SciELO - Scientific Electronic Library Online

 
vol.61 número3EFECTO DEL METODO Y EDAD DE LAS PLÁNTULAS SOBRE EL PRENDIMIENTO Y DESARROLLO DE INJERTOS EN MELON (Cucumis melo) índice de autoresíndice de materiabúsqueda de artículos
Home Pagelista alfabética de revistas  

Servicios Personalizados

Revista

Articulo

Indicadores

Links relacionados

Compartir


Agricultura Técnica

versión impresa ISSN 0365-2807

Agric. Téc. v.61 n.3 Chillán jul. 2001

http://dx.doi.org/10.4067/S0365-28072001000300001 

PATRONES GENÉTICOS DE LOS CULTIVARES DE VIDES DE VINIFICACIÓN
MÁS COMÚNMENTE USADOS EN CHILE BASADOS EN
MARCADORES DE MICROSATÉLITES1

Fingerprinting of wine grape cultivars most commonly grown in Chile based on microsatellite markers

Claudio Narváez H. 2, M. Herminia Castro P. 2, Jorge Valenzuela B. 2 y Patricio Hinrichsen R.2

1Recepción de originales: 18 de febrero de 2000
Investigación financiada parcialmente por FONDECYT, Proyecto N° 19710186
2 Instituto de Investigaciones Agropecuarias, Centro Regional de Investigación La Platina, Casilla 439 Correo 3, Santiago, Chile. E-mail: phinrich@platina.inia.cl

ABSTRACT

The Chilean wine industry has experienced a substantial modification during recent decades, favoring the planting of the so-called fine cultivars over the traditional ones, such as the cultivar País. On the other hand, the globalization of world markets has underlined the necessity of the certification of the genetic identity and purity of these cultivars, which until recently was only carried out by ampelographic methods. The direct analysis of DNA, including genomic repetitive sequences such as mini- and microsatellites, has permitted the development of new, powerful analytical methods, used as molecular markers for different purposes. In this paper, the genetic differentiation of some of the most commonly grown wine grape cultivars in Chile is presented. For this purpose, a set of 12 microsatellite markers were used to characterize 20 cultivars of red and white wine, producing a unique pattern of alleles or fingerprinting for each one. The expected heterozygosity (He) for each marker was quite high and diverse, ranging from 0.27 to 0.87 (average 0.70), as diverse as the number of alleles identified with each marker, from 4 for VVMD-25, VVMD-34 and VVS-29 to 10 for VVMD-28. The number of genotypes identified with each marker was from moderate, 4 in VVMD-34, to as high as 15 with VVMD-28. The combination of a small fraction of these markers (for example, VVMD-5 plus VVMD-28) allowed a complete identification of the cultivars. Considering the foregoing, a combination of SSR markers is proposed to be used in genetic certification of wine grapes.

Key words: wine grape cultivars, DNA, SSR, microsatellite, fingerprinting, Vitis vinifera L., Vitis labrusca.

RESUMEN

La industria chilena del vino se ha modificado substancialmente en las últimas décadas, predominando la plantación de los denominados "cultivares finos" sobre los tradicionales, como la cepa País. Por otra parte, la globalización de los mercados ha resaltado la necesidad de certificar la identidad genética y pureza de los cultivares, que hasta hace poco tiempo se realizó exclusivamente mediante ampelografía. El análisis directo del ADN ha permitido el desarrollo de nuevas y poderosas herramientas analíticas, como las secuencias de mini- y microsatélites, actualmente usadas como marcadores moleculares para diferentes fines. En este trabajo se presenta la caracterización genética de los cultivares de vides de vinificación más comúnmente usados en Chile. Para este propósito, se ha usado un conjunto de 12 marcadores de microsatélites para caracterizar 20 cultivares de vino tinto y blanco, generando patrones alélicos únicos para cada uno de ellos. La heterocigocidad esperada (He) para cada marcador fue bastante alta y diversa, entre 0,27 y 0,87 (promedio 0,70), y fue tan diversa como el número de alelos detectados con cada marcador, desde sólo cuatro para VVMD-25, VVMD-34 y VVS-29, hasta 10 para VVMD-28. El número de genotipos identificado con cada marcador fue moderado en algunos casos, cuatro en VVMD-34, y hasta 15 con VVMD-28. La combinación de un pequeño número de estos marcadores (por ejemplo, VVMD-5 más VVMD-28) fue suficiente para obtener una completa diferenciación de los cultivares. Considerando estos antecedentes, se propone una combinación de marcadores para ser usada en certificación genética de cepas viníferas.

Palabras claves: variedades de uva vinífera, ADN, polimorfismo, Vitis vinifera, Vitis labrusca.

INTRODUCCIÓN

Chile es reconocido en distintas partes del mundo por su producción vinífera (Del Pozo, 1998). La producción y exportación de vinos, tanto por cuenta de las grandes viñas tradicionales como por las denominadas "viñas boutique", ha tenido un aumento sostenido en los últimos años, principalmente en lo que respecta a cultivares finos. Chile tiene un alto porcentaje de plantación de cepas finas en comparación con otros países importantes en este rubro (Costa Barros, 1998). Esta condición motiva un mayor cuidado en la calidad del producto final, siendo aspectos significativos en este sentido la certificación de origen de los vinos y su identidad genética.

La producción de vinos finos está basada principalmente en antiguos cultivares provenientes de Francia, los cuales se comenzaron a traer a Chile en la década de 1850 (Del Pozo, 1998), continuándose este proceso hasta hoy. El origen de muchos de estos materiales es confuso o simplemente desconocido (Del Pozo, 1998), siendo escasos los cuarteles o viñas cuyas plantas han sido multiplicadas bajo un control genético estricto. Por otra parte, el origen genético de la mayoría de los cultivares viníferos es desconocido, aunque recientemente se han identificado posibles parentescos entre las cepas de distintas regiones de Francia (Bowers y Meredith, 1997; Sefc et al., 1997; Bowers et al., 1999a).

