SciELO - Scientific Electronic Library Online

 
vol.38 número2-3Wheel-running and rest activity pattern interaction in two octodontids (Octodon degus, Octodon bridgesi) índice de autoresíndice de materiabúsqueda de artículos
Home Pagelista alfabética de revistas  

Servicios Personalizados

Revista

Articulo

Indicadores

Links relacionados

Compartir


Biological Research

versión impresa ISSN 0716-9760

Biol. Res. v.38 n.2-3 Santiago  2005

http://dx.doi.org/10.4067/S0716-97602005000200020 

XLVIII

REUNIÓN ANUAL DE LA
SOCIEDAD DE BIOLOGÍA DE CHILE

XII REUNION ANUAL DE LA
SOCIEDAD DE ECOLOGÍA DE CHILE

XXVII CONGRESO CHILENO
DE MICROBIOLOGÍA

13 al 16 de octubre 2005
Gran Hotel Pucón

 

SOCIEDADES PARTICIPANTES

Sociedad de Bioquímica de Chile

Sociedad de Microbiología de Chile

Sociedad de Ecología de Chile

Sociedad de Biología Celular de Chile

Sociedad de Farmacología de Chile

 

 

Auspiciadores

BIOAXIS

BIOSONDA S.A.

CELLYGENT S.A.

GENESYS CHILE LTDA.

GENÉTICA Y TECNOLOGÍA LTDA.

MELVIN BECERRA Y CIA. LTDA.

MERCK S.A. - CHILE

PERKIN ELMER CHILE LTDA.

SUDELAB S.A.

 

Patrocinantes

 

CONICYT

UNIVERSIDAD DE CHILE, V.I.D.

FACULTAD DE MEDICINA, UNIVERSIDAD DE CHILE

FACULTAD DE CIENCIAS, UNIVERSIDAD DE CHILE

FUNDACIÓN CHILENA PARA BIOLOGÍA CELULAR

UNIVERSIDAD DE CONCEPCIÓN

ALFABETA ARTES GRÁFICAS

 

CONFERENCIAS

CONFERENCIA INAUGURAL

ESTRUCTURA, ENSAMBLAJE Y FUNCIÓN DE LAS PROTEÍNAS DEL SISTEMA DE SECRECIÓN BACTERIANA TIPO III (Structure, assembly and function of proteins from type III bacterial secretion system) Galán J.E. Section of Microbial Pathogenesis, Yale University School of Medicine, New Haven, CT 06536, U.S.A.

Los sistemas de secreción de proteínas tipo III son esenciales para la patogenicidad o la asociación simbiótica de numerosas bacterias. La función de estas nanomáquinas es la secreción e inyección de proteínas bacterianas a la célula hospedadora. Este sistema de secreción está compuesto por un organelo localizado en la membrana bacteriana denominada complejo aguja ("needle complex"). Este organelo está compuesta por una base anclada a la membrana celular a través de 4 anillos, un cilindro central ("inner rod"), y una extensión o "aguja" que se proyecta hacia el exterior de la bacteria. Toda el organelo está atravesado por un canal central de unos 28 Å de diámetro. El ensamblaje del "complejo aguja" ocurre a través de una serie de pasos definidos cuidadosamente orquestados. En primer término se ensambla la base del "complejo aguja", la cual comienza a funcionar como un aparato de secreción exclusivamente destinado a la secreción de las proteínas necesarias para formar el "cilindro central" y la "aguja", los cuales se ensamblan separadamente. La terminación del ensamblado del cilindro central causa un cambio conformacional en la cara citoplásmica de la base del "complejo aguja" de modo que la especificidad del aparato de secreción cambia drásticamente, y tanto las proteínas que forma la aguja como el cilindro central ya no son reconocidas. Por lo tanto, el largo de la aguja está determinado por la velocidad de ensamblaje del cilindro central. El aparato de secreción es consecuentemente reprogramado para reconocer las proteínas destinadas a ser inyectadas dentro de la célula huésped.

Las proteínas destinadas a ser secretadas por este sistema poseen señales específicas en su amino terminal que las guían por el camino de secreción. El proceso de secreción está ayudado por chaperonas específicas que escoltan a las proteínas efectoras hasta el aparato de secreción. Estas chaperonas mantienen un dominio de las proteínas a secretar en forma desplegada. No obstante, los dominios de las proteínas a secretar no cubiertos por las chaperonas se mantienen plegados, por lo que deben se desplegados antes de poder ser secretados a través del canal central del aparato de secreción. La disociación de la proteína a secretar de su chaperona como así también el desplegado previo a su secreción están mediados por una ATPasa localizada perifericamente en la base del "complejo aguja". Finalmente las proteínas son "inyectadas" en la célula huésped a través de un poro formado en la membrana plasmática de la célula.

CONFERENCIA PREMIO
BIOS-CHILE-SOCIEDAD DE
BIOLOGÍA DE CHILE

MECANISMOS MOLECULARES QUE CONTROLAN EL EQUILIBRIO ENTRE INMUNIDAD Y AUTOINMUNIDAD. Kalergis A. M. Departamento de Genética Molecular y Microbiología, Facultad de Ciencias Biológicas, Pontificia Universidad Católica de Chile.

La sinapsis inmunológica entre el linfocito T y la célula dendrítica (DC) es fundamental tanto para la iniciación de la respuesta inmune contra patógenos (sinapsis activadora), como para evitar el ataque autoinmune contra componentes propios del hospedero (sinapsis inhibidora). Es así como mientras alteraciones en la sinapsis activadora aumentan la susceptibilidad a infecciones, deficiencias en la sinapsis inhibidora pueden causar respuestas autoinmunes. Para una función regulada de la sinapsis, la DC debe presentar coordinadamente dos tipos de señales moleculares al linfocito T. La señal 1 es el antígeno o complejo péptido-MHC (pMHC) que funciona como ligando específico para el receptor del linfocito T (TCR). De acuerdo a nuestros resultados la vida media de la interacción TCR:pMHC modula la activación del linfocito T (1). También lo hace la cantidad de señal 1, la que aumenta cuando la DC captura antígenos vía receptores específicos, como los receptores Fc (2). Por otro lado, la señal 2 corresponde a moléculas co-estimuladoras, cuya expresión en la DC hemos logrado aumentar mediante la señalización vía receptores Fc activadores, lo que potencia la activación del linfocito T (2,3). Estas observaciones las hemos aplicado para potenciar la respuesta inmune anti-bacteriana (2). Sin embargo, experimentos realizados en el laboratorio indican que un aumento excesivo de la expresión de la señal 1 y 2 por la DC a nivel de la sinapsis causa autoinmunidad (4). Por lo tanto, nos interesa identificar estrategias moleculares para favorecer la formación de sinapsis reguladas conducentes a respuestas inmunes eficientes contra patógenos y prevenir la autoinmunidad (5). FONDECYT 1030557 y 1050979. Núcleo Milenio en Inmunología e Inmunoterapia.
1. PA González, LJ Carreño, D. Coombs, JE Mora, E. Palmieri, B Goldstein, SG Nathenson and AM Kalergis. TCR binding kinetics required for T cell activation depend on the density of cognate ligand on the APC. Proc Natl Acad Sci U S A., 2005, 102: 4824. 2. JA. 2. Tobar, PA. González and A.M. Kalergis. Salmonella escape from antigen presentation can be overcome by targeting bacteria to Fcg Receptors on dendritic cells.`J. Immuno., 2004, 173: 4058. 3. SM Bueno, MI Iruretagoyena, JA Tobar, AM Kalergis Molecular Interactions Between Dendritic Cells and Salmonella: Escape From Adaptive Immunity and Implications on Pathogenesis. (Critical Reviews in Immunology, 2005, in press). 4. MI Iruretagoyena, M Wiesendanger and AM Kalergis. The Dendritic cell-T cell synapse as a determinant of autoimmune pathogenesis. Curr. Pharm. Des.; 2005, in press. 5. MI Iruretagoyena, JA. Tobar, PA. González, SE. Sepúlveda, CA. Figueroa, RA. Burgos, JL. Hancke and AM. Kalergis. Andrographolide interferes with T cell activation and reduces Experimental Autoimmune Encephalomyelitis in the Mouse. J. Pharm. Exp. The. 2005, 312:366.

