SciELO - Scientific Electronic Library Online

 
vol.93New records of Leopardus guigna in its northern-most distribution in Chile: implications for conservationFew self-citations among Chilean ecologists índice de autoresíndice de materiabúsqueda de artículos
Home Pagelista alfabética de revistas  

Servicios Personalizados

Revista

Articulo

Indicadores

Links relacionados

  • En proceso de indezaciónCitado por Google
  • No hay articulos similaresSimilares en SciELO
  • En proceso de indezaciónSimilares en Google

Compartir


Revista chilena de historia natural

versión impresa ISSN 0716-078X

Rev. chil. hist. nat. vol.93  Santiago  2020  Epub 23-Abr-2021

http://dx.doi.org/10.1186/s40693-020-00096-7 

Short Report

Assessment of intestinal parasites in the coexisting Bombus terrestris (Apidae) and Xylocopa augusti (Apidae) in central Chile

Kiara Fernández1 

Jennifer Alcaíno1 

Dionisia Sepúlveda2 

Rodrigo Medel1  * 
http://orcid.org/0000-0001-9955-764X

1Departamento de Ciencias Ecológicas, Facultad de Ciencias, Universidad de Chile, Las Palmeras 3425, Santiago, Chile.

2Centro de Biotecnología, Facultad de Ciencias, Universidad de Chile, Las Palmeras 3425, Santiago, Chile.

Abstract

Bombus terrestris is a European bumblebee extensively commercialized worldwide for crop pollination. In Chile, this species was introduced in 1997 and after confinement escape, it has spread and established in several localities of central-southern Chile and in the Argentine Patagonia. The South American carpenter bee Xylocopa augusti, in turn, has been recently reported in central Chile, and as B. terrestris, this species has become increasingly common, often found in sympatry with B. terrestris in some localities. While intestinal parasites such as the flagellate trypanosome Crithidia bombi, the microsporidium Nosema bombi, and the neogregarine protozoan Apicystis bombi, show high levels of specialization on the Bombus genus, parasites often increase their host range, especially after invading novel habitats, hence creating new infection disease scenarios. In this work, we used molecular techniques to detect the presence of the intestinal pathogens of B. terrestris in coexisting X. augusti from different localities in the Metropolitan Region of Chile. Our results revealed the presence of the three pathogens in B. terrestris only, with population prevalence broadly similar to that reported in other studies. The carpenter bee X. augusti did not show evidence of any of the three parasites examined, indicating that this invader species is not recipient of any of the parasite species present in B. terrestris.

Keywords: Apicystis bombi; Crithidia bombi; Nosema bombi; Pathogen spillover

Introduction

Pathogen spillover, broadly defined as the transfer of one or more pathogens from one reservoir host to a recipient host is one of the major factors influencing disease spread in natural populations. Spillover often occurs when infected host species invade novel habitats and transmit exotic parasites to native hosts, which often experience substantial reduction in reproduction and survival [1,2]. Pathogen spillover occurs commonly in bee colonies transported from one region to another for commercial purposes because commercially-reared colonies often harbor parasites harmful to wild bees, resulting in disease epidemics, and native bee declines in wild populations [35]. In this regard, Bombus terrestris Linnaeus (Apidae) (Fig. 1a), one of the most extensively used bumblebee species for crop pollination worldwide has been suggested to transmit their parasites to recipient native bees in southern South America [6, 7]. One of the parasites commonly harbored by B. terrestris is Crithidia bombi Lipa & Triggiani, a flagellated trypanosome species that infects exclusively species of the Bombus genus. This protozoan is horizontally transmitted by ingestion of infectious cells present in the feces deposited on flowers by infected workers of other colonies or bumblebee species, by contaminated honey stores and nest material, and through vertical transmission from one generation to another within the same colony [8, 9]. Like C. bombi, the microsporidium Nosema bombi Fantham & Porter, infects exclusively species of the Bombus genus. The spores (infective stages) locate mostly in the digestive tract of the bumble bees, and after proliferation within the host, are released into the environment [10, 11]. As in C. bombi, this parasite transmits vertically across generations in bumble bees [12]. Finally, Apicystis bombi Liu, Macfarlane & Pengelly, is a neogregarine protozoan that in addition to Bombus species, infects Apis mellifera, and Osmia bicornis Linnaeus (Megachilidae). It locates in the host adipose tissue, reducing the colony establishment success [12]. Its transmission is horizontal through shared flower resources, but vertical transmission has also been suggested [13].

