SciELO - Scientific Electronic Library Online

 
vol.129 número3Certificación serológica de la interrupción de la transmisión vectorial de la enfermedad de Chagas en ChileFrecuencia de los defectos de cierre del tubo neural en las maternidades públicas de Santiago durante el año 1999 índice de autoresíndice de materiabúsqueda de artículos
Home Pagelista alfabética de revistas  

Servicios Personalizados

Revista

Articulo

Indicadores

Links relacionados

Compartir


Revista médica de Chile

versión impresa ISSN 0034-9887

Rev. méd. Chile v.129 n.3 Santiago mar. 2001

http://dx.doi.org/10.4067/S0034-98872001000300006 

Búsqueda de la espiroqueta
Borrelia burgdorferi sensu lato
mediante PCR en garrapatas
ixoideas chilenas silvestres

Search for the spirochete
Borrelia burgdorferi senso lato
by polymerase chain reaction
in Chilean ticks

Gonzalo Osorio A.

Background: Lyme disease is a tick-borne human disease caused by the spirochete Borrelia burgdorferi. Main vectors of Lyme disease are ticks of the Ixodes and Amblyomma genera. Cases with clinical manifestations of Lyme disease and favorable responses to antimicrobial agents have been reported in Chile, some of them with erythema migrans, the hallmark of B burgdorferi infection. Aim: To detect the presence of B burgdorferi in Chilean ticks. Material and methods: A total of 62 ticks were recollected from wild rodents and cervidae in the Southern region of Chile. Infected and non infected ticks of the species Ixodes ricimus, were used as controls. Insects were homogenised and B burgdorferi was detected using classical and nested polymerase chain reactions. Results: B burgdorferi was not detected in the studied ticks. Conclusions: Although all the elements required for the enzootic cycle of B burgdorferi are present in Chile, its direct detection in Chilean ticks using the nested polymerase chain reaction assay was negative. (Rev Méd Chile 2001; 129: 270-6).
(Key-words: Borrelia burgdorferi; Lyme disease; Tick-home diseases).

Recibido 27 de septiembre, 2000. Aceptado en versión corregida 1 de diciembre, 2000.
Trabajo financiado por Proyecto de Iniciación DID # I016-98/2 de la Universidad
de Chile 1999-2000.
Programa de Microbiología y Micología, ICBM Facultad de Medicina, Universidad de
Chile, Santiago, Chile.

La enfermedad de Lyme (EL) es una enfermedad infecciosa que afecta al hombre, y cuyo agente etiológico es la espiroqueta Borrelia burgdorferi. Este microorganismo es transmitido al hombre por la picadura de garrapatas duras del complejo Ixodes ricinus. En USA, los principales reservorios de esta espiroqueta son mamíferos pequeños, tales como roedores silvestres y ciertos cérvidos. La distribución geográfica de esta enfermedad comprende actualmente sólo al hemisferio norte (USA, Europa y Asia). La EL es multisistémica y sin tratamiento tiene un curso crónico1,2.

La existencia de EL se sospechó por primera vez en Chile en el año 19894. En la misma época, un caso de eritema crónico migrans (ECM) fue comunicado en Chile5. Este caso presentó las características clásicas de este tipo de lesión, revelando el estudio de la biopsia cutánea microorganismos de forma espirilar. Algunos años más tarde se describió otro caso de ECM con respuesta favorable al tratamiento antimicrobiano6. Recientemente, 118 pacientes con signos y síntomas sugerentes de EL fueron estudiados en Chile7. Sin embargo, el estudio serológico no pudo confirmar como agente etiológico a Borrelia burgdorferi.

Estos resultados se pueden explicar considerando la gran heterogeneidad descrita para el grupo de B burgdorferi sensu lato, siendo todas sus especies posibles agentes etiológicos de EL. Este grupo comprende a las siguientes especies: B burgdorferi sensu stricto (múltiples cepas diferentes), B afzelii, B garinii, B andersoni, B japonica, B lusitaniae, B tanikii y B turdae. Todas ellas difieren en aspectos genéticos, biológicos, ciertas diferencias en la presentación clínica de la enfermedad y además en su distribución geográfica8-11. Es importante enfatizar que los ensayos inmunológicos antes mencionados se realizaron con antígenos correspondientes a B burgdorferi sensu stricto, sólo una de las nueve especies reconocidas actualmente como agentes etiológicos de EL.