REGULACIÓN DEL METABOLISMO DEL NITROGENO Y BIODEGRADACIÓN DE CONTAMINANTES NITROGENADOS(Regulation of Nitrogen Metabolism and Biodegradation of Nitrogenated Contaminants). Santero, E., García-González, V., Porrúa, O., Veguillas, A:, Canosa, I. & Govantes, F. Centro Andaluz de Biología del Desarrollo, Área de Microbiología, Universidad Pablo de Olavide, Sevilla, España.

La biodegradación de contaminantes orgánicos puede estar sujetas a una regulación específica, que vincula la expresión de los genes de degradación a la presencia del contaminante en el medio, y a una regulación general, por la cual la expresión génica se supedita a la ausencia de otros sustratos preferentes. La eliminación del herbicida nitrogenado atrazina por Pseudomonas sp. estirpe ADP solo se produce en condiciones de limitación de nitrógeno, lo que puede mermar la eficacia de biorremediación de suelos agrícolas con herbicidas s-triazínicos ya que estos suelos se abonan con compuestos nitrogenados.

La expresión del operón atzDEF se induce en presencia de ácido cianúrico cuando la bacteria está limitada por nitrógeno. Hemos identificado un gen regulador,`atzR, esencial para expresar el operón. La transcripción de este gen está regulada por nitrógeno y requiere el factor sigma-54 y el regulador global del metabolismo del nitrógeno NtrC, conocido en otras bacterias. La transcripción de atzDEF activada por AtzR está a su vez regulada por nitrógeno y requiere NtrC, de forma que la regulación general por nitrógeno parece controlar la síntesis del activador específico AtzR y también su función activadora. Se presentará un modelo integrado de regulación con todos los datos disponibles.

CONFERENCIA
DR. HERMAN NIEMEYER

PRIONES Y LA NUEVA BIOLOGÍA DE PROTEÍNAS (Prions and the New Biology of Proteins). Soto C. Director Mitchell Center for Research in Neurodegenerative diseases, University of Texas Medical Branch, Galveston, Texas, USA.

Los llamados priones son agentes infecciosos asociados a las encefalopatías espongiformes transmisibles, un grupo de enfermedades neurodegenerativas que afectan a seres humanos y animales. Pese a la baja incidencia de estas patologías, la aparición de una nueva enfermedad en humanos procedente de la ingestión de carne de vaca contaminada con encefalopatía espongiforme bovina, ha despertado un enorme interés público por estas enfermedades. Desde el punto de vista científico, el concepto del prion ha revolucionado la biología, debido a la vasta evidencia científica que indica que el agente infeccioso está compuesto exclusivamente por una proteína, la cual posee la capacidad sin precedentes de propagarse en ausencia de material genético. Además la proteína infecciosa (denotada PrPSc) es idéntica en secuencia a una proteína normal abundante en el cerebro, conocida como PrPC. Durante el desarrollo de la enfermedad, PrPSc es capaz de convertir a la proteína normal, PrPC, en la forma patológica. Este proceso involucra la agregación de proteínas en estructuras fibrilares de hoja beta-plegada, similares a aquellas encontradas en los depósitos de amiloide asociados a enfermedades como el mal de Alzheimer, la enfermedad de Parkinson y diabetes de tipo II, entre otras. En nuestro laboratorio hemos logrado imitar el proceso de replicación de priones in vitro, lo que nos ha permitido incrementar dramáticamente el conocimiento de los mecanismos moleculares responsables de estas enfermedades, la naturaleza del agente infeccioso y el diseño de nuevas estrategias terapéuticas y de diagnóstico.

POR LA SENDA DE DARWIN: REFLEXIONES SOBRE LA RELACIÓN ENTRE CIENCIA, ECOLOGÍA Y SOCIEDAD (On Darwin's trail: Reflections about the relation among science, ecology and society). Armesto, Juan J. CASEB, P. Universidad Católica, MCEB, Universidad de Chile, Fundación Senda Darwin.

La ciencia es un actor fundamental de la sociedad del siglo XXI. Los científicos desarrollan su trabajo en un contexto académico que está permeado por las doctrinas y modelos económicos, políticos y religiosos de cada época. Este contexto social moldea, limita y motiva nuestra visión del mundo natural, el carácter de nuestras teorías y nuestra relación con la comunidad. La teoría de evolución de Darwin se desarrolló en forma disidente al modelo social y político de mediados del siglo XIX y sus consecuencias culturales y antropológicas son aún motivo de fuerte debate en círculos académicos, educacionales y religiosos. Gran parte de los problemas ambientales que enfrentamos como sociedad en el siglo XXI derivan de nuestra limitada asimilación del significado multi-disciplinario de la evolución, incluso en ámbitos académicos, escasa comprensión de nuestros vínculos con el mundo natural y casi nula integración de la evolución biológica y la ecología en la educación de los ciudadanos. En esta presentación propongo la necesidad de desmitificación de la ciencia, incluyendo su difusión en el más amplio y diverso contexto cultural, a través de una variedad de mecanismos, y la relativización del lugar jerárquico de los científicos en la sociedad, de modo de generar un dialogo constructivo con exponentes de otras disciplinas y visiones.

DIVERSIDAD FISIOLÓGICA EN LA ENERGÉTICA ANIMAL: IMPLICANCIAS ECOLÓGICAS Y EVOLUTIVAS. Bozinovic F., CASEB y Departamento de Ecología, Facultad de Ciencias Biológicas, Pontificia Universidad Católica de Chile, Santiago, Chile

La biodiversidad se define como el rango total de variación en y entre organismos y los ambientes que los contienen, desde hábitats locales a los paisajes y la biósfera, incluyendo todos los niveles jerárquicos de organización biológica, desde los ecosistemas a los individuos y sus genomas. A nivel organísmico el área de la biodiversidad funcional se orienta al estudio de la identidad de las especies constituyentes de tipo de comunidades y ecosistemas dentro de una región y su variación fenotípica, genética y molecular dentro y entre poblaciones. En esta conferencia se intentará entender y explicar la diversidad fisiológica desde las moléculas a los organismos. Este objetivo concierne al origen de la diversidad fisiológica, las restricciones sobre ella y sus consecuencias ecológicas y evolutivas.
Pretendo identificar y explicar los factores selectivos que generan diversidad en y entre especies. Esto como uno de los objetivos centrales de la fisiología ecológica y evolutiva. Con aproximaciones evolutivas y ecológicas, discutiré los fenómenos que incluyen, contraste entre especies, diferencias poblacionales, plasticidad fisiológica y su potencial microevolutivo y analizaré las consecuencias de estos procesos frente al fenómeno de calentamiento global. Finalmente postulo que es una tarea para los fisiólogos aumentar el conocimiento de la función biológica, del valor adaptativo de las diversas funciones a los ambientes particulares y a los diferentes modos de vida de los organismos. La fisiología debiese reconocer la diversidad de los sistemas vivos además de intentar generalizaciones basadas en la selección de tipos convenientes y limitados de organismos.
Financiado por FONDAP 1501-0001 (programa 1)

 

EVOLUCIÓN DE VIBRIO PARAHAEMOLYTICUS Y LA IRRUPCIÓN DE BROTES EPIDÉMICOS EN CHILE. Espejo R. T., INTA, Universidad de Chile. respejo@inta.cl

En los últimos años han ocurrido en Chile importantes brotes de diarrea por Vibrio parahaemolyticus asociados a mariscos, a los cuales no estábamos acostumbrados. El primero ocurrió en 1998 en Antofagasta con más de 300 casos clínicos y los siguientes, en Puerto Montt, con 1600 y 3600 casos el 2004 y 2005, respectivamente. En esta presentación se analiza la evolución de las cepas clasificadas como V. parahaemolyticus y como se generan variantes con nuevas propiedades, capaces de irrumpir en nuevas locaciones generando brotes de diarrea. Posteriormente se presentan los resultados obtenidos del análisis de las cepas encontradas en Chile, tanto en casos clínicos como en mariscos. Finalmente, utilizando estos resultados se discute el origen de los brotes, la influencia de variable ambientales, los pronósticos para los próximos años y los estudios y acciones que podrían ayudar a disminuirlos o a paliar sus efectos, tanto en la salud humana como en el comercio de productos del mar.
La forma de reproducción por división binaria de las bacterias hace que las cepas sean clones. Entre las bacterias de un mismo clon se genera diversidad por cambios menores y continuos (mutaciones puntuales) o mayores y bruscos (recombinación). Los descendientes de una bacteria que haya sufrido recombinación pertenecen a un nuevo clon. La vida de V. parahaemolyticus en el mar, con menos barreras para el intercambio de genes con otras cepas de la misma o diferente especie, hace que su evolución esté fuertemente influenciada por la adquisición de nuevos genes desde otras cepas. Así parece haber surgido la cepa responsable de los brotes en Chile. Los brotes en Chile fueron causados por V. parahaemolyticus perteneciente al clon del serovar O3:K6 surgido en el Sudeste asiático alrededor de 1996. A pesar que este clon habría llegado a Chile un poco antes de 1998 ya se ha detectado variantes que parecen haber surgido durante su propagación en el mar chileno. Este clon constituye actualmente solo una pequeña fracción del total de clones de V. parahaemolyticus en los mariscos pero aun así es el responsable de más del 90% de los casos de diarrea.