Fig. 1 Photographs of the bee species here examined for intestinal parasites. a Bombus terrestris, b Xylocopa augusti (female), c Xylocopa augusti (male) (photograph credit https://www.mnhn.gob.cl/613

In Chile, B. terrestris was imported for tomato pollination in 1997/1998. After greenhouse confinement escape, it has spread and become established in several localities of southern Chile and Argentina (see reviews in [6, 14]). In 2009, the presence of C. bombi and A. bombi was reported for the first time in South America [15]. Since then, further reports have confirmed that invasion of B. terrestris to novel habitats in southern Chile and Argentina carried exotic intestinal parasites [6, 16], hence increasing the chance of pathogen spillover to other bee species. For example, after B. terrestris invasion, C. bombi was detected in the native bumblebee Bombus dahlbomii Guérin-Méneville in Chile [6], and A. bombi was recorded in the honeybee Apis mellifera in Argentina [17, 18], which strongly suggests parasite spill-over from B. terrestris to other bee species in southern south America [2].

A recently reported invasive bee species in Chile is the South American carpenter bee Xylocopa augusti Lepeletier (Fig. 1b and c). Originally distributed in Argentina, Brazil, Uruguay, and Paraguay, this species was recorded for the first time in central Chile in 2013, probably transported through undetected nests in packaging structures from Argentina [19]. After its arrival, new ecological scenarios of coexistence between otherwise allopatric X. augusti and B. terrestris are frequently found in central Chile, providing new opportunities for parasite transmission. It is known that parasite transmission is an expected result when founding populations in novel habitats are genetically depauperate [20, 21]. In principle, judging by the pathogens found in B. terrestris and other Xylocopa species, X. augusti has the potential to become infected by some viruses such as DWV (Deformed wing virus), BQCV (Black queen cell virus), and SBPV (Slow bee paralysis virus), all of them detected in B. terrestris also [22, 23]. However, as most studies inquiring on the potential transmission of parasites from B. terrestris to other bee species in southern South America have focused almost exclusively on intestinal parasites, and molecular diagnosis techniques for viral testing require a methodology different to that used in this study [24, 25], we restricted the analysis to the molecular detection of the protozoans C. bombi and A. bombi, and the microsporidium N. bombi in B. terrestris and X. augusti.

Methods

Overall, 59 specimens of the two species combined were collected from the total 26 campaigns performed to different localities in the Metropolitan Region, Santiago, during October–December 2018 (Fig. 2, Table 1). Individuals were collected in three sites where both species were observed foraging in the same plants and in sites where only one of the species was found, one site per species. Even though campaigns were conceived to check the presence or absence of the focal species, B. terrestris and X. augusti, no native bee species was observed. The only additional bee present in some sites was the honeybee A. mellifera. Specimens of the focal bees were captured using entomological nets, euthanized in killing jars, and stored in 95% alcohol at − 20 °C until processing. At the laboratory, separate dissecting tools were used to avoid cross-contamination between samples, and utensils and working place were submitted to 30 min UV-light before sample processing. Each insect was cleaned with bi-distilled water and then subjected to abdominal extrusion to obtain the intestine and intestinal content. To evaluate the status of infection of the collected samples, and the parasite species involved, whole DNA was extracted from the insect guts dissected, using the EZNA Tissue DNA Kit (Omega Bio-tek) following the manufacturer's instructions. The presence of the specific parasites was evaluated by PCR amplification of the small ribosome subunit of each parasite. Primers used in this work are listed in Table 2. They were designed from the following sequences: Apicystis bombi (accession no. FN546182), Crithidia bombi (accession no. GU321194) and Nosema bombi (accession no. AY741110). Specific primers for B. terrestris and X. augusti to be used as positive PCR controls, were designed from the partial mitochondrial genome from B. terrestris (accession no. KT164618) and from the partial COI gene from Xylocopa violacea Linnaeus (accession no. EU122101), respectively. The COI gene from X. violacea was used for primer design as no X. augusti DNA sequences were found at the NCBI database when this study was performed. PCR reactions were performed using a Thermal Cycler 2720 (Applied Biosystems) in a final volume of 25 μl containing 1x PCR buffer (20 mM Tris-HCl, 10 mM KCl), 2 mM MgCl2, 200 μM of each dNTP, 1 μM of each primer, 2 U Taq DNA polymerase, and 100 –130 ng of template DNA. The PCR parameters were: initial denaturation at 94 °C for 3 min, 35 cycles of denaturation at 95 °C for 30 s, annealing at 53 °C for 30 s and extension at 72 °C for 3 min. Then, a final extension step at 72 °C for 10 min was applied and samples were kept at 4 °C until evaluated by 2.0% agarose gel electrophoresis in TAE buffer stained with SafeView™ Plus (Applied Biological Materials). To confirm the obtained results, some amplicons were sequenced at the service provided by the Sequencing Unit, Pontificia Universidad Católica de Chile (Santiago, Chile) using ABI PRISM 3500 xl (Applied Biosystems). The obtained sequences were analyzed and compared with the GenBank database using the BLAST algorithm (http://www.ncbi.nlm.nih.gov/BLAST).

