°C for RNA extraction and expression analysis.

The wild-type A. thaliana (Columbia ecotype) seeds were purchased from the Arabidopsis Biological Resource Center (ABRC, Ohio University, Columbus, OH, USA). The DH5a Escherichia coli and the LBA4404 Agrobacterium tumefaciens strains were provided by Professor Jiaming Zhang from the Institute of Tropical Bioscience and Biotechnology, Chinese Academy of Tropical Agricultural Sciences. All Arabidopsis seeds were sown on a 1:1:8 mixture (by weight) of vermiculite, perlite, and peat moss, respectively. Arabidopsis plants were grown at 22°C with 70% humidity and 16 h light/8 h dark cycle (Sylvania GRO LUX fluorescent lamps; Utrecht, The Netherlands).

2.2. RNA extraction and cDNA synthesis

Total RNA was extracted from the roots, leaves, rhizomes, flowers, as well as fruits of banana, leaves and roots after NaCl treatments using the RNeasy kit (QIAGEN, Valencia, CA) according to the manufacturer's instructions. First strand cDNA was synthesized from 2 µg total RNA from each sample using M-MLV Reverse Transcriptase (Invitrogen, Carlsbad, CA).

2.3. Cloning and sequence analysis of MaASR1

The full-length gene encoding MaASR1 was amplified from a banana fruit 2 d after postharvest with the primers (5'-caagcatcccacactcaatac-3' and 5'-cacaagcacaagatcgagg-3') based on the cDNA sequence of MaASR1 isolated from a banana fruit cDNA library [8] with the adapter primers Ptr5' (ctccgagatctggacgagc) and Ptr3' (taatacgactcactcactataggg). The MaASR1 cDNA sequences were submitted to GenBank using the web-based submission tool “BankIt” from the NCBI home page (http://www.ncbi.nlm.nih.gov/Banklt/index.html). A comparison of the similarity of the full-length cDNA sequence of the MaASR1 gene was performed in the GenBank database using the BLAST program (http://www.ncbi.nlm.nih.gov/BLAST/). Amino acid sequences were compared using the DNAMAN software package (Version 5.2.2, Lynnon Biosoft, Canada). A homology tree was constructed by the neighbor-joining method with a Poisson correction model using MEGA 5.05 software (Arizona State University, Tempe, AZ, USA). The number for each interior branch is the percent bootstrap values calculated from 1000 replicates.

2.4. Expression analysis of MaASR1 in different banana tissues and under salt treatment

Expression levels of MaASR1 were assayed by quantitative real-time PCR (qPCR) performed in an iQ5 real-time PCR detection system (Bio-Rad, USA) using the SYBR ExScript RT-PCR kit (Takara, Otsu, Shiga, Japan). The reaction of 25.0 µL contained 12.5 µL SYBR Premix ExTaq, 1.0 µL of each primer at 10.0 µM, 8.5 µL ddH2O and 2.0 µL cDNA (40 ng). MaActin-F and MaActin-R primers (Table 1) were used as a loading control to normalize samples in separate tubes. The qPCR was performed in triplicate for each sample using the primers of MaASR1-F and MaASR1-R (Table 1). The relative expression level of MaASR1 gene was calculated using the 2-ΔΔCT method [26].

 

Table 1. Primers used for qPCR analyses.

Gene name Sequence (5' to 3')
MaASR1 F: agaagcatcaccatcatctc; R: caagcatcccacactcaacac
RD29A F: gataacgttggaggaagagtcggc; R: cagctcagctcctgattcactacc
RD29B F: gtgaagatgactatctcggtggtc; R: gcctaactctccggtgtaacctag
RAB18 F: atgacgagtacggaaatccgatgg; R: tatgtatacacgattgttcgaagc
DREB2A F: aaggtaaaggaggaccagag; R: acacaaccaggagtctcaac
ABI1 F: agagtgtgcctttgtatggtttta; R: catcctctctctacaatagttcgct
AAO3 F: gaaggtcttggaaacacgaagaa; R:gaaatacacatccctggtgtac
MaActin F: cgaggctcaatcaaaga; R: accagcaaggtccaaac
AtActin F: catcaggaaggacttgtacgg; R: gatggacctgactcgtcatac

 

All data were analyzed using IQ5 software in an iQ5 real-time PCR detection system (Bio-Rad, USA).