 

SIMPOSIO

SIMPOSIO SOCIEDAD DE ECOLOGÍA

EL ROL DE LOS ECÓLOGOS EN LA GESTIÓN AMBIENTAL A RAÍZ DEL CASO RÍO CRUCES

Coordinador: Luis Contreras

EL ROL DE ECÓLOGOS EN GESTIÓN AMBIENTAL (Ecologists' role on environmental management). Contreras, L. Forestal Savia. ftdc.lcc@entelchile.net.

La SOCECOL, y su antecesora Sección de Ecología de la Soc Biol, fueron conformadas por personas de un ámbito científico-académico. Un dicho frecuente que refleja el espíritu de ellos, y de sus tiempos, era "el cultivo de la ciencia por la ciencia". Como reflejo de los cambios los estatutos de la SOCECOL de 1994 incluyen "toda otra iniciativa tendiente al máximo aprovechamiento de esta rama de la Ciencia en beneficio de la colectividad". Pues bien, al parecer el cambio de intereses de un ámbito científico-académico al de la gestión ambiental no ha estado exento de problemas para los ecólogos. A mi juicio, porque han tratado de tener un rol en este nuevo ámbito arrastrando consigo los intereses, paradigmas y prácticas propias de la ciencia-academia a un mundo en que ellos son distintos. Este simposio tiene por propósito presentar las percepciones que tienen distintos actores del rol que han tenido y pueden tener los ecólogos en la gestión ambiental. Ergo, el objeto de análisis o estudio en está oportunidad somos nosotros mismos. No lo es la autoridad ambiental, la empresa o tal o cual universidad. Para ello he invitado a miembros de la autoridad ambiental, de la empresa, de universidades y de centros de ecología aplicada a que nos expongan y a discutir como ellos han visto nuestro rol y desempeño y, más importantemente, como visualizan que puede serlo en el futuro.

 

LA INVESTIGACIÓN CIENTÍFICA EN EL MARCO DE GESTIÓN AMBIENTAL DE LAS EMPRESAS. Contreras, M. Centro de Ecología Aplicada Ltda. Depto. Ciencias Ecológicas, Facultad de Ciencias, Universidad de Chile.

Las empresas requieren implementar medidas destinadas a conciliar la explotación de los recursos naturales con su conservación, aun cuando constituyen un requerimiento, son la base de la sustentabilidad de los proyectos. Recursos económicos y un reducido cuestionamiento de los procedimientos científicos utilizados para abordar las diferentes temáticas ambientales, son la tónica dentro de la gestión ambiental de las empresas, sin embargo, los resultados deben ser capaces de lograr soluciones efectivas. Los ecólogos hemos pretendido transferir la investigación que se realiza al interior de las universidades hacia las empresas, donde la motivación es un atributo incuestionable del científico, limitando su responsabilidad a responder aquellas preguntas que surgen desde su visión particular. ¿Cómo podemos colaborar con la conservación de los recursos naturales, sin hacernos cargo de los temas ambientales en toda su dimensión? Para definir la temática ambiental es necesario comprender la interacción que se genera entre la naturaleza de los recursos naturales y los procesos asociados a la explotación de los mismos. En la práctica existe una capacidad limitada de transferir los resultados de la investigación a las empresas. La escasa comunicación es entendida como una manera de mantener la independencia con los intereses de las empresas. La función de los ecólogos es entender adecuadamente la naturaleza, para permitir alternativas al manejo de los recursos naturales, sobre la base de resultados científicos robustos.

 

EMPRESA Y UNIVERSIDAD: CRITERIOS PARA UNA INTERACCIÓN DE BENEFICIO MUTUO (Enterprise and university: Criteria for an interaction of mutual benefit) Correa, J., Jaksic, F., Vicuña, R. Facultad de Ciencias Biológicas, Pontifica Universidad Católica de Chile.

Una interacción más sustantiva empresa-universidad ha sido invocada por autoridades gubernamentales y universidades como parte de la solución al déficit en inversión científica en Chile. Sin embargo, esta vinculación despierta recelos cuando ocurre. Durante la ejecución de asesoría científica a una empresa, nuestra universidad ha recibido tres tipos de reparos por parte de científicos y legos: (1) Que no debemos criticar a otros colegas sin tener datos propios. (2) Que nuestra investigación, al ser pagada por la empresa, no tendría independencia. (3) Que hay conflicto de intereses, porque la empresa es benefactora de nuestra universidad (Fundación COPEC-UC). Nuestra opinión es que: (1) La primera afirmación es absurda: Si la obtención de datos propios fuera requisito para poder opinar sobre la pertinencia, validez o rigurosidad de planteamientos o conclusiones emitidas por pares, se detendría todo proceso de evaluación de proyectos, programas, promociones, tesis y publicaciones. (2) Las afirmaciones de pérdida de independencia son irresponsables: Denunciar no cuesta nada, demostrar es lo difícil. (3) A nuestro parecer, el tema más relevante es el conflicto de intereses: Deberían existir lineamientos institucionales claros antes de imponer la autocensura como código de conducta. Si las empresas van a incrementar su financiamiento de la investigación científica, las universidades debieran estar preparadas para evaluar dichos vínculos sobre una base pragmática y ética.

LA INFORMACIÓN E INVESTIGACIÓN CIENTÍFICA EN LAS DECISIONES AMBIENTALES. (Scientific research and information in environmental decision making).
Arteaga, R. Dir. Ejec. CONAMA. Chile.

No siempre la información científica ha sido considerada factor relevante en las decisiones de las autoridades políticas; sin embargo, al irrumpir con fuerza la necesidad de compatibilizar el desarrollo que el país requiere con la conservación del medio ambiente la información científica, especialmente la ecológica, debiese adquirir una mayor relevancia en la toma de decisiones por la autoridad. No obstante cabe tener presente que la investigación científica y la toma de decisiones políticas corresponden a ámbitos distintos. Por una parte la investigación científica aborda hipótesis cuyas respuestas nunca son definitivas y generalmente abre nuevas interrogantes sobre el objeto de la investigación, las que permiten postular nuevas hipótesis. Por otra parte, la toma de decisiones generalmente se debe realizar con la información disponible sin poder esperar las respuestas del proceso científico que nunca termina. Considerando estas y otras diferencias no es razonable esperar que la información científica responda todo lo que la autoridad requiere conocer de manera cierta o definitiva, ni que el investigador asuma el rol del tomador de decisiones. Sin dejar de minimizar la relevancia de información científica, se debe tener presente que esta no es el único tipo de información que el tomador de decisiones debe considerar. En este contexto cabe discutir ¿hasta dónde debe llegar el campo de acción de los científicos sin pasar al campo de acción de los tomadores de decisiones que la sociedad ha establecido?

 

PERCEPCIÓN DE EMPRESAS ARAUCO SOBRE EL ROL DE ECÓLOGOS EN LA GESTIÓN AMBIENTAL (Arauco Companies Perception on Ecologists Role on Environmental Management). Camaño, A. Empresas Arauco.

