SciELO - Scientific Electronic Library Online

 
vol.24 número6Fiebre tifoidea: Emergencia, cúspide y declinación de una enfermedad infecciosa en ChileEvaluación retrospectiva de la vigilancia de Streptococcus pneumoniae causante de enfermedades invasoras en adultos de la Región Metropolitana-Chile: 2000-2006 índice de autoresíndice de materiabúsqueda de artículos
Home Pagelista alfabética de revistas  

Servicios Personalizados

Revista

Articulo

Indicadores

Links relacionados

Compartir


Revista chilena de infectología

versión impresa ISSN 0716-1018

Rev. chil. infectol. v.24 n.6 Santiago dic. 2007

http://dx.doi.org/10.4067/S0716-10182007000600002 

 

Rev Chil Infect 2007; 24 (6): 441 -445

Artículo Original

Utilidad de la reacción de polimerasa en cadena en tiempo real en el diagnóstico de infecciones por virus respiratorio sincicial en adultos

Utility of real time polymerase chain reaction in the diagnosis of respiratory syncytial virus infection among adult patients

 

Ricardo Rabagliati B., Michel Serri V., Luisa Montecinos P, Teresa Azocar A. y Marcela Ferrés G.

Pontificia Universidad Católica de Chile, Departamento de Medicina Interna Programa de Enfermedades Infecciosas del adulto (RRB, MSV) Departamento de Pediatría y Centro de Investigaciones Médicas Laboratorio de Infectología Virología Molecular (LMP, TAA, MFG). Santiago.

Dirección para correspondencia


Resumen

Introducción: Las infecciones respiratorias virales (IRV) son causa importante de morbilidad en adultos. Virus respiratorio sincicial (VRS) causa hasta 20% de las IRV en esta edad; sin embargo, su diagnóstico es subestimado debido a una menor sensibilidad de las técnicas diagnosticas convencionales (IF y ELISA). Objetivos: Evaluar el impacto del uso de reacción de la polimerasa en cadena en tiempo real (TR-RPC en tiempo real) en el diagnóstico de IRV por VRS en adultos y caracterizar su perfil clínico. Pacientes y Métodos: Durante ocho semanas del año 2005, los adultos hospitalizados en Hospital Clínico de la Universidad Católica con sospecha de IRV, e IFD negativa para VRS, FLU-A, -B, paraFLU-1, 2, 3 y ADV de muestra de hisopado nasofaríngeo, fueron sometidos a detección de VRS por TR-RPC en tiempo real. Se confeccionó una base de datos con los antecedentes clínicos, laboratorio y evolución de cada paciente. Resultados: De 114 pacientes con IFD negativa en 17 (14,9%) se detectó VRS. Fiebre, congestión faríngea, tos y signos de obstrucción bronquial, configuraron en más de 80% de los casos el perfil clínico de los pacientes. Treinta por ciento presentaba enfermedad crónica y 47% eran inmunocomprometidos. Tres de 17 (18%) presentaron descompensación de la enfermedad de base y 1/17 (6%) requirió ventilación mecánica. No hubo mortalidad asociada. Conclusiones: El uso de TR-RPC en tiempo real permitió duplicar la detección de infecciones por VRS en adultos hospitalizados respecto a las diagnosticadas por IFD. Se recomienda considerar el empleo la técnica de TR-RPC en tiempo real en aquellos pacientes con sospecha clínica de VRS durante la temporada de VRS y estudio viro lógico negativo por métodos convencionales.

Palabras claves: Virus respiratorio sincicial, virus respiratorios, infección viral, TR-RPC en tiempo real.