La diferenciación e identificación de estos cultivares ha representado un problema de difícil solución para las técnicas ampelográficas, basadas en el estudio de caracteres morfológicos, botánicos y agronómicos (forma, tamaño y color de planta, hojas y racimo, época de maduración, resistencia a enfermedades, etc.) (Galet, 1979). Además, estas características pueden ser moduladas por determinantes ambientales, tales como el efecto de determinados patógenos, la etapa del crecimiento o el ambiente agroclimático en que se encuentre la planta. Esta caracterización morfológica depende del criterio y experiencia individual de cada ampelógrafo. Esto ha llevado a que en numerosas ocasiones existan genotipos mal indexados, especialmente cuando se trata de cultivares que presentan fenotipos muy similares. Por otra parte, la identidad genética de un cultivar puede modificarse debido a mutaciones somaclonales producidas durante su reproducción vegetativa (Vignani et al., 1996), y aunque conserven el nombre original, pueden presentar diferencias tanto fenotípicas como genotípicas (sinonimia). La sinonimia también se aplica a cultivares que, aunque genéticamente diferentes, se han manejado como si fueran un único tipo. Alternativamente, la dispersión geográfica de un mismo genotipo o cultivar suele conllevar su redenominación, por lo que un mismo genotipo presenta diversos nombres (homonimia) (Vignani et al., 1996; Cervera et al., 1998).

El uso de herramientas analíticas basadas en el análisis directo del genoma (ADN) supera varios de estos inconvenientes, debido a que el análisis se hace independiente de factores ambientales (Morell et al., 1995). De esta manera, se obtienen "marcadores moleculares" que definen un "perfil molecular" o "fingerprinting" propio para cada cultivar.

Existen diversos marcadores moleculares aplicables para estudios moleculares en plantas, y específicamente para el desarrollo de estos perfiles moleculares (Ferreira y Grattapaglia, 1996). En vides, ha sido posible identificar variedades mediante análisis de fragmentos de restricción (RFLP) (Bowers et al., 1993), amplificación de fragmentos de ADN usando partidores de diseño aleatorio (RAPD) (Collins y Symons, 1993; Gogorcena et al., 1993; Jean-Jaques et al., 1993; Qu et al., 1996; Stavrakakis et al., 1997; This et al., 1997), amplificación de fragmentos de largo polimórfico (AFLP) (Sensi et al., 1996; Cervera et al., 1998) y secuencias simples repetidas (SSR) (Thomas y Scott, 1993, Cipriani et al., 1994; Bowers et al., 1996; Vignani et al., 1996), entre otros.

Un método óptimo de análisis de ADN es aquel que presenta un alto índice de polimorfismo, exhibe una herencia codominante, se distribuye a lo largo de todo el genoma uniformemente, y permite una fácil interpretación de los datos generados. En buena medida, estos requisitos son cumplidos por las secuencias de microsatélites o SSR (Rafalsky y Tingey, 1993), estudiadas mediante PCR (STMS, por Sequence Tagged Microsatellites; Thomas y Scott, 1993; Thomas et al., 1994). Los SSR son series de entre dos y cinco nucleótidos que se repiten 10 o más veces (por ejemplo (GA)18, (CAC)10, etc.), series que a su vez se repiten muchas veces en el genoma entero (Jeffreys et al., 1985; Tautz, 1989). Su tipo y abundancia varía entre distintas especies de plantas y animales (Lagercrantz et al., 1993), y son considerados excelentes marcadores moleculares para distintos propósitos, como estudios de caracteres cuantitativos (Hearne et al., 1992) u otros estudios genéticos en plantas (Morgante y Olivieri, 1993), siendo propuestos como un enfoque general para mapeo genético en eucariontes (Tautz, 1989; Beckmann y Soller, 1990). El principal inconveniente de esta metodología es la identificación de los partidores, diseñados a partir de secuencias conservadas adyacentes al SSR.

Actualmente se cuenta a lo menos con 20 pares de partidores de SSR de vides (Thomas et al., 1994; Bowers et al., 1996, 1999b), los cuales han sido aplicados principalmente para realizar fingerprinting de cultivares de uva de mesa, de vino y portainjertos de distintas especies de Vitis. Los primeros trabajos correspondieron al grupo de Thomas y Scott (Thomas et al., 1993; Thomas y Scott, 1993). Allí se identificaron al menos cuatro grupos de partidores, algunos de los cuales resultaron tener una alta capacidad discriminativa entre cultivares. Posteriormente, este mismo grupo (Botta et al., 1995) y otros (Cipriani et al., 1994; Bowers et al., 1996) han optimizado metodologías libres de isótopos radiactivos y han desarrollado bases de datos que permitirían comparar sus resultados con los de otros laboratorios, a nivel internacional (Thomas et al., 1994). Más recientemente, un consorcio internacional de 20 laboratorios ha desarrollo sobre 300 marcadores de SSR adicionales, los que podrán ser aplicados tanto en la caracterización genética de la especie como para perfeccionar protocolos de fingerprinting.

La aplicación más importante de los SSR en vides ha estado centrada en la identificación de genotipos (Thomas et al., 1994; Grando y Frisinghelli, 1998; Lin y Walker, 1998; Sefc et al., 1998; Meredith et al., 1999). Además, usando una aproximación estadística basada en índices de exclusión, se han podido determinar los progenitores de varios cultivares de origen ancestral desconocido. Por ejemplo, Bowers y Meredith (1997) identificaron a Cabernet Franc y Sauvignon blanc como los progenitores de Cabernet Sauvignon, el cultivar más plantado en el mundo. Usando la misma aproximación, Sefc et al. (1997) identificaron los posibles progenitores para cuatro variedades cultivadas en Alemania y, más recientemente, Bowers et al. (1999a) identificaron los progenitores de más de 15 cultivares tradicionales de Francia, entre ellos los de Chardonnay.