Fig. 2 Map showing the study sites in the Metropolitan Region where specimens were collected. In total, 13 campaigns were carried out. Parentheses indicate the number of visits to the same site: Ñuñoa (3), Puente Alto (2), La Florida (3), Talagante (3), and La Reina (2). Circles: sites where B. terrestris and X. augusti were collected; triangle: sites where only B. terrestris was collected; square: sites where only X. augusti was collected 

Table 1 Number of individuals screened and infected with each parasite per site and bee species. The number of PCR products sequenced is indicated in parenthesis 

Locality Coordinates Sample size (B. terrestris/X. augusti) Apicystis bombi Crithidia bombi Nosema bombi
Ñuñoa 33° 27′ 56″ S 10/11 3/0 1/0 0/0
70° 35′ 44″ W
La Reina 33° 27′ 22″ S 5/0 4/0 2/0 0/0
70° 30′ 60″ W
La Florida 33° 32′ 16″ S 3/9 0/0 1/0 1/0
70° 33′42″ W
Talagante 33° 41′ 60″ S 8/7 0/0 2/0 1/0
70° 50′ 50″ W
Puente Alto 33° 36′ 24″ S 0/6 0/0 0/0 0/0
70° 32′ 16″ W
Total 26/33 7/0 (4) 6/0 (5) 2/0 (2)

Table 2 List of primers used in PCR. See Methods section for details 

Name Sequence (5′ → 3′) Target Expected amplicon size (BP) Reference
AbSSU-F GCGGTAATTCCAGCTCCAATA 18 rDNA gene, A. bombi 323 This work
NeoR GACAGCTTCCAATCTCTAGTCG [23]
CbSSU-F TTAGGGTTCGATTCCGGAGAG 18 rDNA gene, C. bombi 477 This work
CbSSU-R CATGCGTGGATCAGGAAAGGA This work
NbSSU-F TGAGGTGATTAATTGGAGGGC 18 rDNA gene, N. bombi 404 This work
NbSSU-R CTCCTTGTGGTATTCTTCCGT This work
BT-F AGGATTAGACGTTGATACACGAGC Mitochondrial genome, B. terrestris 447 This work
BT-R GGATAATCTGAGTATCGTCGAG This work
XA-F TCCAATAGGAGGAGGAGATC COI gene, X. augusti 657 This work
XA-R CGTCGAGGTATTCCTATCAATCC This work

Results and discussion

Among the total 26 bumblebees screened, seven tested positive for the neogregarine A. bombi (26.9%), six for the trypanosome C. bombi (23.07%), and two for the microsporidium N. bombi (7.69%) (Table 1). Among the seven specimens infected with A. bombi, two of them were also infected with C. bombi and both specimens infected with N. bombi, were also infected with C. bombi. To confirm these results, four A. bombi (accession numbers MT856196, MT856197, MT856198 and MT856199), five C. bombi (accession no. MT856200, MT856201, MT856202, MT856203 and MT856204) and the two N. bombi (accession no. MT856205 and MT856206) PCR products were sequenced. In all cases, the BLAST search revealed over 99% of identity with the corresponding DNA sequences from A. bombi, C. bombi and N. bombi deposited at the NCBI-database, being 100% of identity in most cases (Table 3), confirming that the primers used in this work were successful to identify the parasites under study.