Introduction: Viral respiratory infections (VRI) are a frequent cause of morbidity among adult population. Respiratory syncytial virus (RSV) produces 20%> of VRI, however diagnosis is limited for a low sensitivity of conventional (FDA and ELISA) tests. Aim: To assess the impact of real time reverse transcriptase-polymerase chain reaction (real time RT-PCR) technique in RSV diagnosis in adult hospitalized patients; to characterize RSV infection among these patients. Patients and Methods: All adults hospitalized in Hospital Clínico Universidad Católica during 8 weeks of winter season, with clinical picture of VRI, and with negative DFA for influenza A and B, parainfluenza 1, 2, 3 and adenovirus were included. Real time RT-PCR was performed from nasopharyngeal sample. Clinical information, general laboratory exams and chest X ray reports were collected. Results: Out of 114 patients with negative DFA, 17 (14.9%o) Debe decir: RSV cases were demonstrated using real time RT- PCR. Fever, pharyngeal congestion, cough and bronchial obstruction were present in 80%> of patients. Thirty percent of them had a baseline chronic disease and 47%> were immunocompromised. One out of 17 patients (6%) required mechanical ventilation. No mortality was observed. Conclusions: Use of RT-PCR allowed increasing detection of RSV infection over 100%> among adults with VRI without virological diagnosis with conventional techniques. It is necessary to consider RSV RT-PCR test among patients with clinical picture of VRI during RSV season, with negative virological screening tests.

Key words: Respiratory syncytial virus, respiratory virus, viral infection, real time RT-PCR.


 

Introducción

Las infecciones respiratorias virales (IRV) son una importante causa de morbilidad e incluso mortalidad, reconociéndose cada vez más su importancia en adultos como causa de hospitalización12.

Entre los adultos, el VRS afecta, particularmente a los mayores, pacientes portadores de patología cardíaca o respiratoria crónica e inmunocomprometidos y en especial, sometidos a trasplantes de precursores hematopoyéticos (en quienes puede tener una letalidad de hasta 80%)3,4. Su comportamiento epidémico, durante el invierno, se prolonga por más tiempo que el período de circulación del virus influenza. Entre los pacientes adultos hospitalizados por IRV, se reproduce el comportamiento epidemiológico de estos virus en la comunidad2. Clínicamente, VRS se manifiesta como una infección respiratoria alta o baja4. Desde un punto de vista virológico se clasifica en dos grupos mayores, A y B, que incluyen varios subtipos, de ellos, se ha descrito que el grupo A causa cuadro más graves4.

El diagnóstico de laboratorio, habitualmente, se realiza a través de detección de antígenos utilizando técnicas como la mmunofluorescencia directa (IFD) o indirecta (IFI), ELISA o ELISA de membrana (Test pack®) (de aquí en adelante denominadas convencionales). Existen también métodos de cultivo y aislamiento en células, con una sensibilidad que no supera el 60%o y con el inconveniente de necesitarse personal entrenado para su procesamiento y de la lentitud en la entrega de resultados. Los métodos convencionales tienen sensibilidades descritas entre 57 a 98%> (IF) y 60 a 92%o (ELISA)56. Pese a esta amplia variabilidad en la sensibilidad, se estima que alrededor de 15% de las IRV en población adulta son causadas por VRS478. La dificultad en el diagnóstico se debe, en gran medida, a la baja cuantía de partículas virales excretadas en adultos, en especial, en el grupo de adultos mayores5. Las técnicas de biología molecular, específicamente la RPC, aumenta la detección de VRS, con sensibilidad y especificidad cercanas a 98%9,10.

El objetivo primario de nuestro trabajo fue determinar la utilidad de la técnica de TR-RPC en tiempo real, para identificar la presencia de VRS en pacientes adultos hospitalizados por infección respiratoria y en quienes la pesquisa de virus respiratorios por IFD fuera negativa; y como objetivo secundario, caracterizar clínicamente las infecciones por VRS detectadas por esta técnica.

Pacientes y Método

Diseño: Estudio retrospectivo observacional.

Población estudiada: Se identificaron pacientes sobre 15 años de edad, internados en el Hospital Clínico Universidad Católica (HCUC), de la ciudad de Santiago de Chile, entre el 1 de agosto y 30 septiembre de 2005, (semanas epidemiológicas 31a 39), en quienes su médico tratante sospechó la existencia de IRV, y un estudio virológico realizado mediante IFD, negativo para VRS, FLU A y B, paraFLU 1, 2, 3 y ADV.