En este trabajo se presenta la caracterización genética de 20 cultivares de vides viníferas basada en la determinación de los patrones alélicos de 12 loci de microsatélites. La información colectada constituye un catálogo cuyo principal uso está referido a la posibilidad de respaldar un sistema de certificación genética que asegure un mínimo de posibilidad de error al comparar cualquiera de los genotipos considerados en el estudio.

MATERIALES Y MÉTODOS

Variedades analizadas y extracción del ADN.

Se analizaron 20 cultivares de vides de vinificación (Vitis vinifera L.) manejados como una colección de genotipos (jardín de variedades) mantenidos en el Centro Regional de Investigación (CRI) La Platina del Instituto de Investigaciones Agropecuarias (INIA), ubicado cerca de la ciudad de Santiago. El listado de estos genotipos, correspondientes a cultivares de vino blanco y tinto, se encuentra en el Cuadro 1. Se colectaron hojas en desarrollo (de unos 5 cm de diámetro) que se almacenaron a -80°C hasta que se extrajo su ADN, siguiendo el protocolo descrito por Narváez et al. (2000).

Cuadro 1. Alelos identificados en 20 cultivares de vid usando 12 marcadores de SSR. Los valores indicados corresponden al tamaño de cada amplicón en pares de bases.
Table 1. Alleles identified for the twenty grapevine cultivars using 12 SSR markers. Numbers refer to amplicon sizes (in bp).

 

Marcador

Variedad

VVMD-5

VVMD6

VVMD7

VVMD24

VVMD25

VVMD27

Aurora

236

-

212

-

249

247

218

210

253

-

185

179

Cabernet Franc

240

226

211

205

263

239

210

-

259

243

189

181

C. Sauvignon

240

232

212

211

239

239

219

210

253

243

189

175

Carmenère

238

226

212

211

263

239

214

210

259

243

189

175

Chardonnay

238

234

214

205

243

239

218

210

259

243

189

181

Gewürztraminer

238

232

211

205

257

243

218

214

253

-

189

-

Merlot

236

226

212

205

247

239

214

210

253

243

191

189

Petit Syrah

232

226

214

205

239

-

214

210

245

-

191

189

Pinot noir

238

228

205

-

243

239

218

216

253

243

189

185

Portugais bleu

232

226

211

-

255

243

218

210

243

-

185

179

Ruby Cabernet

232

226

211

-

239

-

214

210

259

253

181

175

Sabat Vongie

236

-

214

-

249

247

210

-

245

-

181

-

Sauvignon vert

240

228

194

-

247

239

210

-

253

245

185

179

Sauvignon blanc

232

228

212

205

257

239

219

218

253

245

189

175

Sauvignon gris

232

228

212

205

257

239

219

218

253

245

189

175

Semillón

238

236

212

205

257

239

219

-

253

245

185

175

Silvaner

232

226

211

-

247

243

218

210

253

245

194

189

Verdot

238

232

214

205

257

239

218

210

253

245

185

179

White Riesling

234

226

214

211

257

249

218

210

259

253

189

181

Zinfandel

236

226

214

212

249

247

210

-

253

245

181

179

Variedad

Marcador

VVMD28

VVMD31

VVMD32

VVMD34

VVMD36

VVS29

Aurora

271

237

212

-

273

-

240

230

264

252

179

171

Cabernet Franc

239

231

216

206

257

241

240

-

254

-

181

175

C. Sauvignon

239

237

210

206

241

241

248

240

264

254

181

179

Carmenère

253

239

210

206

241

-

240

-

272

254

181

175

Chardonnay

231

221

216

214

273

241

240

-

276

254

179

171

Gewürztraminer

239

237

216

204

273

241

240

-

264

254

171

-

Merlot

237

231

216

212

241

-

240

-

254

-

181

175

Petit Syrah

231

221

216

212

273

241

240

-

ND

ND

179

171

Pinot noir

239

221

216

-

273

241

240

-

254

-

179

171

Portugais bleu

261

231

210

204

273

253

242

240

ND

ND

171

-

Ruby Cabernet

261

237

210

206

253

241

248

240

264

ND

179

171

Sabat Vongie

271

221

224

216

273

-

240

230

264

268

179

-

Sauvignon blanc

239

237

216

210

257

241

248

240

295

264

179

171

Sauvignon gris

239

237

216

210

257

241

248

240

295

264

179

171

Sauvignon vert

261

239

212

206

257

253

240

-

ND

ND

179

171

Semillón

251

237

210

204

273

241

240

-

264

-

171

-

Silvaner

239

231

210

204

273

-

240

-

276

264

179

171

Verdot

261

221

216

212

251

241

240

-

254

-

179

171

White Riesling

235

233

212

204

273

253

240

-

ND

ND

179

171

Zinfandel

261

251

ND

ND

265

255

240

-

ND

ND

179

171

SSR: Secuencias simples repetidas.
-: indica que se detectó un único alelo para una determinada combinación marcador/genotipo, lo que puede corresponder a un homocigoto o un alelo nulo (
Botta et al., 1995).
ND: no determinado.

Marcadores de microsatélites (SSR)

Para el análisis de SSR se usaron partidores para 11 loci diseñados por Bowers et al. (1996, 1999b), más aquel denominado VVS-29, diseñado por M. Thomas, de CSIRO, Australia (resultados no publicados). Las secuencias y otras características de estos partidores de SSR se encuentran en las citas indicadas. Las secuencias de los partidores VVS-29 son las siguientes:

VVS-29 forward: 5’ CCCCAAGGCTCTGAAAACAAT 3’
VVS-29 reverse: 5’ TGCAAACGAAATAAAGCTTCCA 3’

Reacciones de PCR para SSR

Cada mezcla de reacción contenía (concentraciones finales) 10 ng de ADN, 10 pmoles de partidores (directo y reverso), 8mM de dNTPs, 1,5 mM de MgCl2, tampón de PCR 1X (Tris-HCl 10 mM pH 8,3; KCl 50 mM y 0,01% de gelatina) y 0,5 U de Taq polimerasa en 16 m L de volumen final. Se usó un termociclador Perkin-Elmer con el siguiente programa de amplificación: desnaturación a 95ºC por 5 min; 35 ciclos de 95ºC por 45 s, alineamiento a 56ºC por 45 s y extensión a 72ºC por 90 s; elongación final por 7 min a 72ºC.