Recientemente, la reacción en cadena de la polimerasa (PCR) se ha utilizado para detectar ADN específico de B burgdorferi. Este método presenta una elevada sensibilidad y especificidad debido fundamentalmente a dos razones. Puede detectar tanto segmentos génicos específicos de cada especie, como también segmentos génicos compartidos por el grupo completo de B burgdorferi sensu lato. Además, esta técnica puede detectar hasta 1-5 espiroquetas en garrapatas infectadas12,13. Este trabajo tuvo por objeto estudiar la presencia de la espiroqueta B burgdorferi sensu stricto y sensu lato mediante las técnicas de PCR clásica y anidada, en garrapatas ixoideas silvestres de la zona sur del país recolectadas desde roedores y cérvidos.

MATERIAL Y MÉTODO

Recolección de garrapatas y controles. Las garrapatas estudiadas fueron recolectadas a partir de roedores silvestres y cérvidos en la octava y novena región del país. La recolección se realizó manualmente, a partir de roedores silvestres anestesiados o sacrificados (Tabla 1). Las especies de roedores estudiados fueron principalmente Abrothrix longipilus, Abrothrix olivaceus y Rattus rattus. La principal zona corporal parasitada en estos roedores era la región periauricular. El cérvido estudiado fue un Pudu pudu macho de aproximadamente 10 meses de edad.


La identificación de las garrapatas aisladas de roedores correspondió a Ixodes sigelos y las aisladas de Pudú a Ixodes stilesi. Las garrapatas utilizadas como controles (infectadas y no infectadas con B burgdorferi sensu stricto), pertenecientes a la especie Ixodes ricinus, fueron proveídas gentilmente por el Dr. Felipe Cabello del New York Medical College.

Preparación de extractos de garrapatas. Los extractos de garrapatas se prepararon de acuerdo a Kirstein et al, 199714. Brevemente, las garrapatas recolectadas y las controles conservadas en etanol al 70%, fueron depositadas en un tubo de ensayo de 5 ml estéril, agregándose inmediatamente 50 µl de hidróxido de amonio 0,7 M. La homogenización se realizó con la ayuda de una bagueta de vidrio estéril. Se agregó finalmente 150 µl de hidróxido de amonio 0,7 M, calentando la muestra a 100°C por 30 m. Se centrifugó la muestra a 10.000 g por 1 m y el sobrenadante obtenido fue utilizado para las reacciones de detección por PCR.

Ensayos de PCR clásica y anidada. Se utilizó un termociclador Minicycler™ (MJ Research) con cubierta calefactora. Para las reacciones de PCR clásica se utilizó como sitio blanco de amplificación el gen ospA. Los partidores utilizados fueron los siguientes: TCTAATATTAGCCTTAATA (directo) y CCATTGTTTTTATCAGAAGTTC (inverso). Cada reacción constó con 2,5 u de Taq polimerasa, 5 µl de homogenizado de garrapatas, 2,5 µl de cada partidor (100 ng/µl), 5 µl de dNTP (1 mM), 10 µl de tampón 5x (preparado con 500 µl de tampón PCR 10 x, 400 µl de cloruro de magnesio 25 mM y 100 µl de agua bidestilada) y agua bidestilada para completar un volumen final de 50 µl. El ensayo constó de 35 ciclos y el siguiente protocolo: denaturación inicial a 95°C por 5 m y ciclos caracterizados por una etapa de denaturación a 95°C por 30 s, alineamiento a 55°C por 30 s y una etapa final de polimerización a 72°C por 30 s. Todos los reactivos utilizados fueron proveídos por Promega.