Table 3 BLASTn search results of parasite PCR products. The best alignment between the query sequence and the found sequence is shown in each case 

Sample (GenBank accession N°) BLAST Result – Coverage; %Identity BLAST Result - GenBank accession N° BLAST Result - Description
MT856196 478/478;100% FN546182 Apicystis bombi SSU rRNA gene, partial sequence
MT856197 468/469;99,79% FN546182 Apicystis bombi SSU rRNA gene, partial sequence
MT856198 461/461;100% FN546182 Apicystis bombi SSU rRNA gene, partial sequence
MT856199 468/468;100% FN546182 Apicystis bombi SSU rRNA gene, partial sequence
MT856200 303/306;99% MH010977 Crithidia bombi SSU rRNA gene, partial sequence
MT856201 377/377;100% GU321194 Crithidia bombi SSU rRNA gene, partial sequence
MT856202 376/377;99,73% GU321194 Crithidia bombi SSU rRNA gene, partial sequence
MT856203 388/388;100% GU321194 Crithidia bombi SSU rRNA gene, partial sequence
MT856204 366/366;100% MH010977 Crithidia bombi SSU rRNA gene, partial sequence
MT856205 321/321;100% KF188740 Nosema bombi SSU rRNA gene, partial sequence
MT856206 385/385;100% KF188740 Nosema bombi SSU rRNA gene, partial sequence

Unlike B. terrestris, no parasite was detected in the 33 specimens of X. augusti here examined, suggesting that regardless of the status of coexistence with B. terrestris, parasites are not present in X. augusti (Table 1). To confirm this result, primers were designed in order to differentiate between B. terrestris and X. augusti DNA (primer pairs BT-F/BT-R and XA-F/XA-R, respectively) (Table 2). PCR products of the expected size were obtained from the 26 B. terrestris samples and none from the 33 X. augusti samples when using primer pair BT-F/BT-R. Accordingly, PCR products of the expected size were only obtained from the 33 X. augusti samples and none from the 26 B. terrestris samples when using primer pair XA-F/XA-R. A PCR product from each case was randomly selected and sequenced. The BLAST analysis of the PCR product from a B. terrestris sample (accession no. MT862773) revealed 100% of identity with the partial mitochondrial genome from B. terrestris and the analysis of the PCR product from a X. augusti sample (accession no. MT862774) revealed 90.7% of identity with the partial COI gene sequence from X. violacea. These results indicate that the quality of DNA samples from X. augusti specimens was adequate to perform PCR analysis, which supports the absence of the three parasites in these samples.

The prevalence of A. bombi in B. terrestris specimens collected in this work was 26.9%, which is less than the prevalence obtained in a comparable study carried out in Argentina where 14 out of 30 individuals were infected (47%) [16]. Regarding the detection of C. bombi, all the sites where B. terrestris was present had individuals infected with the protozoan, reaching an overall prevalence of 23.1%, which is in the range of values previously reported for populations sampled near Santiago ([6], 0–41.7%). This result is consistent with the observation that C. bombi is very widespread and abundant wherever B. terrestris is found [6]. Regarding N. bombi, the results obtained in this work indicate a low prevalence of this microsporidium (7.7%), probably because this parasite is more infectious in larvae than in adult bumblebees [26]. Interestingly, Schmid-Hempel et al. [6] did not record the presence of this parasite in B. terrestris populations near Santiago. Likewise, the prevalence of N. bombi in the 12 Chilean populations sampled in 2010 ranged from 0 to 3.7%, with an average prevalence of 1.7% [6], indicating that even if small, our recordings are the highest prevalence recorded for B. terrestris in Chile.