La eficiencia de la reacción de amplificación fue confirmada en un gel de agarosa-TBE al 2,5%, cargando 7 m L de la reacción; luego, se tomó 1 m L del producto de cada reacción y se diluyó a la mitad con tampón de formamida (0,05% de azul de bromofenol y xilen cianol, en 95% de formamida). Esta mezcla se cargó en un gel desnaturalizante de poliacrilamida al 6% conteniendo urea (6,5 M), preparado en TBE 1X. La corrida electroforética se realizó a 70-80 W, verificándose una corriente inicial de unos 1.800 a 2.000 V (temperatura óptima de corrida de 50°C). Luego de aproximadamente 2 h, se procedió a fijar y teñir el gel con nitrato de plata, de acuerdo al protocolo del kit Promega Silver Sequencing (Promega) (Bowers et al., 1996). Los tamaños de cada banda se determinaron por comparación con referencias de alelos de SSR de genotipos conocidos, previamente analizadas en el laboratorio y cargadas en el mismo gel. Además, se compararon con patrones de algunos cultivares disponibles en la literatura (ver Resultados y Discusión).

Determinación de la capacidad de los marcadores de SSR para diferenciar cultivares

Se contabilizó el número de alelos y genotipos identificados con cada marcador de SSR y en base a estos datos se calculó la heterocigocidad esperada (He = 1 - S pi2, siendo pi la frecuencia alélica), expresada como porcentaje (Cuadro 2). He refleja la capacidad de cada marcador de SSR para diferenciar dos alelos seleccionados al azar en una población determinada (Powell et al., 1996), en este caso, entre los 20 genotipos de vides.

Cuadro 2. Resumen de la información obtenida con cada marcador de SSR analizado.
Table 2. Summary of the information obtained for each SSR marker analyzed.

Marcador

 

Característica 

VVMD-5

VVMD-6

VVMD-7

VVMD-24

VVMD-25

VVMD-27

VVMD-28

VVMD-31

VVMD-32

VVMD-34

VVMD-36

VVS-29

Nº de genotipos observados

13

11

10

8

7

11

15

11

9

4

9

5

Nº de alelos observados

7

5

7

5

4

7

10

7

7

4

7

4

Nº de pares de genotipos no diferenciados

7

9

10

12

13

9

5

7

11

16

4

15

Heterocigocidad esperada (He)

0,8487

0,7846

0,7859

0,7026

0,7269

0,8205

0,8705

0,7371

0,7308

0,2743

0,484

0,6577

SSR: Secuencias simples repetidas.

Para estimar teóricamente la capacidad de diferenciación que tendría cada marcador de SSR (o combinación de ellos), se recurrió a la fórmula deducida por Tessier et al. (1999). Brevemente, se listaron los marcadores, comenzando por el que tuviese el mayor número de genotipos observados, y posteriormente se agregaron secuencialmente los demás partidores, hasta los menos informativos. Luego se calculó el número teórico de pares de genotipos no diferenciables, Xk, haciendo combinaciones con un número creciente de marcadores (Cuadro 3). Para este cálculo, se usó la fórmula:

donde N es el número de genotipos estudiados, [N(N-1)/2] representa el número de pares de combinaciones diferentes entre genotipos y Cj es la probabilidad de que dos individuos seleccionados aleatoriamente presenten un fingerprinting idéntico. Por ejemplo, si se tienen 20 genotipos, existen 190 posibles combinaciones diferentes entre ellos (pares), o dicho de otro modo, se tiene una probabilidad de 1 en 190 de equivocarse si se pretende identificar un genotipo en base a un patrón único. En este contexto, se define un factor de exclusión, D, que es el complemento de Cj (D = 1 -C ) y es equivalente a la heterocigocidad esperada, determinada para cada marcador en base a las frecuencias de los diferentes patrones alélicos (Tessier et al., 1999). Como comparación a los valores teóricos calculados, se verificó el número de genotipos que no es posible diferenciar efectivamente con cada combinación de marcadores (Cuadro 3).

Cuadro 3. Capacidad acumulada de los marcadores de SSR para diferenciar cultivares de vides viníferas.
Table 3. Cumulative ability of the SSR markers to differentiate wine grape cultivars.

Combinación de marcadores

N° de pares no diferenciados

 

 

Valor calculado (Xk) 1

Valor observado

 

.

D28

24,6025

5

D28+D5

3,7219

1

D28+D5+D6

0,8016

1

D28+D5+D6+D7

0,1716

1

D28+D5+D6+D7+D27

0,0308

1

D28+D5+D6+D7+D27+D31

0,0081

1

D28+D5+D6+D7+D27+D31+D24

0,0024

1

D28+D5+D6+D7+D27+D31+D24+D32

0,0006

1

D28+D5+D6+D7+D27+D31+D24+D32+D25

0,0002

1

D28+D5+D6+D7+D27+D31+D24+D32+D25+D36

0,0001

1

SSR: Secuencias simples repetidas.
1 El número teórico de pares de genotipos no diferenciados (Xk) se calculó de acuerdo a lo indicado en Materiales y Métodos.

RESULTADOS Y DISCUSIÓN

En este trabajo se han definido los patrones genéticos para 20 cultivares de vides viníferas (Cuadro 1), muchos de los cuales tienen características ampelográficas que dificultan su diferenciación por métodos morfológicos clásicos. Para este propósito, se han usado los marcadores de ADN conocidos como microsatélites, considerados la mejor alternativa si se cuenta con partidores diseñados para loci genéticos polimórficos, debido principalmente a sus características de reproducibilidad y buena calidad de la información generada (Morgante y Olivieri, 1993).