La técnica de PCR anidada (nested PCR) consta de 2 reacciones de PCR secuenciales, utilizando como templado para la segunda reacción, el producto obtenido de la primera PCR. Primera reacción de PCR: denaturación inicial a 95°C por 3 m y 30 ciclos caracterizados por una etapa de denaturación a 95°C por 30 s, alineamiento a 57°C por 30 s y una etapa final de polimerización a 72°C por 30 s. Finalmente una etapa de polimerización a 72°C por 5 m. La segunda reacción de PCR fue idéntica a la primera, exceptuando la etapa cíclica en que el alineamiento se realizó con una mayor estrictez, esto es a 70°C. Los partidores utilizados fueron diseñados para amplificar directamente una parte del espaciador 16-23 S de los operones ribosomales de B burgdorferi sensu stricto. Este espaciador presenta un tamaño total de 3.052 pb. Las secuencias del par de partidores para la primera reacción fueron: GGTATGTTTAGTGAGGG y GGTTAGAGCGCAGGTCTG. Este primer par de partidores amplifica un segmento de ADN de un tamaño de 1.014 pb. Los partidores utilizados para la segunda reacción fueron: CGTACTGGAAAGTGCGGCTG y GATGTTCAACTCATCCTGGTCCC. Este segundo par amplifica un segmento de 941 pb. Las mezclas para las reacciones de PCR se realizaron de acuerdo a lo descrito para las reacciones de PCR convencionales. Para la segunda PCR se utilizó como templado un volumen entre 2-5 µl de la primera PCR.

RESULTADOS

Estandarización de los ensayos de PCR anidada en garrapatas controles: La Figura 1 muestra los experimentos de PCR anidada realizados con garrapatas de la especie Ixodes ricinus infectadas (controles positivos) y no infectadas (controles negativos) con B burgdorferi sensu stricto. Los partidores utilizados corresponden a la zona espaciadora 16-23 S del operón ribosomal de B burgdorferi. Se observa claramente la amplificación de una banda de aproximadamente 1 kb sólo en las garrapatas infectadas con B burgdorferi.


Figura 1. PCR anidada con partidores para la región espaciadora 16-23 S de B burgdorferi sensu stricto de garrapatas infectadas y no infectadas. Carril 1: 5 µl estándar 100 pb Gibco BRL; Carril 2: extracto de garrapatas no infectadas; Carril 3: extracto de garrapatas infectadas.

Estudio de colonización de garrapatas silvestres: En la Figura 2 se pueden observar los ensayos realizados para detectar la presencia de B burgdorferi sensu stricto en garrapatas ixoideas silvestres recolectadas en las regiones de Valdivia y Concepción. Los extractos fueron preparados exactamente en las mismas condiciones que los extractos controles, de acuerdo a Kirstein et al, 1997. Se utilizó para tal efecto, preferentemente garrapatas no alimentadas, pues se ha reportado que la molécula de hemoglobina puede actuar como inhibidora de la enzima Taq polimerasa en los ensayos de PCR. Los partidores utilizados corresponden a la zona del espaciador 16-23 S del operón ribosomal de B burgdorferi sensu stricto.


Figura 2. PCR anidada con partidores para la región espaciadora 16-23 S de B burgdorferi sensu stricto de garrapatas ixoideas silvestres. Carril 1: 5 µl estándar 100 pb Gibco BRL; Carril 2: garrapatas infectadas; Carril 3: extracto de Ixodes stilesi aisladas de Pudú (VIII región). Carril 4: extracto de garrapatas no identificadas (zona de Valdivia); Carril 5: extracto de Ixodes sigelos (VIII región).

Con el objetivo de ampliar nuestra búsqueda y posibilitar la detección de borrelias no restringidas al grupo sensu stricto, se diseñaron partidores para regiones del gen ospA que fuesen muy conservadas entre distintas especies de dicho grupo. Esta estrategia permite detectar borrelias más distantes evolutivamente, esto es, del grupo más diverso denominado B burgdorferi sensu lato (Figura 3). Dichos partidores se utilizaron para pesquisar en las garrapatas silvestres recolectadas la presencia de dichas espiroquetas (Figura 4).



Figura 4. PCR clásica con partidores para el gen ospA de B burgdorferi sensu lato desde garrapatas ixoideas silvestres. Carril 1: 5 µl estándar 100 pb Gibco BRL; Carril 2: garrapatas infectadas; Carril 3: extracto de Ixodes stilesi aisladas de Pudú (VIII región). Carril 4: extracto de garrapatas no identificadas (zona de Valdivia); Carril 5: extracto de Ixodes sigelos (VIII región).

DISCUSIÓN

En Chile han sido descritas las siguientes especies de garrapatas duras pertecientes al género Ixodes: I ricinus, I uriae, I chilensis, I taglei, I stilessi e I sigelos15-17. También se han descrito varias especies de roedores, algunas de ellas muy estrechamente emparentadas con los descritas como reservorio de B burgdorferi en otros países (ej: Sigmodon degus y Akodon andinus)18.