Las recientes situaciones ambientales, sociales y políticas en las cuales han estado involucradas las Empresas Arauco han evidenciado logros y fracasos. Estos últimos han constituido lecciones importantes que han cambiado profundamente nuestra percepción en cuanto a la relevancia de estos temas y sus formas de gestión. Entre ellos se encuentra: la necesidad de fortalecer el rol de la institucionalidad ambiental, de atender las situaciones a nivel de regiones, de legitimar las soluciones técnicas con las comunidades, de fijar tanto niveles como procedimientos para los seguimientos ambientales, de acrecentar la apropiación de la actividad forestal por la sociedad, etc. En este contexto los ecólogos, generalmente vinculados a universidades, pueden tener un rol importante en promover el logro de acuerdos entre las partes, más que en generar divisiones paralizantes. Como ecólogos pueden aportar de manera relevante a los tomadores de decisiones, sea la administración pública o empresas públicas o privadas. Como académicos universitarios pueden cumplir un rol crecientemente demandado por la sociedad en cuanto a promover el traspaso del conocimiento y la innovación para promover el desarrollo económico, social y ambiental del país. Hasta el momento estas demandas parecen no haber sido satisfechas y en este contexto los ecólogos no parecen tener un desempeño distintivo. En todo caso, los ecólogos/académicos deben mantener claridad respecto de su propio rol como también el de las otras partes involucradas.

SIMPOSIO SOCIEDAD DE MICROBIOLOGÍA DE CHILE

ASPECTOS MOLECULARES DE LA PATOGENICIDAD BACTERIANA: IDENTIFICACIÓN Y FUNCIÓN DE DETERMINANTES DE VIRULENCIA

Coordinador: Inés Contreras

BASES PARA LA CARACTERIZACIÓN DE LA EXPRESIÓN GÉNICA IN VIVO DE Mycobacterium tuberculosis. (Bases for characterization of Mycobacterium tuberculosis in vivo gene expression). 1Maulén, N., 1Pincheira, S., 2Zahrt, T., 1Bustamante, M., 3Acevedo, V. 1Universidad Católica de la Santísima Concepción. 2Medical College Wisconsin, Milwaukee-USA. 3Programa Control Tuberculosis; Bío-Bío.

Mycobacterium tuberculosis (Mtb), infecta 1/3 de la población mundial y provoca 3x103 muertos por Tuberculosis/aHo. Mientras aumenta el conocimiento de la respuesta inmune del hospedero frente a Mtb, escasa información se genera acerca de los factores de virulencia y patogénesis de Mtb.
Proponemos caracterizar la expresión génica in vivo de Mtb, ello debido a que solo in vivo ocurriría la expresión de los genes "clave" para el establecimiento de la infección aguda o latente en el ser humano, lo cual estaría mediado por ciertos sistemas de transducción de señales descritos en Mtb. Dicha corroboración requiere: Primero, la confirmación diagnóstica de TBC, directamente en muestras clínicas pulmonares, mediante un método propio basado en PCR de tiempo real (PI 2030/2005- DPI). Segundo, la obtención de RNA total de estas y posterior síntesis del cDNA representativo de esta condición fisiológica-TBC activa.
El método diseñado, cuya sensibilidad analítica es 10 bacilos/ml, permite la confirmación diagnóstica del complejo M. tuberculosis en 8 horas. La prueba mostró: Sensibilidad 100%; Especificidad 63%; VPPP 68%, VPPN 100% e Inhibición 0%. La detección de los genes mprB-mprA y sigA, asociados a la infección aguda-persistencia de Mtb, y función housekeeping, se realizó por RT-PCR de tiempo real en sistema LightCycler-Roche.
Financiamiento: FONDECYT 1040978 y privados.

 

VIRULENCE FACTORS IN NEISSERIA MENINGITIDIS AND THEIR POTENTIAL FOR USE AS A GROUP B VACCINE. Zollinger, W., Walter Reed Army Institute of Research, Silver Spring, Maryland, USA.

Analysis of an epidemic outbreak of Neisseria meningitidis serogroup B in Iquique Chile in the 1980's illustrates that systemic infection requires both a virulent strain and a susceptible host. Host susceptibility is thought to be mediated by lack of serum bactericidal antibodies or more rarely by a defective complement system. Not all determinants of virulence for N. meningitidis have been identified. Among the recognized virulence factors are capsule, lipooligosaccharide (LOS), pili (PilC1), and IgA1 protease. Other factors such as invasins, adhesins, and iron uptake proteins may also be required. Most of these virulence factors have been investigated as potential vaccine candidates. However, group B N. meningitidis have acquired multiple mechanisms for evading the host immune response, such as antigenic variation, phase variation, and molecular mimicry. These evasion mechanisms present significant challenges for group B vaccine development. Nevertheless, recent work with LOS, conserved surface proteins identified through genomic approaches, and multivalent outer membrane vesicle vaccines provide encouragement that a broadly protective group B vaccine is feasible. Use of native outer membrane vesicles is a promising approach for presentation of LOS and outer membrane proteins to the immune system in their natural environment and conformation.

 

EXPRESIÓN DIFERENCIAL DEL LIPOPOLISACÁRIDO: IMPLICANCIAS EN LA PATOGENICIDAD DE Salmonella enterica serovar TYPHI. (Differential expression of lypopolysaccharide: role in Salmonella enterica serovar Typhi pathogenicity). Contreras I. Facultad de Ciencias Químicas y Farmacéuticas, Universidad de Chile.

Salmonella Typhi es el agente etiológico de la fiebre tifoidea en el hombre. Una etapa clave en la infección es la invasión del epitelio intestinal, mediada por el sistema de secreción tipo III codificado en la isla de patogenicidad 1. La activación de este sistema requiere el contacto con la célula eucariótica; por esto, la primera interacción de la bacteria con las células epiteliales es crucial para gatillar la invasión. En serovar Typhi la naturaleza de esta interacción no se ha aclarado, pero participaría el lipopolisacárido (LPS). Nuestro trabajo ha investigado la regulación de la biosíntesis del LPS y su participación en etapas claves de la infección por serovar Typhi. Hemos demostrado que la expresión del polisacárido O (AgO) del LPS aumenta en condiciones de fase estacionaria y que en esta modulación participan el antiterminador transcripcional RfaH y los factores sigma de estrés RpoN y RpoS. Utilizando mutantes definidas en genes de la biosíntesis del LPS, demostramos que el AgO contribuye a la resistencia al sistema del complemento, pero no a la adherencia o invasión a células HEp-2 in vitro. En este último proceso es indispensable un residuo de glucosa terminal en la región del "core" del LPS. Defectos en el "core" no afectan la adherencia, la que sería mediada por otras adhesinas. Nuestros resultados sugieren que variaciones en la estructura del LPS le confieren a la bacteria ventajas adaptativas en distintas etapas del ciclo infectivo.
Financiamiento: Fondecyt 1040562.

 

CARACTERIZACIÓN DE LOS MECANISMOS MOLECULARES DE LA PATOGENICIDAD DE Salmonella enterica serovar Typhi. (Characterization of the molecular mechanisms of Salmonella enterica serovar Typhi pathogenicity). Mora Longa G. Laboratorio de Microbiología, Facultad de Ciencias de la Salud, Departamento de Ciencias Biológicas, Universidad Andrés Bello.

Salmonella enterica serovar Typhi, es un patógeno exclusivo del ser humano que produce una enfermedad sistémica conocida como fiebre tifoidea. Este serovar pertenece a la subespecie I de Salmonella enterica que agrupa bacterias capaces de colonizar animales de sangre caliente. Aun cuando en el ámbito genético los serovares de la subespecie I comparten sobre un 90% de identidad a nivel nucleotídico, cada uno de ellos presenta características específicas relacionadas con la sintomatología de la enfermedad que producen y la especificidad de hospedero. Por ejemplo S. Typhimurium produce tifoidea al ratón y S. Gallinarum a aves de corral. Estas diferencias se deberían principalmente a la adquisición de distintos segmentos genómicos denominados "islas de patogenicidad". Es así que las islas de patogenicidad SPI-1 y SPI-2 son indispensables para la invasión de células epiteliales y supervivencia dentro de células del sistema retículo endotelial, respectivamente. Estas islas se encuentran en todos los serovares que producen enfermedad sistémica en animales. Sin embargo, existen otras islas que se encontrarían solo en ciertos serovares que podrían explicar las diferencias observadas tanto en la especificidad de hospedero como en la persistencia que poseen estos patógenos en el animal. Conocer los mecanismos de la enfermedad nos permitiría prevenir y controlar la fiebre tifoidea. Y desde este modelo de infección se podrían exptrapolar conclusiones a otras infecciones bacterianas específicas del humano.
Financiamiento: FONDECYT 1020486

 

SISTEMAS DE SECRECIÓN TIPO IV Y V DE HELICOBACTER PYLORI COMO FACTORES DE VIRULENCIA (Type IV and type V secretion systems from Helicobacter pylori as virulence factors). Venegas, A., Palacios, J.P., Martínez P., Olmos, M., Pérez, T., Bruce, E. Pontificia Universidad Católica de Chile.