La Figura 1 muestra la separación electroforética en un gel de poliacrilamida desnaturalizante de los alelos correspondientes al marcador VVMD-5 de los 20 cultivares estudiados. Allí también se ilustra la calidad técnica y facilidad de interpretación de los patrones de microsatélites. En este caso (VVMD-5) se encontraron 13 genotipos diferentes combinando siete alelos de tamaños entre 226 y 240 pares de bases; dado que VVMD-5 es un marcador de dinucleótidos, cuyos tamaños se diferencian de dos en dos nucleótidos, en esta serie sólo faltó la banda correspondiente al alelo 230. De estos 13 genotipos, ocho patrones fueron propios de un único cultivar, cuatro patrones correspondieron a pares de genotipos indiferenciables (sumando ocho genotipos) y hubo un grupo de cuatro genotipos con igual combinación alélica. Este resultado es indicativo de la alta heterocigocidad de este tipo de marcadores en vides.

Figura 1. Patrones electroforéticos de genotipos de vid analizados con el marcador VVMD-5. Los tamaños de los amplicones fueron calculados de acuerdo a la co-migración con estándares auténticos de algunos cultivares (ver texto y tamaños indicados en el lado derecho).
Figure 1. Electrophoretic patterns of grapevine genotypes analyzed with the VVMD-5 marker. Amplicon sizes were calculated based on co-migration of reference cultivars (see text and allele sizes at the right).

El Cuadro 1 contiene la información de los tamaños (pb) de los amplicones identificados en los 20 genotipos con los 12 marcadores de SSR. Para el análisis subsecuente, no se considerará al marcador VVMD-36 debido a que consistentemente mostró dificultades técnicas en las reacciones de PCR, obteniéndose información sólo para 13 de los 20 genotipos. Del resto de los marcadores, sólo un genotipo careció de información en un marcador (Zinfandel en VVMD-31). Para cada uno de los cultivares se cuenta entonces con 11 a 12 loci caracterizados, con excepción del cultivar Zinfandel, con 10 marcadores caracterizados. Con cada marcador se encontraron una o dos bandas, correspondientes a loci homocigotos o heterocigotos, respectivamente. El rango de heterocigosis fluctuó entre 70% (marcador VVMD-6, ver Cuadro 1) y 100% (VVMD-28), aunque el marcador VVMD-34 fue excepcionalmente bajo, con sólo un 32%. Considerando el conjunto de datos colectados con el set de 11 marcadores, la heterocigosis promedio fue de 77%, que aumenta a 82% si no se considera el marcador VVMD-34. Estos valores confirman la alta heterocigocidad de esta especie, la que podría ser aún mayor si se determinara que algunos homocigotos corresponden más bien a heterocigotos con alelos nulos, lo que ha sido reportado en vides (Sefc et al., 1998). Por esta razón, en el Cuadro 1 no se explicita si efectivamente se trata de un homocigoto, excepto en Cabernet Sauvignon, para el cual se conocen los alelos respectivos de los progenitores (Bowers y Meredith, 1997).

El análisis de SSR "genera" alelos nulos porque uno o ambos sitios de unión de los partidores de PCR están mutados por modificaciones puntuales, inserciones o deleciones de fragmentos de ADN, lo que impide la amplificación. El diseño de nuevos partidores, que reconozcan secuencias alternativas cercanas al SSR, puede ayudar a amplificar alelos "desaparecidos" y confirmaría que se trata de alelos nulos (Callen y Thompson, 1993), aunque la forma más usual de verificarlo es estudiar la descendencia de un cruzamiento entre el genotipo con un supuesto alelo nulo (genotipo incógnito) y otro que sea heterocigoto; si en la progenie se obtiene una mezcla en porcentajes iguales de dos heterocigotos, el genotipo incógnito era efectivamente homocigoto, pero si además de estos heterocigotos (ahora reducidos a un 25% cada uno) se encuentran otros dos grupos de segregantes, cada uno también con un 25% de "homocigotos" (nulos verdaderos), entonces se confirmaría la presencia del alelo nulo en el progenitor testeado. Una forma indirecta de estimar la frecuencia de alelos nulos en una determinada población fue discutida por Sefc et al. (1998), quienes, analizando una población de más de 60 cultivares y portainjertos austríacos, determinaron que los marcadores VVMD7, VVMD-28, VVMD-36 y VVS-29 tendrían una baja probabilidad de presentar alelos nulos, basados en los valores de He y Ho (heterocigocidad esperada y observada, respectivamente). Por el contrario, VVMD-5 y VVMD-32 sí podrían aportar alelos nulos (Sefc et al., 1998).

Todos los marcadores fueron altamente polimórficos entre los cultivares analizados, detectándose el mayor número de alelos y genotipos diferentes (10 y 15, respectivamente) con el marcador VVMD-28. Esta información, además de los valores de He (que refleja la capacidad de cada marcador para diferenciar dos o más cultivares elegidos al azar), se resume en el Cuadro 2. De acuerdo a estos datos, los marcadores VVMD-28 y VVMD-5, ambos con valores de He superiores a 0,84, serían los mejores marcadores para diferenciar los 20 cultivares considerados en este trabajo. Cabe mencionar que esta situación dependerá en primer lugar del número y naturaleza de los cultivares que se están analizando, aunque también de la "calidad" técnica del marcador (ver más adelante) así como de la homogeneidad propia del cultivar (Grando y Frisinghelli, 1998). Sefc et al. (1998) también identificaron al marcador VVMD-28 como el más informativo, aunque ellos analizaron otro grupo de marcadores y genotipos, entre los que se comparten sólo algunos con este trabajo.