Recolección de muestra: La muestra utilizada fue secreción respiratoria obtenida por hisopado nasofaríngeo con tórula de dacrón y llevada al laboratorio, a 4°C, en medio de transporte para antígenos.

Inmunofluorescencia directa (IFD): La muestra de hisopado nasofaríngeo fue fijada con acetona en un portaobjetos de vidrio de ocho pocilios y procesada para la detección de siete virus respiratorios: FLU A y B, paraFLU 1, 2, 3, ADV y VRS, utilizando anticuerpos monoclonales unidos a fluorescencia, específicos para los siete virus respiratorios (Pat hoDx, DPC Los Angeles, CA). Se consideró positiva aquella muestra que mostraba el patrón de IFD color verde manzana en el citoplasma o núcleo celular, característico para cada virus. Aquellas muestras que resultaron negativas se conservaron a -70 °C para ser procesadas posteriormente por TR-RPC en tiempo real.

Reacción de polimerasa en cadena: A partir de 200 mi de muestra se obtuvo el ARN viral utilizando el kit de extracción High Pure Viral Nucleic Acid Kit (Roche) siguiendo las instrucciones del proveedor. La TR-RPC en tiempo real se realizó por LightCycler® RNA Amplification kit SYBR Green I, en dos etapas, según especificaciones del proveedor.

• TR-RPC 1 con 2 mi de ARN que se transfirieron para una mezcla con 10ml de agua libre de nucleasa, 1,6 mi de MgCl225mM, 4ml de mezcla del kit, 0,4 ml de enzima del kit y lml de cada partidor lOmM (AB-F y AB-R); detectándose una banda en gel de agarosa al 2% con bromuro de etidio de 800 pb, aproximadamente, cuando es positivo. Los partidores utilizados fueron: AB-F 5'-GTCTTACAGCCGTGA TTAGGy AB-R 5'-GGGCTTTCTTTGGTTACTTC.

• TR-RPC2 se realizó con 2 mi de ARN en una mezcla de RPC con 12,4 mi de H20, 1,6 mi MgCL2, 2 mi de mezcla del kit y 1 ml de cada partidor (A1F y A2R, B1F y B2R). Los partidores ocupados fueron: A1F 5'GATGTTACGGTGGGGAGTCT,A2R5'-GTACA CTGTAGTTAATCACA, B1F 5'-AATGCTAAGA TGGGGA GTTC Y B2R 5'-GAAATTGACTTA ATGACAGC Se traspasó la amplificación a un gel de agarosa 1% para detectar una banda de 334 pb para VRS-A y 183 pb para VRS-B11.

Recolección y análisis de datos. Se confeccionó una base de datos donde se registró el número de exámenes de panel viral solicitados en adultos hospitalizados, se identificaron los resultados positivos por IFD o TR-RPC, por semana. Además, se recopilaron los antecedentes clínicos, examen físico y laboratorio, evolución, complicaciones y condición de egreso de cada paciente con diagnóstico de infección por VRS por TR-RPC en tiempo real. Los datos fueron analizados como número total y porcentaje. Se diseñó la presentación de los resultados en tablas con los resultados más relevantes para el estudio.

Resultados

En el período estudiado se incluyeron 133 muestras de pacientes hospitalizados con sospecha de IRV, se detectaron 14 (10,5%) casos de infección por VRS y cinco (3,8%o) casos de infección por otros virus respiratorios a través de IFD. De las 114 muestras restantes con sospecha de IRV e IFD negativa para virus respiratorios, 17 (14,9%o) resultaron positivas para VRS por TR-RPC en tiempo real, todos tipo B. Esto representa un aumento de 121% en la capacidad de diagnóstico de VRS en ese momento. En la Figura 1 se muestra la distribución variable de la positividad de los exámenes (IFD y TR-RPC tiempo real), según la semana epidemiológica (Figura 1A), observándose un paralelismo entre los resultados observados en los pacientes internados con prueba positiva y la detección del virus en la comunidad en las mismas semanas de vigilancia epidemiológica para VRS en Santiago (Figura IB)12.