Helicobacter pylori es un patógeno humano ampliamente distribuido en la población. Su eficiente colonización y persistencia resultan de adecuado equilibrio con defensas del hospedero. Esta interacción está mediada por factores de virulencia, destacándose la citotoxina vacuolizante VacA y CagA, un efector con múltiples actividades que interfiere en la transducción de señales intracelulares del hospedero. En ambos casos las proteínas bacterianas deben alcanzar el citoplasma de células gástricas para ejercen su acción. Utilizan o son parte de sistemas de secreción de proteínas. VacA, definida como autotransportador o sistema tipo V, genera un poro en la superficie bacteriana para exportación de parte de su molécula previo procesamiento. Mediante entrecruzamiento químico y construcción de genes híbridos demostramos que el C-terminal de VacA forma un poro trimérico y permite exposición superficial de proteínas antigénicas. CagA es el efector exportado por el sistema tipo IV codificado en un islote de patogenicidad junto a otros 30 genes. La transferencia funcional de este islote a Escherichia coli sugiere que el requerimiento genético necesario para su expresión reside solo en el islote.
La completa caracterización funcional y estructural de estos agentes de virulencia permitirá entender aspectos aun no conocidos de la patogénesis causada por Helicobacter pylori.
Financiamiento: FONDECYT 1030894, FONDEF DO2I-1067.

 

SIMPOSIO SOCIEDAD DE FARMACOLOGÍA DE CHILE

FARMACODEPENDENCIA

Coordinador Iván Saavedra

FARMACODEPENDENCIA: UN PROBLEMA DE SALUD PÚBLICA (Drug-dependence: a public health problem). Saavedra, I., Programa de Farmacología Molecular y Clínica, ICBM, Facultad de Medicina, Universidad de Chile.

La farmacodependencia o adicción a drogas ilícitas (marihuana, cocaína, heroína), lícitas (anfetamina, morfina, benzodiazepinas) o sociales (tabaco, alcohol) es una enfermedad del cerebro/psiquiátrica que se ha transformado en un problema social por su alta prevalencia y por la iniciación en el consumo-abuso-dependencia cada vez a más temprana edad. Enfrentar esta patología es responsabilidad de todos los actores de la sociedad, por ello en 1990 el Gobierno de Chile creó el Consejo Nacional para el Consumo de Estupefacientes (CONACE) cuyo objetivo es prevenir, evitar y disminuir el consumo de drogas, sensibilizar e informar sobre sus efectos, fortalecer los recursos para enfrentar eficazmente el problema, integrando e implementando las políticas públicas de prevención del consumo y tráfico de sustancias ilícitas en el país a través de las diversas instituciones del Estado, promoviendo la dictación de leyes restrictivas del consumo de este tipo de sustancias. Paralelamente el MINSAL posee programas para el tratamiento del alcoholismo y tabaquismo. Con propósitos docentes, extensión e investigación, en las universidades chilenas también se han desarrollado núcleos con responsabilidad en esta materia. De allí provienen los especialistas que participarán en este simposio quienes revisarán la nomenclatura, conceptos y definiciones, se referirán a las bases neurobiológicas de la farmacodependencia, enfocándose en la anfetaminas (metanfetamina, ecstasy) y derivados del opio (morfina, heroína).

 

BASES NEUROBIOLÓGICAS DE LA ADICCIÓN A DROGAS (Neurobiological basis of drug addiction). Mora, S., Programa de Farmacología Molecular y Clínica, ICBM, Facultad de Medicina, Universidad de Chile.

La adicción a drogas es un trastorno cerebral crónico caracterizado por cambios neurobiológicos que llevan al deseo compulsivo de consumir una droga y a la pérdida del control sobre su ingesta. Existen muchas evidencias acerca de las estructuras cerebrales involucradas en los efectos reforzadores positivos y negativos de las drogas de abuso. Los elementos claves para los efectos reforzadores incluyen estructuras cerebrales como el núcleo accumbens y la amígdala, y neurotransmisores como dopamina, péptidos opioides, serotonina, GABA y glutamato. Por su parte, el síndrome de privación agudo está asociado con síntomas afectivos negativos y desregulación de sistemas de recompensa que incluyen a los mismos neurotransmisores implicados en el reforzamiento agudo, junto con una elevación del neurotransmisor del estrés, el CRF.
Aunque las diferentes drogas de abuso, tales como heroína, cocaína, nicotina, alcohol y marihuana, puedan tener acciones muy disímiles, sus propiedades reforzadoras parecen tener un denominador común: similares efectos sobre los mecanismos cerebrales de recompensa y liberación de dopamina.
El conocimiento de los sistemas neuroquímicos involucrados en la transición desde el uso moderado al consumo compulsivo de una droga podría proporcionar la base racional para el desarrollo de farmacoterapias para la adicción a drogas.
Agradecimientos: Proyecto X.8, Subprograma X, Programa CYTED

 

DEPENDENCIA DE OPIOIDES: DESDE LA CONDUCTA HASTA LA CÉLULA. (Opiate dependence: from the behavior to the cell) Sepúlveda, MJ., Laboratorio de Neuroquímica y Psicofarmacología, Departamento de Farmacología, Facultad de Ciencias Biológicas, Universidad de Concepción, Concepción.

La morfina es utilizada principalmente para el tratamiento del dolor, siendo su principal inconveniente el rápido desarrollo de tolerancia al efecto antinociceptivo y la fármacodependencia.
La transmisión glutamatérgica está directamente relacionada con este fenómeno de plasticidad neuronal. Estudios conductuales han demostrado que el uso de antagonistas del receptor de N-Metil-D-Aspartato (NMDA) y de otros fármacos antiglutamatérgicos, inhibidores de la liberación de glutamato, reducen el desarrollo de tolerancia y atenúan la intensidad del síndrome de abstinencia.
Desde el punto de vista neuroquímico se ha comprobado que la administración aguda de morfina reduce las concentraciones extracelulares de glutamato en el núcleo accumbens, efecto que no se encuentra después de un tratamiento crónico con este fármaco. La inducción de un síndrome de abstinencia con naloxona o la supresión de morfina produce un aumento considerable de este neurotransmisor en esta zona límbica, lo cual puede ser revertido con fármacos antiglutamatérgicos como acamprosato y riluzol.
A nivel celular, la administración crónica de morfina produce un aumento de la expresión de la sintasa del óxido nítrico (nNOS) y del transportador de glutamato EAAT1 en zonas límbicas, efectos que son revertidos por administración de acamprosato.
El desarrollo de fármacos orientados a la manipulación de la transmisión glutamatérgica neuronal y glial pueden ser alternativas farmacológicas para el tratamiento de la dependencia de opioides.

 

FARMACOLOGÍA Y TOXICOLOGÍA DE METANFETAMINAS (Methamphetamine's pharmacology and toxicology). Bustamante, D., Cassels B., Herrera-Marschitz M., Programa de Farmacología Molecular y Clínica, ICBM, Facultad de Medicina, Universidad de Chile.