Para identificar confiablemente un cultivar, es conveniente usar el máximo de descriptores, pero debido al alto costo de la metodología es necesario al mismo tiempo definir un número mínimo de marcadores de SSR, manteniendo un bajo nivel de riesgo de confundir genotipos estrechamente emparentados. En este sentido, es también necesario determinar la diversidad genética inherente a los cultivares y portainjertos del género Vitis en su conjunto y de la especie V. vinifera en particular (Tessier et al., 1999; Narváez et al., 2000). Para determinar la combinación de marcadores que permitiera la mejor diferenciación de los cultivares viníferos (Cuadro 3), se consideró lo propuesto por Tessier et al. (1999), quienes estimaron un valor teórico del número de genotipos no diferenciables, basados en el número de genotipos observados para cada marcador. Como segundo criterio, se eligieron marcadores que tuvieran mayor facilidad para identificar sus diferentes amplicones, razón por la que VVMD-7 aparece precediendo a otros marcadores con mayor número de genotipos observados, como VVMD-27 o VVMD-31.

Como se puede apreciar en el Cuadro 3, la combinación de tres marcadores (VVMD-28, -5 y -6) mostró una alta capacidad discriminativa, representada por un número de genotipos no diferenciados menor que la unidad (0,80), lo que indica que sólo un par de genotipos no fue diferenciado. Esos dos genotipos corresponden a los cultivares Sauvignon blanc y Sauvignon gris, que son considerados clones que se han diferenciado por mutaciones en la vía biosintética de las antocianinas (Galet, 1979), lo que explica su alta similitud genética. Este análisis fue corroborado con el de los genotipos efectivamente diferenciados (Cuadro 3), donde se verificó que bastaría la combinación de los marcadores VVMD-28 y VVMD-5 para diferenciar los 20 genotipos estudiados (con la excepción antes mencionada). De esta manera, este trabajo demuestra que los cultivares viníferos más comúnmente usados en Chile pueden ser identificados mediante dos marcadores de SSR, VVMD-5 y VVMD-28, los cuales pueden ser ampliados a cuatro (sumando los marcadores VVMD-6 y VVMD-7) para tener mayor seguridad en las determinaciones. Además, estos cuatro marcadores se pueden combinar en corridas electroforéticas dobles, ya que los tamaños de sus alelos no se sobreponen. Estas dos parejas ("duplex") serían VVMD-5 + VVMD-7 y VVMD-6 + VVMD-28.

A pesar que los cultivares de vid son multiplicados vegetativamente, y por lo tanto no debieran existir diferencias entre genotipos de un mismo cultivar, se han descrito diferencias entre clones de cultivares como Sangiovese y Colorino usando marcadores moleculares como AFLP (Sensi et al., 1996) y microsatélites (Vignani et al., 1996). Debido a ello, en este trabajo se verificó la reproducibilidad de los patrones de SSR, analizándose los patrones de SSR de entre seis y diez genotipos para cinco cultivares. La Figura 2 muestra el resultado con tres de estos cultivares (Carmenère, Chardonnay y Merlot), usando el marcador VVMD-5. Se observa una completa identidad entre los patrones de las distintas plantas de cada cultivar, lo que demuestra la alta reproducibilidad del método usado.

Figura 2. Reproducibilidad de los patrones de secuencias simples repetidas (SSR). Análisis en gel de electroforesis de los patrones de SSR de seis plantas diferentes para tres cultivares (según se indica) usando el marcador VVMD-5. "Referencias" corresponden a las plantas usadas en este trabajo para generar los patrones señalados en el Cuadro 1 (Chardonnay (Ch), Carmenère (Ca) y Merlot (Me), respectivamente).
Figure 2. Reproducibility of the SSR patterns. Electrophoresis separation of simple sequence repetition (SSR) PCR products for six different plants of three cultivars (as indicated) using VVMD-5 marker. "References" are the genotypes effectively used in this work to generate the complete SSR pattern listed in Table 1 (Chardonnay (Ch), Carmenère (Ca) y Merlot (Me) respectively).

En relación con esto, los marcadores más útiles son aquellos que muestran alelos (amplicones) con diferencias de más de 2 pares de bases entre cultivares (Lin y Walker, 1998), ya que la determinación del tamaño de los alelos puede variar entre uno a dos pares de bases, de acuerdo al ADN usado como referencia y al método de visualización de las bandas. Es así como el método de tinción con plata entrega tamaños con uno, dos (Bowers et al., 1996; Bowers et al., 1999b) o hasta cuatro u ocho pares de bases de diferencia a los estimados con sistemas de secuenciación automáticos basados en marca fluorescente (Grando y Frisinghelli, 1998; Sefc et al., 1998). Dado que aquí se ha usado tinción de plata, los patrones moleculares determinados deben compararse con los resultados obtenidos con la misma metodología.

Los cultivares incluidos en este estudio corresponden a algunos de los más usados en el mundo, casi todos provenientes de Francia. Estos cultivares han sido caracterizados anteriormente (Bowers y Meredith, 1997; Sefc et al., 1998; Bowers et al., 1999a, 1999b), encontrándose una alta consistencia con los tamaños de los alelos reportados aquí para los cultivares Cabernet Sauvignon, Cabernet Franc, Sauvignon blanc, Pinot noir, Chardonnay, Merlot, Semillon, Sauvignon blanc, Silvaner y Riesling. Para estos cultivares, se comparó directamente con ADN de los respectivos genotipos obtenido del Foundation Plant Material Service de la Universidad de California, Davis, y del Institut National de la Recherche Agronomique, INRA, Montpellier, Francia, encontrándose perfecta coincidencia en cada caso. Este resultado indica que las plantas mantenidas en el jardín de variedades del INIA, CRI La Platina, establecido a partir de materiales colectados en viñedos nacionales, están correctamente indexadas, aunque se tiene evidencia de al menos un error en esta colección, correspondiente a un grupo de plantas de Carmenère consideradas como Merlot hasta antes de este trabajo (Hinrichsen et al., 2001). Del resto de las variedades, no se puede tener certeza de su identidad, ya que no se cuenta con referencias auténticas. Como han demostrado recientemente Meredith et al. (1999), es fundamental disponer de más de una referencia para hacer una certificación confiable, o bien disponer de la información proveniente de centros como los mencionados más arriba, repositorios de cultivares y clones de referencia internacional.