2.5. Subcellular localization of the MaASR1 protein

The cDNA encoding the ORF of MaASR1 was digested with Nco I and Spe I restriction enzymes and inserted into pCAMBIA1304-GFP expression vector to generate a MaASR1-GFP fusion protein under the control of the cauliflower mosaic virus (CaMV) 35S promoter. The recombinant pCAMBIA1304-MaASR1-GFP plasmid was transferred to the A. tumefaciens strain LBA4404 and introduced into Nicotiana benthamiana leaves as previously described by Goodin et al. [27]. After 48 h incubation on MS at 25°C, fluorescence was examined by fluorescence microscopy (LSM700, Carl Zeiss, Germany).

2.6. Plant transformation and generation of transgenic plants

The MaASR1 coding region was inserted into the pBI121 vector by replacing the ß-glucuronidase following digestion with BamH I and Sac I. The pBI121-MaASR1 was transferred into A. tumefaciens strain LBA 4404. Transgenic Arabidopsis plants were generated using the floral dip-mediated infiltration method [28]. Seeds from T0 transgenic plants were plated in kanamycin selection medium (50 mg·L- 1). Homozygous T3 lines were used for functional investigation of MaASR1.

2.7. Blot analyses

Two kanamycin-resistant transgenic lines from the T3 generation were used to determine the integration of MaASR1 to A. thaliana genome by Southern blotting analysis. Probes from a partial region (389 bp) of the MaASR1 gene for hybridization were prepared from the PCR product by using the primers (5'-ccgaggagaagcaccaccac-3' and 5'-gccaccgct gcagcgatctcctc-3') and used in DIG-dUTP according to the manufacturer's instructions (Roche Applied Science, Mannheim, Germany). Northern blotting was performed according to the manufacturer's instructions (Roche Applied Science, Mannheim, Germany). Probe of northern blotting was labeled using a random primer labeling system (Cat.1093657, Roche Applied Science, Mannheim, Germany). After hybridization, the membrane was washed and exposed to X-ray film (Kodak BioMax MS system) according to the methods of Miao et al. [29].

2.8. Salt stress and ABA treatment in wild-type and transgenic plants

For salt stress tolerance analysis, 4 week old plants were irrigated with 300 mM NaCl and survival rates were assessed after 15 d. For expression analysis of ABA/stress-responsive genes in wild-type and transgenic plants, 15 d old seedlings were transferred to 1/2 MS agar plates supplemented with 300 mM NaCl for 12 h or 100 µM ABA for 6 h.

The expression patterns of three ABA/stress-responsive genes (RD29a, RD29b, and RAB18), one ABA-independent pathway gene (DREB2A), one upstream element of ABA signaling pathway (ABI1), and an ABA biosynthesis rate-limiting enzyme gene (AAO3) in the leaves of MaASR1 overexpressing transgenic plants and wild-type A. thaliana after NaCl or ABA treatments were detected by qPCR using corresponding primers (Table 1) and the AtActin as a control. The amplification program consisted of one cycle of 95°C for 1 min, followed by 40 cycles of 95°C for 10 s, 55°C-58°C for 15 s, and 72°C for 30 s. The expression levels of these genes were verified in triplicate and calculated using the 2- ΔΔCT method [26].

3. Results

3.1. Isolation and sequence analysis of banana MaASR1

A full-length ASR gene was obtained from the banana fruit and designated as MaASR1. The gene was deposited in GenBank under the Accession number AAT35818. Sequence analysis revealed that the full-length MaASR1 cDNA has a 432 bp open reading frame (ORF) (Phred scores > 20) that encodes 143 amino acids. The deduced amino acid sequence of MaASR1 contained the conserved N-terminal DNA binding site and a putative nuclear C-terminal localization signal (Fig. 1), and it shared 62 and 66% identities with rice (OsASR1, AAB96681) and maize (ZmASR1, CAA72998), respectively (Fig. 2).

Fig. 1. Alignment of predicted amino acid sequences of ASR genes from different plants. (a) Domain: Zn2 +-dependent DNA binding site in the N-terminal, (b) domain: a conserved nuclear localization signal in the C-terminal.

Fig. 2.  Phylogenetic tree analysis of the deduced amino acid sequences of ASR genes in different species. OsASR1 (accession no. AAB96681), ZmASR1 (accession no. CAA72998), MaASR (accession no. AY628102), LeAsr1 (accession no. AAA34137), LeAsr3 (accession no. CAA52874), Ci21A-like (accession no. AAD00255), LeAsr2 (accession no. CAA52873), VvASR (accession no. AAK69513), PtASR1 (accession no. AAB03388).