Results from this study indicate that the exotic bee, X. augusti, is not infected by any of the three parasites infecting B. terrestris, suggesting that transmission of pathogens typical of the Bombus genus does not proceed from B. terrestris to sympatric X. augusti. This result is not necessarily unexpected as the pathogens here examined are often considered specific to the Bombus genus. However, as intestinal parasites represent only a fraction of the potential pathogens transmitted (i.e., viruses should also be considered), we cannot rule out completely the idea of parasite transmission from one species to another, especially considering that susceptibility to new parasites is high in novel hosts [27], and new parasites often experience drastic changes in life history traits that permit them to infect novel hosts [28]. While the co-invasion of B. terrestris and X. augusti to Chile has created a new zone of geographical sympatry for the two otherwise allopatric species, the consequence of their coexistence for disease spread is unknown. Although our data suggests absence of intestinal parasite transmission between hosts, works that consider a broader spectrum of intestinal and viral parasites are needed. This information is crucial to understand the extent to which new contexts of host sympatry in species outside their original habitats influence and amplify parasite transmission in novel environments.

Funding

This work was funded by grant FONDECYT 1180850 to RM.

Availability of data and materials

All data generated or analyzed during this study are included in this published article. Sequence data that support the findings of this study have been deposited in GenBank with the accession codes MT856196, MT856197, MT856198, MT856199, MT856200, MT856201, MT856202, MT856203, MT856204, MT856205, MT856206, MT862773, MT862774.

Ethics approval and consent to participate

Not applicable.

Consent for publication

Not applicable.

Publisher's Note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Acknowledgements

We thank Dra. Marina Arbetman for kindly providing samples of B. terrestris infected with C. bombi, and A. bombi DNA samples. Dra. C. Botto-Mahan provided useful comments on a preliminary version of this manuscript.

References

1. Power AG, Mitchell CE. Pathogen spillover in disease epidemics. Am Nat. 2004;164:S79–89. [ Links ]

2. IPBES. The assessment report of the Intergovernmental Science-Policy Platform on Biodiversity and Ecosystem Services on pollinators, pollination and food production. In: Potts SG, Imperatriz-Fonseca VL, Ngo HT, editors. Bonn: Secretariat of the Intergovernmental Science-Policy Platform on Biodiversity and Ecosystem Services; 2016. [ Links ]

3. Otterstatter MC, Thomson JD. Does pathogen spillover from commercially reared bumble bees threaten wild pollinators. PLoS One. 2008;3:e2771. [ Links ]

4. Colla SR, Otterstatter MC, Gegear RJ, Thomson JD. Plight of the bumble bee: pathogen spillover from commercial to wild populations. Biol Conserv. 2006;129:461–7. [ Links ]

5. Goka K, Okabe K, Yoneda M. Worldwide migration of parasitic mites as a result of bumblebee commercialization. Popul Ecol. 2006;48:285–91. [ Links ]

6. Schmid-Hempel R, Eckhardt M, Goulson D, Heinzmann D, Lange C, Plischuk S, et al. The invasion of southern South America by imported bumblebees and associated parasites. J Anim Ecol. 2014;83:823–37. [ Links ]

7. Aizen MA, Smith-Ramírez C, Morales CL, Vieli L, Sáez A, Barahona-Segovia RM, et al. Coordinated species importation policies are needed to reduce serious invasions globally: the case of alien bumblebees in South America. J Appl Ecol. 2018;56:100–6. [ Links ]

8. Durrer S, Schmid-Hempel P. Shared use of flowers leads to horizontal pathogen transmission. Proc R Soc Lond B. 1994;258:299–302. [ Links ]

9. Imhoof B, Schmid-Hempel P. Colony success of the bumble bee, Bombus terrestris, in relation to infections by two protozoan parasites, Crithidia bombi and Nosema bombi. Insect Soc. 1999;46:233–8. [ Links ]

10. McIvor CA, Malone LA. Nosema bombi, a microsporidian pathogen of the bumble bee Bombus terrestris (L.). NZ J Zool. 1995;22:25–31. [ Links ]

11. Otti O, Schmid-Hempel P. Nosema bombi: a pollinator parasite with detrimental fitness effects. J Invertebr Pathol. 2007;96:118–24. [ Links ]

12. Rutrecht ST, Brown MJF. The life-history impact and implications of multiple parasites for bumble bee queens. Int J Parasitol. 2008;38:799–808. [ Links ]