Dados los antecedentes antes mencionados, la existencia de cuadros clínicos semejantes a EL en Chile y de condiciones ambientales favorables para el ciclo de vida de la espiroqueta causante de esta enfermedad, se planteó la hipótesis que garrapatas ixoideas silvestres chilenas podrían actuar como reservorios y vectores para B burgdorferi sensu stricto.

Las reacciones de PCR anidadas se diseñaron para detectar la región espaciadora 16-23 S del operón ribosomal de B burgdorferi sensu stricto. Se debe enfatizar que el par de partidores utilizado está diseñado para amplificar una zona no codificante del operón ribosomal. Esto explica su rápido cambio en el transcurso de la evolución y por lo tanto su uso para diferenciar entre especies estrechamente relacionadas o entre cepas dentro de una misma especie. Dicha es la razón por la que se han utilizado para diferenciar un amplio conjunto de cepas dentro del grupo de B burgdorferi sensu stricto19. Los resultados obtenidos con los ensayos de PCR anidada, indican que las garrapatas silvestres recolectadas no están colonizadas por B burgdorferi sensu stricto. Estos resultados no nos permiten descartar la presencia de dicha espiroqueta en garrapatas chilenas ni mucho menos en Chile (utilizando otros vectores por ejemplo), pues para eso se debería realizar una recolección de un número de especímenes mucho mayor de garrapatas y que abarcara en lo posible, una gran variedad de lugares geográficos. Una posibilidad para explicar los hallazgos clínicos mencionados y la negatividad de los resultados obtenidos por serología, era que las garrapatas silvestres pudieran estar colonizadas por otras especies del complejo B. burgdorferi sensu lato. Para ello era necesario diseñar partidores de amplio espectro, que pudieran amplificar ADN de todas las especies que conforman el complejo o al menos de varias de ellas. Para ello se decidió estudiar el gen ospA que codifica para una proteína de membrana externa de B burgdorferi y que presenta la característica de presentar un elevado número de copias, por lo que su detección presenta un grado mayor de sensibilidad. Además, ya se han secuenciado varios genes ospA de diferentes especies del grupo sensu lato lo que posibilitaba un estudio comparativo (Figura 3). Los resultados indican que las garrapatas estudiadas no presentan espiroquetas del grupo sensu lato, tales como B afzelii y B garinnii. No se puede descartar que estén colonizadas por otras especies del grupo sensu lato, sin embargo, para contrastar tal hipótesis se debería incrementar la cobertura de los partidores utilizados lo que no siempre es posible, debido a carencia de secuencias génicas para la totalidad del grupo. Dado que existen en nuestro país casos clínicos fuertemente sugerentes de EL creemos que la mejor estrategia a futuro sería realizar un estudio de PCR con partidores de amplio espectro (como los utilizados en este estudio para el gen ospA) en muestras clínicas de pacientes sospechosos de padecer EL, con el fin de demostrar directamente en los casos estudiados si alguna espiroqueta del grupo B burgdorferi sensu lato es responsable de la patología observada.

Correspondencia a: Gonzalo Osorio A. Programa de Microbiología y Micología, Facultad de Medicina, Universidad de Chile, Independencia 1027, Casilla 13898-Correo 21, Santiago, Chile. Fono: 6786145, Fono/Fax: 7355855, e-mail:gosorio@canela.med.uchile.cl.

Agradecimientos

Agradezco en primer lugar a Patricio Chandía por su esfuerzo y dedicación en la recolección de garrapatas a partir de roedores silvestres y sin cuya colaboración este trabajo no se hubiera podido realizar. También agradezco especialmente al Dr. Felipe Cabello, pues su valiosa ayuda fue fundamental para el inicio y desarrollo de este proyecto. Quiero destacar además la valiosa colaboración del Dr. Roberto Murúa (Universidad de Valdivia), Dr. M Eugenia Reyes (Universidad de Concepción), Dr. ME Casanueva (Universidad de Concepción), que participaron activamente en la recolección e identificación de las garrapatas estudiadas en este proyecto.