3.2. Differential expression of MaASR1 in various banana tissues

There were significant differences in the MaASR1 expression in different banana tissues. MaASR1 expression was detected in roots, leaves, rhizomes, flowers, and fruits. The roots showed the highest gene expression level, together with leaves, fruits, and flowers; the lowest level was found in rhizomes. The MaASR1 expression level in roots was approximately 11-fold higher than that in rhizomes (Fig. 3a).

Fig. 3. MaASR1 expression analysis in different tissues and under salt stress. (a) MaASR1 expression in different tissues by qPCR, (b) phenotypes of banana leaves and roots under salt stress, (c) MaASR1 expression analysis in banana leaves and roots under salt stress. Data are means ± SE of biological replicates (n = 3). Means, denoted by the same letter, do not significantly differ, when set at P < 0.05, as determined by Duncan's multiple range tests.

3.3. Phenotype and expression analysis of MaASR1 in banana plants under salt stress

The phenotype and expression of MaASR1 in banana plants at different times under salt treatments were examined to determine the transcriptional response of MaASR1 to salt stress. The results showed that banana roots and leaves exhibited different phenotypes at different times under salt stress. At 6 h under salt stress, the banana roots were black and leaves exhibited obvious brown spots (Fig. 3b). Significant differences in MaASR1 expression were detected in the roots and leaves under salt stress. The expression levels of MaASR1 quickly increased and reached its maximum levels in roots and leaves at 4 h. The expression in roots was approximately 3-fold higher than that in leaves at 4 h, and then gradually decreased over time (Fig. 3c). These results indicated that MaASR1 expression was obviously induced in banana roots and leaves while roots may be more sensitive to salt stress.

3.4. MaASR1 localizes to the nucleus and plasma membrane

To determine the subcellular localization of the MaASR1 protein, its ORF was introduced into the pCAMBIA1304-GFP vector upstream of the GFP gene to create a MaASR1-GFP translational fusion construct. The recombinant pCAMBIA1304-MaASR-GFP fusion was infiltrated into the leaves of N. benthamiana. We observed that the green fluorescence MaASR1-GFP was confined to the nucleus and plasma membrane (Fig. 4). These results indicated that MaASR1 is targeted to the nucleus and plasma membrane.

Fig. 4. Subcellular localization of the MaASR1 fused with GFP. The recombinant pCAMBIA1304-MaASR1-GFP plasmid was transferred to the A. tumefaciens strain LBA4404 and introduced into N. benthamiana leaves as previously described by Goodin et al. [27]. The fluorescence was examined by fluorescence microscopy (LSM700, Carl Zeiss, Germany). (a) Green fluorescence in dark field, (b) Green fluorescence in bright field.

3.5. Blot analyses of MaASR1 overexpressing transgenic lines

To examine the function of MaASR1 in plants, MaASR1 was introduced into a pBI121 vector under the control of a 35S promoter. After a floral-dip transformation of Arabidopsis, two kanamycin-resistant transgenic lines from the T3 generation were obtained. The copy number of these two transgenic lines was investigated by Southern blotting analysis. These results showed that the L14 line integrated two copies of MaASR1, while the L38 line integrated one copy of MaASR1 (Fig. 5a). Northern analysis confirmed that the MaASR1 transcripts were present in the leaf tissue of two transgenic lines compared to that no expression was detected in wild-type plants (Fig. 5b).

Fig. 5. Blot analysis and responses to salt stress of MaASR1 transgenic lines in Arabidopsis. (a) The copy number of MaASR1 transgenic lines by Southern blotting, (b) the expression of MaASR1 transgenic lines by northern blotting, (c) photographs of wild-type and transgenic lines under normal or saline conditions, (d) survival rates of wild-type and transgenic lines under saline conditions. WT: wild-type; L14, L38: MaASR1 transgenic lines. Data are means ± SE of biological replicates (n = 4). Means denoted by the same letter do not significantly differ, when set at P < 0.05, as determined by Duncan's multiple range tests.

3.6. Overexpression of MaASR1 enhances tolerance to salt stress

When mature Arabidopsis plants were subjected to 300 mM NaCl treatment for 15 d, the transgenic plants exhibited better growth and a higher survival rate than that of the wild-type (Fig. 5c and Fig. 5d), where the survival rate of wild-type, L14, and L38 was 10.7, 87.3, and 82.7%, respectively (Fig. 5d). These results showed that overexpressing of MaASR1 in Arabidopsis plants were more tolerant to salt stress than the wild-type.