La metanfetamina es el derivado N-metilado de la anfetamina. Mientras la anfetamina tiene algunas aplicaciones clínicas en el tratamiento de la obesidad, narcolepsia y síndrome de déficit atencional, la metanfetamina no tiene uso terapéutico y es de reconocida toxicidad, a pesar de que no existe consenso en el (los) mecanismo(s) que da(n) cuenta del daño que produce en el tejido nervioso.
La metanfetamina como droga de uso recreacional ha dado origen a algunos derivados como la metilen-dioxi-metanfetamina (MDMA, ecstasy) y para-metoxi-metanfetamina que forman parte de una familia de fármacos, conocidos genéricamente como "drogas de diseño", las cuales tienen un uso muy difundido como drogas de uso recreacional por la población juvenil asimilada a la cultura tecno-pop (rave).
El interés por conocer la toxicología de cada una de estas sustancias en particular es muy importante pues, debido a síntesis parciales o incompletas en laboratorios clandestinos, los comprimidos de ectasy suelen contener 2 o 3 compuestos diferentes de los cuales se desconocen sus propiedades farmacológicas y/o toxicológicas, lo cual hace aún más complejo su abuso.
En este trabajo se revisarán los mecanismos de toxicidad de la metanfetamina y se entregará evidencia obtenida por trabajos realizados en nuestros laboratorios, respecto de algunos de sus derivados.
Agradecimientos: FONDECYT Nº 103-0521

SIMPOSIO SOCIEDAD DE ECOLOGÍA DE CHILE

INTRODUCCIÓN E INVASIÓN DE ESPECIES EN ECOSISTEMAS CHILENOS

Coordinador: Patricio Camus

INTRODUCCIÓN E INVASIÓN DE ESPECIES EN AMBIENTES CHILENOS (Species introduction and invasion in Chilean environments). 1Camus, P.A., 2Jiménez, J. 1: Facultad de Ciencias, Universidad Católica S. Concepción, Casilla 297, Concepción, y Center for Advanced Studies in Ecology & Biodiversity; 2: Laboratorio de Ecología, Universidad de Los Lagos.

La introducción de especies en Chile tiene una larga historia, pero solo recientemente se ha comenzado a evaluar y entender la magnitud de sus impactos. El fenómeno de la introducción es complejo y heterogéneo (tanto como su ámbito normativo), y usualmente sus aspectos más evidentes y controversiales involucran en general especies exóticas y en particular aquellas definibles como invasoras. Sin embargo el impacto de aspectos muy comunes de la introducción, como el reestablecimiento y translocación de especies, es claramente poco conocido. Las introducciones marinas han sido menos estudiadas que las terrestres, aunque existen casos notorios de efectos directos e indirectos derivados de la acuicultura, así como impactos negativos sobre la acuicultura misma. Actividades como la salmonicultura son emblemáticas en ambientes marinos y lénticos, y pueden incluso modificar la diversidad y estructura espacial de la avifauna presente en estos sistemas. En contraste, el rol de factores de gran relevancia potencial como el volumen y dinámica del agua de lastre de las embarcaciones es virtualmente desconocido. En este simposio presentamos casos de estudio terrestres y marinos enfatizando procesos, mecanismos e impactos de la invasión, a fin de identificar algunos aspectos comunes y problemas de investigación prioritarios.
Agradecimientos: FONDAP 15010001-1CASEB

 

INTRODUCCIONES DE MACROALGAS: EL CASO DE CODIUM FRAGILE (CHLOROPHYTA) EN CHILE (Macroalgal introductions: the case of Codium fragile (Chlorophyta) in Chile). Neill, P.E.; Navarrete, S.A. & Correa, J.A. CASEB, Departamento de Ecología, Facultad de Ciencias Biológicas, P. Universidad Católica de Chile.

Alrededor del mundo las macroalgas han sido introducidas tanto en forma intencional (acuicultura) como en forma fortuita. Muchas de estas especies comparten características que favorecen su introducción, establecimiento e invasión. En Chile al menos 15 macroalgas son consideradas no-indígenas o cryptogénicas, sin embargo actualmente solo el alga verde Codium fragile es considerada un invasor. Originaria de Japón, esta especie fue reportada como "peste" por primera vez en 1998. En este trabajo reportamos la magnitud de la invasión en Chile y evaluamos experimentalmente sus efectos sobre la estructura y dinámica de reclutamiento de comunidades submareales locales. Actualmente C. fragile está presente en más de 25 sitios discontinuos a lo largo de Chile, con mayor abundancia en la zona norte, donde presenta un ciclo anual de cobertura y biomasa, con fuerte decremento hacia finales de verano. Experimentos de terreno demostraron que la presencia de C. fragile i) afecta negativamente la biomasa y cobertura de algas filamentosas y foliosas, y ii) afecta positivamente la abundancia de algunos invertebrados móviles. Aunque C. fragile es considerada una de las peores especies invasoras a nivel mundial, en Chile su invasión parece estar limitada a sectores cercanos a cultivos, y sus efectos sobre la biodiversidad varían estacionalment.
CONICYT-AT4040050, PEO-Scholar, IdeaWild, FONDAP 15010001-

 

PLANTAS EXÓTICAS EN CHILE CENTRAL: CAUSAS, CONSECUENCIAS Y PREDICCIONES (Exotic plant invasions in central Chile: causes, consequences and predictions). Figueroa, J.A.1,2 & Castro, S.A.1,2. 1Centro de Estudios Avanzados en Ecología y Biodiversidad. Departamento de Ecología, Pontificia Universidad Católica de Chile, Casilla 114-D, Santiago. 2ONG Entorno, Sociedad y Medio Ambiente.

Más de 3500 especies de plantas vasculares han sido introducidas en Chile intencional o involuntariamente. De estas, solo una fracción cercana al 22% se encuentra naturalizada mientras que el resto (78%) se halla en un incierto estatus poblacional. Independientemente de su condición, las especies plantas exóticas tienen el potencial de causar modificaciones sobre diversos aspectos de la diversidad biológica residente, incluyendo procesos biogeoquímicos, frecuencia e intensidad de perturbaciones y patrones de diversidad biológica bajo sus distintas manifestaciones. Tras describir los patrones distribucionales de la flora exótica en Chile central a lo largo de un gradiente urbano - rural, exploramos las causas y posibles consecuencias de la presencia de flora exótica. Finalmente, exponemos posibles líneas de investigación que podrían ser realizadas para una mayor comprensión del fenómeno de las invasiones biológicas en Chile central y en particular de las plantas vasculares.
FONDAP 15010001-1; S.A. Castro agradece financiamiento DIPUC

UNA APROXIMACIÓN MULTIESCALA A LAS INVASIONES DE PLANTAS EXÓTICAS EN ÁREAS PROTEGIDAS: DETECCIÓN DE PATRONES Y CONTRIBUCIONES A LA BIOLOGÍA DE LAS INVASIONES (A multiscale approach to alien plant invasions in protected areas: Pattern detection and insights into invasion biology).
Pauchard, A. 1Bustamante, R. 2Marticorena, A. 1Jiménez, A.1, & Cavieres, L. 1. 1Universidad de Concepción, 2Universidad de Chile.

Las invasiones de plantas exóticas son una amenaza a la conservación de la biodiversidad no solo en zonas perturbadas por el hombre, sino también en áreas naturales. Las plantas exóticas pueden invadir áreas naturales desde la matriz a través de distintas modos de dispersión. Esta presentación busca presentar los resultados de diversos estudios a múltiples escalas (desde la parcela a la región) sobre invasiones en áreas protegidas. Se intenta ilustrar los patrones de distribución de las especies exóticas y su relación con variables ambientales, bióticas y antrópicas. El área de estudio es la zona centro sur de Chile, pero se consideran ejemplos de otros lugares del mundo. Se ha encontrado que las invasiones de especies exóticas están positivamente relacionadas con el grado de perturbación, la cercanía a caminos y los tipos vegetacionales más abiertos. Por el contrario, la altitud y la latitud se correlacionan negativamente con las invasiones. La relación entre diversidad de las plantas exóticas y nativas es variable pudiendo ser positiva o negativa dependiendo del paisaje estudiado. El estudio a múltiples escalas de invasiones en áreas naturales puede ayudar a encontrar generalidades sobre los procesos de invasiones.FONDECYT 1040528

 

EL INVASOR CASTOR CANADENSIS EN EL ARCHIPIÉLAGO DE TIERRA DEL FUEGO: IMPACTOS Y MECANISMOS SUBYACENTES (Castor canadensis invasion to Tierra del Fuego Archipelago: underlying mechanisms and impacts). Wallem P.K.1*; Jones, C.G.2; Marquet, P.A.1 & Jaksic, F.M.1. 1Center for Advanced Studies in Ecology & Biodiversity, P. Universidad Católica de Chile, Santiago, Chile. 2Institute of Ecosystem Studies, Millbrook, New York 12545 USA.