Características generales de la población. Características generales de la población. La Tabla 1 muestra el perfil clínico de los pacientes con infección por VRS diagnosticada por TR-RPC en tiempo real. La edad promedio fue 54 años (rango: 16-86). Aproximadamente, un tercio de los pacientes tenían alguna enfermedad crónica basal como hipertensión arterial, diabetes mellitus o cardiopatía. Sólo un paciente presentaba antecedente de enfermedad pulmonar previa (asma bronquial o EPOC). Cerca de 50% presentaba algún tipo de inmunocompromiso: SIDA, uso de corticoste-roides o inmunosupresores de larga data y quimioterapia por cáncer. El motivo de hospitalización más frecuente en estos pacientes fue el síndrome febril (47%). En aproximadamente 65%), el diagnóstico de ingreso fue una neumonía.


Semiología y parámetros de laboratorio en pacientes con infección por virus respiratorio sincicial. La Tabla 2 resume los síntomas y signos clínicos más relevantes. Los síntomas más frecuentes eran: tos, decaimiento, coriza y fiebre. La tos, en general, era húmeda (93,3%), observándose predominio de expectoración mucosa vs muco-purulenta (60 vs 33,3%). En el examen físico, no se demostró compromiso hemodi-námico, se observó polipnea leve (22 ± 5 resp/min), congestión faríngea y signología de obstrucción bronquial. Del laboratorio general destacó la elevación moderada de VHS: 53 ± 2 1 mm/h (VN < 25 mm/h) y PCR:9,6 ± 6,2 mg/dL (VN < 1 mg/dL). La radiografía de tórax resultó mayoritariamente normal, en 4/17 (23,5%) casos se observó consolidación y en 3/17 (11,8%) casos congestión pulmonar.


Complicaciones de la infección por virus respiratorio sincicial. Sólo cuatro pacientes presentaron complicaciones que requirieron traslado a una unidad de mayor complejidad. Tres pacientes, con antecedentes de patología cardiopulmonar, presentaron insuficiencia cardiaca descompensada. Un paciente inmunocom-prometido, no SIDA, presentó insuficiencia respiratoria progresiva que requirió conexión a ventilación mecánica y, posteriormente, tuvo una sobreinfección bacteriana. No se presentó mortalidad directa o indirecta atribuible a la infección por VRS.

Discusión

Nuestro estudio demuestra que la aplicación de técnicas de biología molecular, específicamente TR-RPC en tiempo real, permitió duplicar la identificación de infecciones por VRS respecto de las detectadas con IFD en adultos hospitalizados por infección respiratoria aguda, hecho ya publicado con anterioridad6.

En un trabajo previo, detectamos 12% de infecciones respiratorias por VRS en adultos hospitalizados por IRV2. Si duplicamos la cifra de infecciones detectadas por TR-RPC en tiempo real, obtenemos cerca de 25%) de adultos hospitalizados, con sospecha de IRV, en quienes se documenta un VRS. Las publicaciones en este tema, describen que el VRS está presente hasta en 20%o de las IRV en adultos, con porcentajes variables en poblaciones específicas de estudio48"10. Este sub-diagnóstico, que se obtendría por métodos convencionales, se debería a que en adultos la excreción viral es de menor cuantía que en la población pediátrica13, y que los métodos de diagnóstico convencionales tienen sensibilidades ampliamente variables6. Lo anterior no influiría en la técnica de TR-RPC en tiempo real, la cual detecta una mínima carga de excreción de VRS.

Según datos de vigilancia epidemiológica de virus respiratorios de la ciudad de Santiago12, durante el período de estudio se registraba una baja progresiva de casos de VRS, posterior a su mayor actividad ocurrida en la semana 29; este comportamiento fue similar al observado en la curva obtenida al granear las muestras positivas por semana epidemiológica, incluyendo IFD más RPC positivas; este hecho nos ratifica que, entre adultos hospitalizados, se refleja la actividad de VRS presente en la comunidad2.