REFERENCIAS

1. Burgdorfer W, Barbour AG, Benach JL, Davis JP, Grunwaldt E, Hayes SF. Lyme disease-A tick borne spirochetosis? Science 1982; 216: 1317-9.        [ Links ]

2. Kantor FS. Disarming Lyme disease. Sci Am 1994; 271: 34-9.        [ Links ]

3. Barbour AG, Fish D. The biological and social phenomenon of Lyme disease. Science 1993; 260: 1610-16.        [ Links ]

4. Barahona J, Lobos T, Court J, Pfenniger A. Enfermedad de Lyme en Chile. Rev Méd Chile 1989; 117: 946-7.        [ Links ]

5. Berner E, Moncada X, Aris HE, Sazunic I. Eritema crónico migrans y enfermedad de Lyme. Rev Méd Chile 1989; 117: 1271-4.        [ Links ]

6. Guzmán L, Neira O. Lyme disease in Chile. J Rheumatol 1993; 20: 224-5.        [ Links ]

7. Neira O, Cerda C, Alvarado A, Palma S, Abumohor P, Wainstein E, et al. Enfermedad de Lyme en Chile. Estudio de prevalencia en grupos seleccionados. Rev Méd Chile 1996; 124: 537-44.        [ Links ]

8. Oliver Jr JH. Lyme borreliosis in the southern united states: A review. J Parasitol 1996; 82: 926-35.        [ Links ]

9. Van Dam AP, Kuiper H, Vos K, Widjojokusumo A, Spanjaard L, De Jongh BM, Ramselaar CP, Kramer MD, Dankert J. Different genospecies of Borrelia burgdorferi are associated with distinct clinical manifestations in Lyme borreliosis. Clin Infect Dis 1993; 17: 708-17.        [ Links ]

10. Wang G, Van Dam AP, Le Fleche A, Postic D, Peter O, Barabton G, De Boer R, Spanjaard L. Genetic and phenotypic analysis of Borrelia valaisiana sp. Nov. (Borrelia genomic groups VS116 and M19). Int J Syst Bacteriol 1997; 47: 926-32.        [ Links ]

11. Le Fleche A, Postic D, Girardet K, Peter O, Baranton G. Characterization of Borrelia lusitaniae sp.nov. by 16S ribosomal DNA sequence analysis. Int J Syst Bacteriol 1997; 47: 921-5.        [ Links ]

12. Schmidt BL. PCR in laboratory diagnosis of human Borrelia burgdorferi infections. Clin Microb Rev 1997; 10: 185-201.        [ Links ]

13. Persing DH, Telford III SR, Rys PN, Dodge DE, White TJ, Malawista SE, Spielman A. Detection of Borrelia burgdorferi DNA in museum specimens of Ixodes dammini ticks. Science 1990; 249: 1420-3.        [ Links ]

14. Kirstein F, Rijpkema S, Molkenboer M, Gray JS. Local variation in the distribution and prevalence of Borrelia burgdorferi sensu lato genomospecies in Ixodes ricinus ticks. Appl Environ Microbiol 1997; 63: 1102-6.        [ Links ]

15. Cekalovic T. Catálogo de los Arachnida: Scorpiones, Pseudoscorpiones, Opiliones, Acari, Aranea y Solifugae de la XII región de Chile, Magallanes, incluyendo la Antártica Chilena (Chile). Gayana Zoología, Editorial de la Universidad de Concepción, 1976; Nº 37.        [ Links ]

16. Tagle I. Ixodoidea en Chile. Bol Chile Parasit 1971; 26: 46-9.        [ Links ]

17. Kohls GM. Eight new species from central and South America (Acarina: Ixodidae). J Parasitol 1956; 42: 636-49.        [ Links ]

18. Mann G. Los pequeños mamíferos de Chile. Gayana Zoología, Editorial de la Universidad de Concepción, 1978; Nº 40.        [ Links ]

19. Liveris D, Wormser GP, Nowakowski J, Nadelman R, Bit’tker S, Cooper D, Varde S, Moy FH, Forseter G, Pavia CS, Schwartz I. Genetic diversity of Borrelia burgdorferi in Lyme disease patients as determined by culture versus direct PCR with clinical specimens. J Clin Microbiol 1999; 37: 565-9.        [ Links ]

Creative Commons License Todo el contenido de esta revista, excepto dónde está identificado, está bajo una Licencia Creative Commons