La introducción de Castor canadensis en 1946 ha tenido graves consecuencias para los bosques del Archipiélago Fueguino. Esta especie se caracteriza por modificar variables ambientales mediante interacciones no tróficas. Actualmente se ha expandido por los bosques magallánicos, el matorral y estepa patagónica. El éxito de esta invasión podría explicarse por la ausencia de depredadores, que resultaría en un incremento del área impactada en comparación a su hábitat nativo. El presente trabajo describe el uso de hábitat por C. canadensis y sus impactos en el Archipiélago Fueguino. Se midieron variables edáficas y vegetacionales asociadas a tres tipos de parches: prístinos, con castoreras activas y castoreras abandonadas. Mediante transectos perpendiculares a los cuerpos de agua se caracterizó la riqueza y abundancia relativa de las especies herbáceas, la profundidad de sedimentación, humedad del suelo y cantidad de desechos leñosos presentes en cada parche. En base a los antecedentes se discute la importancia de la ausencia de depredadores como mecanismo subyacente a esta invasión, así como la naturaleza y extensión de la modificación de hábitat por Castor canadensis en Tierra del Fuego.
Agradecimientos: Conicyt 24050122, FONDAP 1501-0003, Universidad de Magallanes.

SIMPOSIO SOCIEDAD DE MICROBIOLOGÍA DE CHILE

PATÓGENOS ZOONÓTICOS

Coordinador: Heriberto Fernández

IMPORTANCIA EPIDEMIOLÓGICA DE LISTERIA MONOCYTOGENES EN LA INDUSTRIA ALIMENTARIA (Epidemiological importance of Listeria monocytogenes in the food industry). Schöbitz, R. Instituto de Ciencia y Tecnología de los Alimentos, Facultad de Ciencias Agrarias, Universidad Austral de Chile.

L. monocytogenes es un patógeno de alta peligrosidad, pero de baja incidencia que afecta particularmente a niños, ancianos, personas enfermas y mujeres embarazadas. La bacteria puede estar presente en distintas materias primas, donde el mayor riesgo lo constituyen los alimentos listos para el consumo ("Ready to Eat Food") y productos lácteos elaborados con leche cruda. Los casos de listeriosis reportados a nivel mundial son mayoritariamente debido al consumo de productos lácteos y cárnicos sin embargo, L. monocytogenes también puede encontrarse en salmón ahumado en frío y en otros productos marinos. La industria procesadora de alimentos ha tomado medidas para enfrentar el problema, mediante la aplicación de productos químicos a superficies de trabajo y equipos y un riguroso control de los tratamientos térmicos. Un problema adicional para eliminar el patógeno de una industria de alimentos es la formación de biopelículas ("biofilm") sobre diferentes superficies, lo cual dificulta su destrucción con higienizantes. Como medida preventiva a la formación de biopelículas se ha propuesto la aplicación de nisina, péptido de origen microbiano con antagonismo en contra de L. monocytogenes. La reglamentación sanitaria chilena no incluye este patógeno entre las especificaciones, en EE.UU de N.A. en cambio existe tolerancia cero en alimentos listos para el consumo, en tanto la Comunidad Europea acepta niveles de < 100 ufc /g en alimentos para poblaciones no sensibles.

CAMPYLOBACTER Y ARCOBACTER. Fernández H. Instituto de Microbiología Clínica Universidad Austral de Chile. hfernand@uach.cl Los géneros Campylobacter y Arcobacter (Familia Campylobacteraceae), agrupan varias especies zoonóticas, cuya morfología corresponde a bacilos Gram negativos curvos.

C. jejuni subsp. jejuni (C. jejuni), es la especie aislada con mayor frecuencia. Produce diarrea en todos los grupos etarios de ambos sexos, siendo más frecuente en los 2 primeros años de vida en países en vías de desarrollo. Puede cursar como un cuadro exudativo, expresando su capacidad invasora, la cual puede detectarse en cultivos celulares. En otros casos, el cuadro se manifiesta como una diarrea secretora, que estaría determinada por una enterotoxina, la cual promueve secreción acuosa aumentada en la mucosa intestinal de ratas y alteraciones morfológicas en células CHO con aumento de AMPc intracelular. También se ha demostrado la producción de diversas citotoxinas. En varios países, incluido Chile, se ha aislado cepas resistentes a eritromicina, tetraciclina, cloramfenicol, ampicilina y, más recientemente, a quinolonas, constituyendo esto último, un problema emergente.
Especies del género Arcobacter (A. cryaerophilus y A. butzleri), han sido aisladas, preferentemente de animales, alimentos de origen aviar y del medio ambiente. Es posible que A. cryaerophilus tenga capacidad invasora y enterotoxigénica. En A. butzleri ha sido demostrada capacidad de adherencia, de invasión y de citotoxigenicidad. Aun cuando son consideradas especies emergentes, no existen métodos estandarizados para su aislamiento que permitan establecer su real frecuencia de aislamiento como agentes de diarrea.
Fianciamiento: proyecto FONDECYT 1030245

SIMPOSIO SOCIEDAD DE BIOQUÍMICA Y BIOLOGÍA MOLECULAR DE CHILE

TÓPICOS ESPECIALES EN RETROVIROLOGÍA

Coordinador Marcelo López

INTEGRACIÓN RETROVIRAL: INTEGRASA DEL VIRUS DE LEUCEMIA MURINO MOLONEY (MoMuLV)

Vera, J., Gajardo, H., Henríquez, D., León, O. Programa de Virología. Facultad de Medicina. Universidad de Chile.

La integración del DNA retroviral en el DNA de la célula huésped es una etapa esencial para la replicación de los retrovirus. Esta etapa requiere de la integrasa viral, sin embargo, se ha sugerido que otras proteínas virales y celulares, participan en el proceso.
Nuestro laboratorio está interesado en el estudio de la integrasa de Moloney MuLV (MoMuLV) como modelo de integración. En este modelo se desea determinar el tipo de interacciones proteína-proteína y proteína_DNA mediados por la integrasa viral en el complejo de preintegración.
Actualmente no se dispone de información cristalográfica de la enzima por lo que para establecer zonas de contacto proteína_DNA hemos utilizado entrecruzamiento y mutagénesis sitio dirigida. Estas herramientas han permitido identificar regiones específicas de la proteína involucradas en el reconocimiento del DNA viral.
Por otra parte la integrasa de MoMuLV se ha expresado en S. cerevisiae.`En este sistema se ha demostrado que el ingreso de la integrasa al núcleo produce un fenotipo letal en cepas que poseen defectos en reparación. Este fenotipo letal es dependiente del factor de transcripción SNF5, lo que está de acuerdo con observaciones que indican que la integración se produciría en regiones en activa transcripción. Este sistema puede ayudar en la identificación de factores celulares homólogos que interactúan con la integrasa.
Financiado por proyecto Fondecyt 1040409.

RECENT ADVANCES IN THE BASIC BIOLOGY OF MOUSE MAMMARY TUMOUR VIRUS
,2Indik, S.,2,3Längle-Rouault, F., 1,2Dangerfield, J.A., 1,2Metzner, C., 1,2Rungaldier, S., 1,2 Badihi Nejad Asl, S., 1,2 Faschinger, A., 3Salmons, B., and 1,2Günzburg, W.H.1Research Institute of Virology and Biomedicine, 2Christian Doppler Laboratory for Gene Therapeutic Vector Development and 3AUSTRIANOVA Biotechnology, University of Veterinary Sciences, Vienna, Austria.