Comportamiento clínico del VRS en adultos. Se confirmaron observaciones obtenidas en estudios previos de los autores: los pacientes más afectados por este agente son los adultos mayores con patologías crónicas de base. Es destacable que sólo un paciente con enfermedad pulmonar crónica basal fuera identificado en esta ocasión, a pesar que la literatura médica describe a este grupo como uno de los más afectados por el VRS (aproximadamente 25%o)14; esto podría explicarse por una baja sospecha de etiología viral en algunos de estos pacientes, por lo que no se habría solicitado el examen; además el número de pacientes incluidos fue bajo y el protocolo no abarcó todo el período de la estación de VRS. Los pacientes con algún tipo de inmunocompromiso (47%o en nuestro estudio) están también en el grupo vulnerable a presentar morbilidad y mortalidad por este agente15, con cuadros infecciosos más graves que la población adulta general (10-20%o)4; uno de los pacientes con inmuno-supresión (no-SIDA) llegó a requerir conexión a ventilación mecánica. No hubo mortalidad atribuida a la infección por VRS, en forma directa o indirecta, ratificando la experiencia previa de los autores2.

La manifestación clínica predominante en esta serie fue el síndrome febril, presente en 68%o de los pacientes, en 47%o fue el motivo de consulta e ingreso hospitalario, asociado a síntomas y signos clínicos de infección respiratoria alta (congestión nasal 71% y faríngea 83%), tos (88%o), expectoración de tipo mucoso y signos clínicos de obstrucción bronquial. Lo anterior concuerda con la descripción de la literatura científica sobre el comportamiento de la infección en adultos, con sintomatología predominantemente de tos y disnea, asociada a síntomas respiratorios altos4,8,14,17.

Los parámetros inflamatorios no mostraron elevación importante y, en la mayoría de los pacientes no hubo hallazgos radiológicos de significado patológico; en 23,5%o de los casos se observó consolidación pulmonar pero no podemos asegurar si ello correspondía al cuadro viral propiamente tal o a una sobre-infección bacteriana.

En resumen, las técnicas de biología molecular permitieron duplicar el diagnóstico de infecciones respiratorias producidas por VRS en adultos hospitalizados respecto de aquellas diagnosticadas por técnicas convencionales. El cuadro clínico de pacientes diagnosticados por TR-RPC no difiere del clásicamente descrito. Recomendamos incorporar en la práctica clínica, la TR-RPC como método diagnóstico de infección por VRS en pacientes con cuadro clínico sugeren-te de VRS y métodos convencionales negativos, durante la estación de VRS. Ello debiera lograr un diagnóstico preciso, disminuiría la sobre utilización de antimicrobianos y ayudaría a tomar las medidas necesarias de control de infecciones para evitar la transmisión nosocomial de este virus.

Referencias

1.- Rabagliati R, Benítez R, Fernández A. Gaete P, Guzmán A, García P, et al. Reconocimiento de influenza-A como etiología de síndrome febril e insuficiencia respiratoria en adultos hospitalizados durante brote en la comunidad. Rev Méd Chile 2004; 132: 317-24.        [ Links ]

2.- Rabagliati B R, Serri V M, Perret P C, Guzmán DAM, Azocar A T, Habash A L, et al. Perfil clínico-epidemiológico de las infecciones por virus respiratorios en adultos hospitalizados durante la estación de influenza 2004. Rev Chil Infectol 2006; 23: 111-7.        [ Links ]

3.- Falsey A, Hennessey P, Formica M, Cox C, Walsh E. Respiratory syncytial virus infection in elderly and high-risk adults. N Engl J Med 2005; 352: 1749-59.        [ Links ]

4.- Falsey A, Walsh E. Respiratory syncytial virus infection in adults. Clin Microbiol Rev 2000; 13: 371-84.        [ Links ]