3.7. Overexpression of MaASR1 decreases the expression of ABA/stress-responsive genes by NaCl treatment

To improve our understanding of MaASR1 function during salt stress tolerance, the expression of several ABA/stress-responsive genes was examined in the wild-type plants and the MaASR1 overexpressing transgenic plants (Fig. 6). Without the addition of NaCl, no significant difference was observed in the transcription of tested genes (RD29a, RD29b, RAB18, DREB2A, ABI1, and AAO3) in the MaASR1 overexpressing transgenic plants compared to wild-type plants. Under salt stress, however, transgenic plants exposed to 6 h or 12 h of salt treatment exhibited reduced expression of RD29A, RD29b, and RAB18 compared to wild-type plants that were similarly treated (Fig. 6). The expression of DREB2A, ABI1, and AAO3 revealed similar trends at 6 h between wild-type and transgenic plants under salt stress (Fig. 6). This result indicated that MaASR1 overexpression led to the down-regulation of ABA/stress-responsive genes under salt stress conditions, but didn't affect the expressions of ABA-independent pathway and biosynthetic pathways genes.

Fig. 6. Expression analysis of ABA/stress-responsive genes in wild-type and MaASR1 overexpressing transgenic plants by NaCl treatment. WT: wild-type; L14, L38: MaASR1 transgenic lines. Data are means ± SE of biological replicates (n = 4). Means denoted by the same letter do not significantly differ when set at P < 0.05 as determined by Duncan's multiple range tests.

 

3.8. Overexpression of MaASR1 enhances the response of plants to ABA by exogenous ABA treatment

Under exogenous ABA treatment, the expressions of several ABA/stress-responsive genes, such as RD29a, RD29b, RAB18, and ABI1, were obviously increased in MaASR1 overexpressing transgenic plants compared to wild-type plants that were similarly treated (Fig. 7). However, the expression of ABA-independent pathway gene DREB2A and ABA biosynthetic pathway gene AAO3 revealed similar trends between wild-type and transgenic plants by ABA treatment (Fig. 7). This result suggested that overexpression of MaASR1 might enhance the response of plants to ABA/stress signal pathway, but was no involved in ABA-independent and ABA biosynthetic pathways.

Fig. 7. Expression analysis of ABA/stress-responsive genes in wild-type and MaASR1 overexpressing transgenic plants by ABA treatment. WT: wild-type; L14, L38: MaASR1 transgenic lines. Data are means ± SE of biological replicates (n = 4). Means denoted by the same letter do not significantly differ when set at P < 0.05 as determined by Duncan's multiple range tests.

 

4. Discussion

In this study, MaASR1 was identified in banana. MaASR1 contains an ORF encoding 143 amino acids and two highly conserved regions, including Zn2 +-DNA binding sites at the N-terminus and a nuclear localization signal at the C-terminus (Fig. 1), whose structure was similar to ASR genes from lily [15] and tomato [18], and therefore was characterized as a potential ASR family member. Compared with other banana cultivars, the MaASR1 from the M. acuminata L. AAA group, cv. 'Dwarf Cavendish' (accession no. AAT35818) shared 97 and 86% similarity with Asr amino acid sequences from the M. acuminata L. AAA group cultivars 'Mbwazirume' (accession no. ACZ60129) and 'Williams' (accession no. ACZ50751). Amino acid sequence differences may be because these ASR genes are from different banana cultivars or different ASR family members. Although another mAsr1 (accession no. ACZ60119) was reported in different banana (M. acuminata subsp. burmannicoides) cultivar [21], amino acid sequence differences exist in the N-terminus, which suggests that MaASR1 is different from mAsr1. Compared with other species, MaASR1 shares higher similarities with rice OsASR1 (accession no. AAB96681) and maize ZmASR1 (accession no. CAA72998) (Fig. 2), which indicates that MaASR1 might be a relatively conserved gene.

Distinct ASR family members exhibit variable responses to abiotic stress [21] and [30]. In tomato, Asr1 and Asr2 are members of the family preferentially induced by desiccation in leaves; Asr2 is the only one activated in the roots from water-deficit-stressed plants [30]. Wheat TaASR1 transcript levels increase after treatments with PEG6000, ABA, and H2O2 [16]. The expression of lily LLA23 is induced following the application of ABA, NaCl, or dehydration [15]. LcAsr was expressed in postharvest uncovered litchi fruit [10]. In banana meristems, mAsr1 and mAsr3 were induced by sucrose stress and wounding, while mAsr3 and mAsr4 were induced by exposure to ABA [21]. In this study, the expression of MaASR1 was induced by salt stress (Fig. 3b and Fig. 3c), consistent with that reported for the tomato Asr1 [18] and [31], but we found that the expression level of MaASR1 in roots was approximately 3-fold higher than in leaves at 4 h under salt treatment (Fig. 3c). These results indicated that the expression of MaASR1 might be induced in leaves and roots by salt stress but banana roots might be more sensitive to salt stress.