Además de los 20 cultivares analizados más exhaustivamente, se dispone de información que permite diferenciar a otros genotipos de más reciente ingreso al país, o que tienen menor importancia productiva, como por ejemplo los cultivares de uva blanca Viognier y Mouvedre. Estos cultivares fueron recientemente introducidos al valle de Casablanca, siendo diferenciables de los otros 20 con sólo dos marcadores analizados (VVMD-5 y VVMD-7), aunque han sido caracterizados en otros dos marcadores, también polimórficos (VVMD-6 y VVMD-28). Además, ha sido posible identificar genéticamente una serie de muestras cuyo patrón molecular no coincide con ningún cultivar conocido. Algunas de éstas corresponden en uno o ambos alelos con las cepas correspondientes a los viñedos donde se han encontrado, por lo que podrían corresponder a descendientes de esas mismas cepas; en otros casos, en cambio, se han detectado genotipos que en más de un locus no coinciden en ningún alelo con las cepas que podrían ser sus progenitores (estimados por similitud ampelográfica), lo que plantea una interrogante para futuras investigaciones sobre el tema.

CONCLUSIONES

El análisis mediante microsatélites (SSR) permite la inequívoca identificación de los cultivares de vides viníferas más comunes en el país, con excepción de Sauvignon blanc y Sauvignon gris. La información presentada en este trabajo puede constituir la base de un sistema de certificación genética, complementaria a estudios ampelográficos

AGRADECIMIENTOS

Este trabajo fue parcialmente financiado por los Proyectos FONDECYT 1970186 y FDI 98 C3-AT01. Los autores agradecen la valiosa colaboración de la Dra. Carole P. Meredith, del Dr. John E. Bowers y de Summaira Riaz, de la Universidad de California, Davis, California, EE.UU. Igualmente, agradecen la posibilidad de usar el marcador VVS-29, desarrollado por el Dr. Mark E. Thomas de CSIRO, Adelaide, Australia.

LITERATURA CITADA

Beckmann, J.S., and M. Soller. 1990. Toward a unified approach to the genetic mapping of eukaryotes based on sequence-tagged microsatellite sites. Bio/Technology 8:930-932 .        [ Links ]

Botta, R., N.S. Scott, I. Eynard, and M.R. Thomas. 1995. Evaluation of microsatellite sequence-tagged site markers for characterizing Vitis vinifera cultivars. Vitis 34: 99-102.        [ Links ]

Bowers, J.E., and C.P. Meredith. 1997. The parentage of a classic wine grape, Cabernet Sauvignon. Nature Genetics 16: 84-87.        [ Links ]

Bowers, J.E., E.B. Bandman, and C.P. Meredith. 1993. DNA fingerprint characterization of some wine grape cultivars. Am. J. Enol. Vitic. 44:266-274.        [ Links ]

Bowers, J.E., G.S. Dangl, R. Vignani, and C.P. Meredith. 1996. Isolation and characterization of new polymorphic simple sequence repeat loci in grape (Vitis vinifera L.). Genome 39: 628-633.        [ Links ]

Bowers, J., J.M. Boursiquot, P. This, K. Chu, H. Johansson, and C.P. Meredith. 1999a. Historical genetics: The parentage of Chardonnay, Gamay, and other wine grapes of Northeastern France. Science 285:1562-1565.        [ Links ]

Bowers, J.E., G.S. Dangl, and C.P. Meredith.]1999b. Development and characterization of additional microsatellite DNA markers for grape. Am. J. Enol. Vitic. 50:243-246.        [ Links ]

Callen, D.F., and A. Thompson.1993. Incidence and origen of null alleles in the (AC)n microsatellites markers. Am. J. Human Genet. 52: 922-927.        [ Links ]

Cervera, M.T., J.A. Cabezas, J.C. Sancha, F. Martinez de Toda, and J.M. Martinez-Zapater. 1998. Application of AFLPs to the characterization of grapevine Vitis vinifera L. genetic resources. A case study with accessions from Rioja (Spain). Theor. Appl. Genet. 97: 51-59.        [ Links ]

Cipriani, G., G. Frazza, E. Peterlunger, and R. Testolin. 1994. Grapevine fingerprinting using microsatellite repeats. Vitis 33:211-215.        [ Links ]

Collins, G.G., and R.H. Symons. 1993. Polymorphisms in grapevine DNA detected by the RAPD PCR technique. Plant Molec. Biol. Rep. 11: 105-112.        [ Links ]

Costa B., V. 1998. La vitivinicultura mundial frente a la situación chilena y proyecciones. In Curso Tópicos de actualización en vitivinicultura y enología, Santiago, Chile. Pontificia Universidad Católica de Chile, Facultad de Agronomía e Ingeniería Forestal, Santiago, Chile.         [ Links ]

Del Pozo, J. 1998. Historia del Vino Chileno. 315 p. Editorial Universitaria, Santiago, Chile.         [ Links ]

Ferreira, M.E., y D. Grattapaglia. 1996. Introdução ao uso de marcadores moleculares em análise genética. (Documento 20). 220 p. 2a ed. EMBRAPA, Centro de Recursos Genéticos y Biotecnología, Brasilia, Brasil.         [ Links ]

Galet, A. 1979. A practical ampelography: grapevine identification. 248 p. Commstock Publishing Association, Cornell University Press, Ithaca, New York, USA.         [ Links ]

Gogorcena, Y., S. Arulsekar, A.M. Dandekar, and D.E. Parfitt. 1993. Molecular markers for grape characterization. Vitis 32: 183-185.        [ Links ]

Grando, M.S. and C. Frisinghelli. 1998. Grape microsatellite markers: Sizing of DNA alleles and genotype analysis of some grapevine cultivars. Vitis 37:79-82.        [ Links ]