5.- Falsey A, Formica M, Walsh E. Diagnosis of respiratory syncytial virus infection: comparison of reverse transcription-PCR to viral culture and serology in adults with respiratory illness. J Clin Microbiol 2002; 40: 817-20.        [ Links ]

6.- Hu A, Colella M, Tarn J, Rappaport R Cheng S M. Simultaneous detection, subgrouping, and quantitation of respiratory syncytial virus A and B by real-time PCR. J Clin Microbiol 2003; 41: 149-54.        [ Links ]

7.- Falsey A R McCann R M, Hall W I Tanner M A, Criddle M M, Formica M A, et al. Acute respiratory tract infection in daycare centers for older persons. J Am Geriatr Soc 1995; 43: 30-6.         [ Links ]

8.- Thompson W, Shay D, Weintraub E, Brammer L, Cox N, Anderson L, et al. Mortality associated with influenza and respiratory syncytial virus in the United States. JAMA. 2003; 289: 179-86.         [ Links ]

9.- Templeton K, Scheltinga S, Beersma M, Kroes A, Claas E. Rapid and sensitive method using multiplex real-time PCR for diagnosis of infections by influenza A and Influenza B viruses, respiratory syncytial virus, and parainfluenza viruses 1, 2, 3, and 4. J Clin Microbiol 2004; 42: 1564-9.        [ Links ]

10.- Falsey A, Formica M, Treanor J, Walsh E. Comparison of quantitative reverse transcription-PCR to viral culture for assessment of respiratory syncytial virus shedding. J Clin Microbiol 2003; 41: 4160-5.        [ Links ]

11.- Stockton J, Ellis J S, Saville M, Clewley J P, Zambón M C. Multiplex PCR for typing and subtyping influenza and respiratory syncytial viruses. J Clin Microbiol 1998; 36: 2990-5.        [ Links ]

12.- Proyecto de Vigilancia de Virus Respiratorios. Laboratorio de Infectología. Centro de Investigaciones Médicas. Pontificia Universidad Católica de Chile, http://virus.med.puc.cl/virus_respiratorios/ inicio.html        [ Links ]

13.- Falsey A, McCann R Hall W, Criddle M M. Evaluation of four methods for the diagnosis of respiratory syncytial virus infection in older adults. J Am Geriatr Soc 1996; 44: 71-3.        [ Links ]

14.- Rohde G, Wiethege A, Borg I, Kauth M, Bauer T, Gillissen A, et al. Respiratory viruses in exacerbations of chronic obstructive pulmonary disease requiring hospitalization: a case-control study. Thorax 2003; 58: 37-42.         [ Links ]

15.- Van Kraaijm M, van Elden L, van Loon A M, Hendriksen K A, Laterveer L, Dekker A W, et al. Frequent detection of respiratory viruses in adults recipients of stem cell transplants with the use of realtime polymerase chain reaction, compared with viral culture. Clin Infect Dis 2005; 40: 602-9.        [ Links ]

16.- Dowell S, Anderson L, Gary H, Erdman D D, Plouffe J F, File T M, et al. Respiratory syncytial virus is an important cause of community acquired lower respiratory infection among hospitalized adults. J Infect Dis 1996; 174: 456-62.         [ Links ]

17.- Walsh E E, Peterson D R Falsey A R. Is clinical recognition of respiratory syncytial virus infection in hospitalized elderly and high-risk adults possible? J Infect Dis 2007; 195: 1046-51.        [ Links ]

Recibido: 24 de mayo 2007, Aceptado: 3 de septiembre de 2007

Fuente de financiamiento: Laboratorio de Infectología y Virología Molecular, Pontificia Universidad Católica de Chile. Roche Diagnostica

Correspondencia a: Ricardo Rabagliati Borie rabagli@med.puc.cl

 

Creative Commons License Todo el contenido de esta revista, excepto dónde está identificado, está bajo una Licencia Creative Commons