Different ASR proteins' subcellular distribution patterns were observed in tomato [5], litchi [10], wheat [16], and lily [15]. The ASR1 from tomato was first reported as a nuclear protein [5]. The result supported the fact that most ASR proteins, such as lily [15], litchi [10], and wheat [16] were found in the nucleus. However, Kalifa et al. [18] reported that tomato ASR1 was localized in both the cytosol and the nucleus. During the early stages of pollen maturation, the ASR protein from lily translocates from the cytosol into the nucleus [14]. In this study, we demonstrated that the MaASR1 protein localized to the nucleus and plasma membrane (Fig. 1c), suggesting that it acts as a part of a transcription-regulating complex. However, further experiments are needed to determine the specific functions and cellular mechanisms of MaASR1 in the nucleus and plasma membrane.

ASRs are involved in abiotic stress tolerance [9], [15], [16] and [18]. In our study, to investigate the function of MaASR1, two MaASR1 overexpressing Arabidopsis transgenic lines were generated and confirmed by Southern blot and northern blot (Fig. 5a and Fig. 5b). Under salt stress, the MaASR1 transgenic plants exhibited increased tolerance to salt stress compared to the wild-types (Fig. 5c). The survival rates of MaASR1 overexpressing transgenic plants were higher than that in the wild-type (Fig. 5d). These results demonstrated that overexpression of MaASR1 genes confers salt stress tolerance to transgenic plants by enhancing the survival rates. The finding will have important theoretical and practical significance for improving the adaptability of banana plants to salt stress, breeding new varieties, and expanding the cultivation area of banana.

ABA-dependent signal transduction pathways play a crucial role in the adaptation of plants to abiotic stress [32]. The expression of several ABA/stress-responsive marker genes, including RD29a, RD29b, and RAB18D, are induced by abiotic stresses [24], [33] and [34]. DREB2A is a DRE/CRT-binding transcription factor; its expression is not induced by ABA and abiotic stresses [35]. The ABI1 and AAO3 belonged to the upstream element of the ABA signaling pathway and ABA biosynthesis rate-limiting enzyme, respectively [33]. Under water stress, some ABA/stress-responsive genes, such as RD29a, RD29b, and RAB18, were up-regulated in wild-type Arabidopsis plants, indicating that the injury which resulted from water stress induces the expression of ABA/stress-responsive genes [36]. We examined the expression of ABA/stress-responsive genes (RD29a, RD29b, and RAB18), DREB2A, ABI1 and AAO3 in MaASR1 overexpressing transgenic plants and wild-type plants. The expression of DREB2A, ABI1 and AAO3 presented similar trends between wild-type and transgenic lines under salt stress; however, the ABA/stress-responsive genes (RD29a, RD29b, and RAB18) were down-regulated in the transgenic plants subjected to salt treatments in comparison to similarly treated wild-type plants (Fig. 6). This result suggests that the MaASR1 overexpressing transgenic plants might be involved in enhancing salt stress tolerance through reducing expression of the ABA/stress-responsive genes, but didn't affect the expression of ABA-independent pathway gene, the upstream element of ABA signaling pathway gene, and an ABA biosynthesis pathway gene.

ABA plays important regulatory roles in plant growth, development [37], and fruit ripening [38], particularly in the ability to respond to various unfavorable environmental stresses, including drought, salt [39], and cold [40]. In lily, constitutive expression of LLA23 in transgenic plants significantly reduced ABA sensitivity and enhanced drought and salt resistance [15]. The constitutive overexpression of OsASR1 also involved ABA signaling and increased high salinity stress tolerance in rice [19]. However, it is not known whether overexpression of MaASR1 is involved in ABA signaling and enhances salt stress tolerance. In this study, we compared the expression of RD29a, RD29b, RAB18D, DREB2A, ABI1, and AAO3 in MaASR1 transgenic plants and wild-type by ABA treatment. DREB2A and AAO3 exhibited similar trends between wild-type and transgenic plants under ABA treatment. However, the expression levels of RD29a, RD29b, RAB18D, and ABI1 were higher in MaASR1 overexpressing transgenic plants than that in the wild-type (Fig. 7). These results suggest that MaASR1 overexpression is likely to involve ABA signaling and enhances the salt stress tolerance by altering the expression of the ABA/stress-responsive genes (RD29a, RD29b, and RAB18D) and the upstream element of ABA signaling pathway (ABI1).