13. Graystock P, Goulson D, Hughes WOH. Parasites in bloom: flowers aid dispersal and transmission of pollinator parasites within and between bee species. Proc R Soc B. 2015;282:20151371. [ Links ]

14. Morales CL, Arbetman MP, Cameron SA, Aizen MA. Rapid ecological replacement of a native bumble bee by invasive species. Front Ecol Environ. 2013;11:529–34. [ Links ]

15. Plischuk S, Lange CE. Invasive Bombus terrestris (Hymenoptera: Apidae) parasitized by a flagellate (Euglenozoa: Kinetoplastea) and a neogregarine (Apicomplexa: Neogregarinorida). J Invertebr Pathol. 2009;102:263–5. [ Links ]

16. Arbetman MP, Meeus I, Morales CL, Aizen MA, Smagghe G. Alien parasite hitchhikes to Patagonia on invasive bumblebee. Biol Invasions. 2013;15:489–94. [ Links ]

17. Lipa JJ, Triggiani O. Apicystis gen nov and Apicystis bombi (Liu, Macfarlane & Pengelly) comb nov (Protozoa: Neogregarinida), a cosmopolitan parasite of Bombus and Apis (Hymenoptera: Apidae). Apidologie. 1996;27:29–34. [ Links ]

18. Plischuk S, Meeus I, Smagghe G, Lange CE. Apicystis bombi (Apicomplexa: Neogregarinorida) parasitizing Apis mellifera and Bombus terrestris (Hymenoptera: Apidae) in Argentina. Environ Microbiol Rep. 2011;3:565–8. [ Links ]

19. Montalva JM, Allendes JL, Lucia M. The large carpenter bee Xylocopa augusti (Hymenoptera: Apidae): new record for Chile. J Melittol. 2013;12:1–6. [ Links ]

20. Whitehorn PR, Tinsley MC, Brown MJF, Darvill B, Goulson D. Genetic diversity, parasite prevalence and immunity in wild bumblebees. Proc R Soc Lond B. 2011;278:1195–202. [ Links ]

21. Jones CM, Brown MJF. Parasites and genetic diversity in an invasive bumblebee. J Anim Ecol. 2014;83:1428–40. [ Links ]

22. Lucia M, Reynaldi FJ, Sguazza GH, Abrahamovich AH. First detection of deformed wing virus in Xylocopa augusti larvae (Hymenoptera: Apidae) in Argentina. J Apic Res. 2014;53:466–8. [ Links ]

23. Tehel A, Brown MJ, Paxton RJ. Impact of managed honey bee viruses on wild bees. Curr Opin Virol. 2016;19:16–22. [ Links ]

24. Meeus I, De Graaf DC, Jans K, Smagghe G. Multiplex PCR detection of slowly-evolving trypanosomatids and neogregarines in bumblebees using broad-range primers. J Appl Microbiol. 2010;109:107–15. [ Links ]

25. De Miranda JR, Bailey L, Ball BV, Blanchard P, Budge GE, Chejanovsky N, et al. Standard methods for virus research in Apis mellifera. J Apic Res. 2013; 52:1–56. [ Links ]

26. Rutrecht ST, Klee J, Brown MJ. Horizontal transmission success of Nosema bombi to its adult bumble bee hosts: effects of dosage, spore source and host age. Parasitology. 2007;134:1719–26. [ Links ]

27. Tepolt CK, Darling JA, Blakeslee AMH, Fowler AE, Torchin ME, Miller AW, et al. Recent introductions reveal differential susceptibility to parasitism across an evolutionary mosaic. Evol Appl. 2020;13:545–58. [ Links ]

28. Kelehear C, Brown GP, Shine R. Rapid evolution of parasite life history traits on an expanding range-edge. Ecol Lett. 2012;15:329–37. [ Links ]

Received: August 19, 2020; Accepted: October 11, 2020; pub: October 21, 2020

*Correspondence: rmedel@uchile.cl

Authors’ contributions

KF collected the samples, carried out the experiments and interpreted the results. DS contributed with the molecular analysis. JA and RM contributed to the study design and analysis of the results. RM conceived the study and participated in the experimental design and coordination. KF, JA and RM drafted the manuscript. All authors read and approved the final manuscript.

Competing interests

The authors declare that they have no competing interests.

Creative Commons License This is an Open Access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.