Hearne, C.M., S. Ghosh, and J.A. Todd. 1992. Microsatellites for linkage analysis of genetic traits. Trends Genet. 8:288-294.        [ Links ]

Hinrichsen, P., C. Narváez, J.E. Bowers, J.M. Boursiquot, J. Valenzuela, C. Muñoz, and C.P. Meredith. 2001. Distinguishing ‘Carménère’ from similar varieties by DNA typing. Am. J. Enol. Vitic. (in press).        [ Links ]

Jean-Jaques, I., A. Defontaine, and J.N. Hallet. 1993. Characterization of Vitis vinifera cultivars by random amplified polymorphic DNA markers. Vitis 32:189-190.        [ Links ]

Jeffreys, A.J., V. Wilson, and S.L. Thein. 1985. Hypervariable "minisatellite" regions in human DNA. Nature 314:67-73.        [ Links ]

.Lagercrantz, U., H. Ellegren, and L. Andersson. 1993. The abundance of various polymorphic microsatellite motifs differs between plants and vertebrates. Nucleic Acids Res. 21:1111-1115.        [ Links ]

Lin, H., and A. Walker. 1998. Identifying grape rootstocks with simple sequence repeat (SSR) DNA markers. Am. J. Enol. Vitic. 49:403-407.        [ Links ]

Lodhi, M.A., G. Ye, N.F. Weeden, and B.I. Reish. 1994. A simple and efficient method for DNA extraction from grapevine cultivars and Vitis species. Plant Mol. Biol. Rep. 12: 6-13.        [ Links ]

Meredith, C.P.; J.E. Bowers, S. Riaz, V. Handley, E.B. Bandman, and G.S. Dangl. 1999. The identity and parentage of the variety known in California as Petite Sirah. Am. J. Enol. Vitic. 50: 236-242.        [ Links ]

Morell, M.K., R. Peakall, R. Appels, L.R. Preston, and H.L. Lloyd. 1995. DNA profiling techniques for plant variety identification. Aust. J. Exp. Agric. 35:807-819.        [ Links ]

Morgante, M., and A.M. Olivieri. 1993. PCR-amplified microsatellites as markers in plant genetics. Plant J. 3:175-182.        [ Links ]

Narváez, C., J. Valenzuela, C. Muñoz, y P. Hinrichsen. 2000. Comparación de métodos de identificación genética de vid basados en el estudio de fragmentos genómicos anónimos (RAPD y AFLP). Agricultura Técnica Chile 60:320-340.        [ Links ]

Powell, W., M. Morgante, C. Andre, M. Hanafey, J. Vogel, S. Tingey, and A. Rafalski. 1996. The comparison of RFLP, RAPD, AFLP and SSR (microsatellite) markers for germplasm analysis. Mol. Breeding 2:225-238.        [ Links ]

Qu, X., J. Lu, and O. Lamikanra . 1996. Genetic diversity in muscadine and American bunch grapes based on randomly amplified polymorphic DNA (RAPD) analysis. J. Am. Hortic. Sci.121:1020-1023.         [ Links ]

Rafalski, J.A., and S.V. Tingey. 1993. Genetic diagnostics in plant breeding: RAPDs, microsatellites and machines. Trends Genet. 9:275-279.        [ Links ]

Sefc, K.M., H. Steinkellner, H.W. Wagner, J. Glössl, and F. Regner. 1997. Application of microsatellite markers to parentage studies in grapevine. Vitis 36:179-183.        [ Links ]

Sefc, K.M., F. Regner, J. Glössl, and H. Steinkellner. 1998. Genotyping of grapevine and rootstock cultivars using microsatellite markers. Vitis 37:15-20.        [ Links ]

Sensi, E., R. Vignani, W. Rohde, and S. Biricolti. 1996. Characterization of genetic biodiversity within Vitis vinifera L. Sangiovese and Colorino genotypes by AFLP and ISTR DNA marker technology. Vitis 35: 182-188.        [ Links ]

Stavrakakis, M.N., K. Biniari, and P. Hatzopoulos. 1997. Identification and discrimination of eight Greek grape cultivars (Vitis vinifera L.) by random amplified polymorphic DNA markers. Vitis 36:175-178.        [ Links ]

Tautz, D. 1989. Hypervariability of simple sequences as a general source for polymorphic DNA markers. Nucleic Acids Res. 17:6463-6471.        [ Links ]

Tessier, C., J. David, P. This, J.M. Boursiquot, and A. Charrier. 1999. Optimization of the choice of molecular markers for varietal identification in Vitis vinifera L. Theor. Appl. Genet. 98:171-177        [ Links ]

This, P., C. Cuisset, and J.M. Boursiquot. 1997. Development of stable RAPD markers for the identification of grapevine rootstocks and the analysis of genetic relationships. Am. J. Enol. Vitic. 48:492-501.        [ Links ]

Thomas, M.R., and N.S. Scott. 1993. Microsatellite repeats in grapevine reveal DNA polymorphisms when analysed as sequence-tagged sites (STSs). Theor. Appl. Genet. 86:985-990.        [ Links ]

Thomas, M.R., S. Matsumoto, P. Cain, and N.S. Scott. 1993. Repetitive DNA of grapevine: classes present and sequences suitable for cultivar identification. Theor. Appl. Genet. 86:173-180.        [ Links ]

Thomas, M.R., P. Cain, and N.S. Scott. 1994. DNA typing of grapevine: a universal methodology and database for describing cultivars and evaluating genetic relatedness. Plant Mol. Biol. 25:939-949.        [ Links ]

Vignani, R., J.E. Bowers, and C.P. Meredith. 1996. Microsatellite DNA polymorphism analysis of clones of Vitis vinifera "Sangiovese". Scientia Hortic.65:163-169.        [ Links ]

Creative Commons License Todo el contenido de esta revista, excepto dónde está identificado, está bajo una Licencia Creative Commons