5. Concluding remarks

A full-length cDNA of MaASR1 (accession number: AAT35818) was obtained from banana (M. acuminata L. AAA group, cv. 'Dwarf Cavendish') and it was obviously induced under salt stress. MaASR1 overexpression resulted in enhanced tolerance to salt stress by reducing expression of the ABA/stress-responsive genes, but didn't affect the expression of ABA-independent pathway and biosynthesis pathway genes. Further studies are required to identify the direct target genes of MaASR1 using Chromatin Immunoprecipitation (ChIP). This will enhance our understanding of the molecular interaction mechanisms of MaASR1 in enhancing salt stress tolerance, improving the adaptability of plants to salt stress.

Conflict of interest

All the authors do not have any possible conflicts of interest.

Financial support

Agency/Institution: National Natural Science Foundation of China (Project number: No. 31071788); Ministry of Science and Technology of the People's Republic of China (Project number: No. 2011AA10020605); Ministry of Agriculture of the People's Republic of China (Project number: CARS-32); Natural Science Foundation of Hainan Province (Project number: No. 314116).

Author contributions

Proposed the theoretical frame: ZJ, BX. Conceived and designed the experiments: BX, HM. Contributed reagents/materials/analysis tools: JL, CJ, WH. Wrote the paper: HM. Performed the experiments: YW, HM, JL. Analyzed the data: HM, PS.

References

1. Ashraf M, Harris PJC. Potential biochemical indicators of salinity tolerance in plants. Plant Sci 2004;166:3-16. http://dx.doi.org/10.1016/j.plantsci.2003.10.024.

2. Van Ha C, Leyva-González MA, Osakabe Y, Tran UT, Nishiyama R, Watanabe Y, et al. Positive regulatory role of strigolactone in plant responses to drought and salt stress. Proc Natl Acad Sci U S A 2014;111:851-6. http://dx.doi.org/10.1073/pnas.1322135111.

3. Tavakkoli E, Fatehi F, Coventry S, Rengasamy P, McDonald GK. Additive effects of Na+ and Cl- ions on barley growth under salinity stress. J Exp Bot 2011;62: 2189-203. http://dx.doi.org/10.1093/jxb/erq422.

4. Duan L, Dietrich D, Ng CH, Chan PMY, Bhalerao R, Bennett MJ, et al. Endodermal ABA signaling promotes lateral root quiescence during salt stress in Arabidopsis seedlings. Plant Cell 2013;25:324-41. http://dx.doi.org/10.1105/tpc.112.107227.

5. Iusem ND, Bartholomew DM, Hitz WD, Scolnik PA. Tomato (Lycopersicon esculentum) transcript induced by water deficit and ripening. Plant Physiol 1993; 102:1353-4. http://dx.doi.org/10.1104/pp.102.4.1353.

6. Padmanabhan V, Dias DMAL, Newton RJ. Expression analysis of a gene family in loblolly pine (Pinus taeda L.) induced by water deficit stress. Plant Mol Biol 1997; 35:801-7. http://dx.doi.org/10.1023/A:1005897921567.

7. Shen G, Pang Y, Wu W, Deng Z, Liu X, Lin J, et al. Molecular cloning, characterization and expression of a novel Asr gene from Ginkgo biloba. Plant Physiol Biochem 2005; 43:836-43. http://dx.doi.org/10.1016/j.plaphy.2005.06.010.

8. Xu BY, Su W, Liu JH, Wang JB, Jin ZQ. Differentially expressed cDNAs at the early stage of banana ripening identified by suppression subtractive hybridization and cDNA microarray. Planta 2007;226:529-39. http://dx.doi.org/10.1007/s00425-007-0502-6.

9. Liu HY, Dai JR, Feng DR, Liu B, Wang HB, Wang JF. Characterization of a novel plantain Asr gene, MpAsr, that is regulated in response to infection of Fusarium oxysporum f. sp. cubense and abiotic stresses. J Integr Plant Biol 2010;52:315-23. http://dx.doi.org/10.1111/j.1744-7909.2010.00912.x.

10. Liu JH, Jia CH, Dong FY, Wang JB, Zhang JB, Xu Y, et al. Isolation of an abscisic acid senescence and ripening inducible gene from litchi and functional characterization under water stress. Planta 2013;237:1025-36. http://dx.doi.org/10.1007/s00425-012-1820-x.

11. González RM, Iusem ND. Twenty years of research on Asr (ABA-stress-ripening) genes and proteins. Planta 2014;239:941-9. http://dx.doi.org/10.1007/s00425-014-2039-9.

12. Çakir B, Agasse A, Gaillard C, Saumonneau A, Delrot S, Atanassova R. A grape ASR protein involved in sugar and abscisic acid signaling. Plant Cell 2003;15:2165-80. http://dx.doi.org/10.1105/tpc.013854.

13. Wang CS, Hsu SW, Hsu YF. New insights into desiccation-associated gene regulation by Lilium longiflorum ASR during pollenmaturation and in transgenic Arabidopsis. Int Rev Cell Mol Biol 2013;301:37-94. http://dx.doi.org/10.1016/B978-0-12-407704-1.00002-6.

14. Wang HJ, Hsu CM, Jauh GY, Wang CS. A lily pollen ASR protein localizes to both cytoplasm and nuclei requiring a nuclear localization signal. Physiol Plant 2005; 123:314-20. http://dx.doi.org/10.1111/j.1399-3054.2005.00454.x.

15. Yang CY, Chen YC, Jauh GY, Wang CS. A lily ASR protein involves abscisic acid signaling and confers drought and salt resistance in Arabidopsis. Plant Physiol 2005;139:836-46. http://dx.doi.org/10.1104/pp.105.065458.

16. Hu W, Huang C, Deng X, Zhou S, Chen L, Li Y, et al. TaASR1, a transcription factor gene in wheat, confers drought stress tolerance in transgenic tobacco. Plant Cell Environ 2013;36:1449-64. http://dx.doi.org/10.1111/pce.12074.

17. Jeanneau M, Gerentes D, Foueillassar X, Zivy M, Vidal J, Toppan A. Improvement of drought tolerance in maize: Towards the functional validation of the Zm-Asr1 gene and increase of water use efficiency by over-expressing C4-PEPC. Biochimie 2002; 84:1127-35. http://dx.doi.org/10.1016/S0300-9084(02)00024-X.

18. Kalifa Y, Gilad A, Konrad Z, Zaccai M, Scolnik PA, Bar-Zvi D. The water- and saltstress- regulated Asr1 (abscisic acid stress ripening) gene encodes a zinc-dependent DNA-binding protein. Biochem J 2004;381:373-8. http://dx.doi.org/10.1042/BJ20031800.

19. Joo J, Lee YH, Choi DH, Cheong JJ, Kim YK, Song SI. Rice ASR1 has function in abiotic stress tolerance during early growth stages of rice. J Korean Soc Appl Biol Chem 2013;56:349-52. http://dx.doi.org/10.1007/s13765-013-3060-6.

20. Ricardi MM, González RM, Zhong S, Dominguez PG, Duffy T, Turjanski PG, et al. Genome-wide data (ChIP-seq) enabled identification of cell wall-related and aquaporin genes as targets of tomato ASR1, a drought stress-responsive transcription factor. BMC Plant Biol 2014;14:29. http://dx.doi.org/10.1186/1471-2229-14-29.

21. Henry IM, Carpentier SC, Pampurova S, Hoylandt AV, Panis B, Swennen R. Structure and regulation of the Asr gene family in banana. Planta 2011;234:785-98. http://dx.doi.org/10.1007/s00425-011-1421-0.

22. Singh Shekhawat UK, Srinivas L, Ganapathi TR. MusaDHN-1, a novel multiple stress-inducible SK3-type dehydrin gene, contributes affirmatively to drought- and salt-stress tolerance in banana. Planta 2011;234:915-32. http://dx.doi.org/10.1007/s00425-011-1455-3.

23. Shan W, Kuang JF, Lu WJ, Chen JY. Banana fruit NAC transcription factorMaNAC1 is a direct target of MaICE1 and involved in cold stress through interactingwithMaCBF1. Plant Cell Environ 2014;37:2116-27. http://dx.doi.org/10.1111/pce.12303.

24. Xu Y, Hu W, Liu JH, Zhang JB, Jia CH, Miao HX, et al. A banana aquaporin gene, MaPIP1;1, is involved in tolerance to drought and salt stresses. BMC Plant Biol 2014;14:59. http://dx.doi.org/10.1186/1471-2229-14-59.

25. Hoagland DR, Snyder WC. Nutrition of strawberry plants under controlled conditions: (a) Effects of deficiencies of boron and certain other elements: (b) Susceptibility to injury from sodium salts. Proc Am Soc Hortic Sci 1933;30: 288-94.

26. Livak KJ, Schmittgen TD. Analysis of relative gene expression data using real-time quantitative PCR and the 2-ΔΔCt method. Methods 2001;25:402-8. http://dx.doi.org/10.1006/meth.2001.1262.

27. Goodin MM, Dietzgen RG, Schichnes D, Ruzin S, Jackson AO. pGD vectors: Versatile tools for the expression of green and red fluorescent protein fusions in agroinfiltrated plant leaves. Plant J 2002;31:375-83. http://dx.doi.org/10.1046/j.1365-313X.2002.01360.x.

28. Clough SJ, Bent AF. Floral dip: A simplified method for Agrobacterium-mediated transformation of Arabidopsis thaliana. Plant J 1998;16:735-43. http://dx.doi.org/10.1046/j.1365-313x.1998.00343.x.

29. Miao HX, Qin YH, Da Silva JAT, Ye ZX, Hu GB. Cloning and expression analysis of S-RNase homologous gene in Citrus reticulate Blanco cv. Wuzishatangju. Plant Sci 2011;180:358-67. http://dx.doi.org/10.1016/j.plantsci.2010.10.012.

30. Maskin L, Gudesblat GE, Moreno JE, Carrari FO, Frankel N, Sambade A, et al. Differential expression of the members of the Asr gene family in tomato (Lycopersicon esculentum). Plant Sci 2001;161:739-46. http://dx.doi.org/10.1016/S0168-9452(01)00464-2.

31. Amitai-Zeigerson H, Scolnik PA, Bar-Zvi D. Tomato Asr1 mRNA and protein are transiently expressed following salt stress, osmotic stress and treatment with abscisic acid. Plant Sci 1995;110:205-13. http://dx.doi.org/10.1016/0168-9452(95)94515-K.

32. Yamaguchi-Shinozaki K, Shinozaki K. Transcriptional regulatory networks in cellular responses and tolerance to dehydration and cold stresses. Annu Rev Plant Biol 2006; 57:781-803. http://dx.doi.org/10.1146/annurev.arplant.57.032905.105444.

33. Xiong L, Ishitani M, Lee H, Zhu JK. The Arabidopsis LOS5/ABA3 locus encodes a molybdenum cofactor sulfurase and modulates cold stress-and osmotic stress-responsive gene expression. Plant Cell 2001;13:2063-83. http://dx.doi.org/10.1105/tpc.13.9.2063.

34. Kim JM, To TK, Nishioka T, Seki M. Chromatin regulation functions in plant abiotic stress responses. Plant Cell Environ 2010;33:604-11. http://dx.doi.org/10.1111/j.1365-3040.2009.02076.x.

35. Sakuma Y, Maruyama K, Osakabe Y, Qin F, Seki M, Shinozaki K, et al. Functional analysis of an Arabidopsis transcription factor, DREB2A, involved in droughtresponsive gene expression. Plant Cell 2006;18:1292-309. http://dx.doi.org/10.1105/tpc.105.035881.

36. Yao X, Xiong W, Ye T, Wu Y. Overexpression of the aspartic protease ASPG1 gene confers drought avoidance in Arabidopsis. J Exp Bot 2012;63:2579-93. http://dx.doi.org/10.1093/jxb/err433.

37. Tanaka Y, Nose T, Jikumaru Y, Kamiya Y. ABA inhibits entry into stomatal-lineage development in Arabidopsis leaves. Plant J 2013;74:448-57. http://dx.doi.org/10.1111/tpj.12136.

38. Soto A, Ruiz KB, Ravaglia D, Costa G, Torrigiani P. ABA may promote or delay peach fruit ripening through modulation of ripening- and hormone-related gene expression depending on the developmental stage. Plant Physiol Biochem 2013; 64:11-24. http://dx.doi.org/10.1016/j.plaphy.2012.12.011.

39. Zhang J, Jia W, Yang J, Ismail AM. Role of ABA in integrating plant responses to drought and salt stresses. Field Crop Res 2006;97:111-9. http://dx.doi.org/10.1016/j.fcr.2005.08.018.

40. Gilmour SJ, Thomashow MF. Cold acclimation and cold-regulated gene expression in ABA mutants of Arabidopsis thaliana. Plant Mol Biol 1991;17:1233-40. http://dx.doi.org/10.1007/BF00028738.


*Corresponding author: E-mail address: biyuxu@126.com (B. Xu).

Received 7 June 2014, Accepted 13 August 2014, Available online 18 September 2014

Copyright © 2014 Pontificia Universidad Católica de Valparaíso. Production and hosting by Elsevier B.V. All rights reserved. Peer review under responsibility of Pontificia Universidad Católica de Valparaíso.

 

Creative Commons License Todo el contenido de esta revista, excepto dónde está identificado, está bajo una Licencia Creative Commons