The existence of a negative trans-acting factor (Naf) in MMTV has been known for some time; however, efforts to clearly identify a role for the factor have been unsuccessful. Recently, we could show that Naf is responsible for the differential expression of at least 10 different cellular factors, some of which it seems may be linked to the reproducible down regulation of gene expression and reduced growth rates that characterise Naf positive cells.
Despite the advances made with the trans-acting Rev-like protein mechanisms of lentiviruses and the cis-acting RNA transport elements (CTEs) of beta retroviruses, little was known about the mechanisms that promote nuclear export of incompletely spliced MMTV mRNA. We have shown that HIV-1 Rev can trans-regulate expression of MMTV containing genes and also specifically interact with MMTV RNA. More recently, we have identified a novel karyophilic viral protein encoded by a multiple spliced transcript and additionally shown that export of non-spliced MMTV mRNA is dependent on the Crm1 pathway. Further, we have identified a mechanism novel to retroviruses for the expression of Env protein.
In the last few years, based mainly on highly homologous to MMTV sequences identified by PCR in tumour samples, MMTV has been increasingly implicated in human breast cancer. Using both wild-type as well as a genetically marked full length virus, we have for the first time shown that MMTV is indeed capable of infecting human cells at a level comparable to murine mammary epithelial cells. Further work is currently underway to characterise and compare integration sites in the mouse and human genomes.

Iniciación de la síntesis de proteínas en retrovirus. Rivas, A., Holzmann, C., Tapia, K., López-Lastra, M.
Laboratorio de Virología Molecular, Centro de Investigaciones Médicas, Facultad de Medicina, Pontificia Universidad Católica de Chile.

Los retrovirus se caracterizan por replicar a través de un intermediario de DNA el cual se integra en el material genético del hospedero. Una vez integrados, el provirus utiliza la maquinaria celular para transcribir y posteriormente, traducir sus mensajeros (mRNA). El mecanismo de iniciación de traducción dependiente de la estructura 5'Cap es utilizado por la mayoría de los mRNA celulares para iniciar el proceso de síntesis de proteína. Sin embargo, el mensajero viral que codifica para las proteínas estructurales Gag y Gag-Pol es capaz de reclutar la subunidad 40S ribosomal de manera independiente del extremo 5'Cap, vía un sitio interno de entrada a ribosomas, IRES. La utilización de este mecanismo alternativo para la iniciación de la síntesis de proteína permite a los retrovirus asegurar la síntesis de sus proteínas estructurales en condiciones en las cuales la síntesis de proteína Cap-dependiente está inhibida. El mecanismo por el cual el aparato traduccional del hospedero reconoce los IRES virales aun no ha sido dilucidado. En esta presentación se discutirá el mecanismo de iniciación de la síntesis de proteína en retrovirus y su implicación en el proceso de replicación viral. Además, se especulará sobre la potencialidad de desarrollar nuevas terapias antiretrovirales que utilicen como blanco la síntesis de proteína viral.
Financiamiento: Proyecto DIPUC 2005/14PI.

Intracellular formation of infectious Human Immunodeficiency virus. 1Grigorov, B., 2Arcanger, F., 2Roingeard, P., 1 Muriaux, D., 1 Darlix, J-L.
(1) LaboRetroUnité de virologie humaine INSERM-ENS #412, IFR128, ENS 46 allée d'Italie, 69 364 Lyon, France. fax 00 33 4 72 72 8080. (2) Laboratoire de Biologie Cellulaire et de Virologie, Faculté de Médecine de Tours, France.

The canonical view of the ultimate steps of HIV-1 replication is that virus assembly and budding take place at the plasma membrane of infected cells. However, recent studies revealed that these steps also occur on endosomal membranes in the interior of infected cells, such as macrophages. Thus we wanted to revisit the site of infectious HIV-1 formation in human cell lines and in infected T CD4+ cells. To address these issues, we investigated the intracellular trafficking of the major viral structural components of HIV-1, namely Gag, Env and the genomic RNA. Using an original subcellular fractionation method, as well as immuno-confocal and electron microscopy, we show that Gag, Env and the genomic RNA accumulate in Lamp3-enriched vesicles. These endosomal vesicles contain infectious HIV-1 particles. Also, while in human cell lines HIV-1 assembles and buds both in endosomes and at the plasma membrane, in infected T CD4+ lymphocytes, the process of viral assembly mostly occurs within the cell where large amounts of infectious virions accumulate in late endosomes. Thus, our results favor a general mechanism of intracellular HIV-1 formation whereby newly made Gag molecules associate with the genomic RNA in the cytosol, then viral core complexes are targeted to late endosomes together with Env, ultimately allowing virus morphogenesis before their release by exocytosis.

SIMPOSIO SOCIEDAD DE ECOLOGÍA DE CHILE

SERVICIOS ECOSISTÉMICOS DE LOS BOSQUES: DESAFÍOS PARA LA CIENCIA Y SU APLICACIÓN

Coordinador: Antonio Lara

¿EL BENTOS PROPORCIONA SERVICIOS ECOSISTÉMICOS VALORIZABLES? (¿Does benthos provide estimable ecosystems services?). Mulsow, S.Instituto de Geociencias _ Núcleo Milenio FORECOS, Universidad Austral de Chile, Valdivia sandormulsow@uach.cl

La necesidad de establecer relaciones entre biodiversidad, servicios ecosistémicos y funciones ecológicas de un determinado bioma son imperiosas para poder predecir el efecto de la pérdida de biodiversidad, y proponer planes de conservación para el mismo.
En los diferentes biomas reconocidos y definidos en nuestro planeta, las interfaces entre ecosistemas son de importancia primordial para entender su funcionamiento (flujos de energía). El bentos es una interface tan importante como la del aire y la biósfera. Más del 70 % del planeta está representado por agua y, por lo tanto, de bentos. Sin embargo poco esfuerzo ha sido dedicado a descubrir, cuantificar y definir servicios ecosistémicos proporcionados por esta interface.
En este trabajo primero se definirá el bentos y su funcionalidad desde el inicio de la primera infaunalización, la cual ocurrió en el paleozoico inferior, hace más de 700 millones de años. Se presentará el estado del arte en el estudio de esta interface, la cual ha permitido la modelación del futuro o fin (consumo/acumulación) de material (sólido o disuelto) sedimentando en esta interface. Finalmente se intentará responder a la pregunta inicial a través de ejemplos cuantitativos de servicios ecosistémicos proporcionados por esta interface en las zonas costeras del sur Chile, las cuales pueden ser aplicadas a otras partes del planeta en donde se encuentre presente una interface agua-sedimento.
Agradecimientos: Iniciativa Científica Milenio, Universidad Austral de Chile.

 

DESAFÍOS PARA COMPRENDER Y CUANTIFICAR LOS SERVICIOS ECOSISTÉMICOS DEL BOSQUE NATIVO. (Challenges to understand and to quantify forests ecosystems services). Lara, A. Núcleo Científico Forecos, Universidad Austral de Chile. antoniolara@uach.cl

Los bosques nativos de Chile proveen importantes servicios ecosistémicos a la sociedad, tales como producción de agua, conservación de suelos, recreación y otros, que son la base de actividades económicas de gran relevancia a nivel regional y nacional. Por lo tanto existe el desafío de cuantificar estos servicios y de buscar sistemas de manejo que permitan mantenerlos, a fin de contar con información que es clave para revertir su desfavorable situación de conservación.
La investigación realizada por el núcleo científico FORECOS en la zona de Valdivia indica que aquellas micro-cuencas cubiertas por bosques nativos tienen un índice de escorrentía (caudal/precipitación) de verano más de tres veces superior al de las cuencas dominadas por plantaciones de pino radiata o eucalipto. Por otra parte, se han desarrollado funciones que muestran una alta correlación de signo positivo entre la abundancia de salmonídeos en los ríos con la cobertura de bosque nativo en la zona ribereña. También hemos desarrollado modelos predictivos que explican la concentración de oxígeno disuelto en el Estuario de Reloncaví en función del caudal del Río Puelo registrado entre 5 y 8 semanas antes, información clave para la salmonicultura. Finalmente, a partir de anillos de crecimiento de Pilgerodendron uviferum y Austrocedrus chilensis se ha reconstruido el caudal del Río Puelo desde el año 1600, observándose ciclos de variación de 84 años y una fuerte tendencia a la disminución desde 1943.
Agradecimientos: Iniciativa Científica Milenio, Universidad Austral de Chile.

VALORACIÓN ECONÓMICA DE SERVICIOS ECOSISTÉMICOS DE LOS BOSQUES TEMPLADOS DE CHILE: RESULTADOS Y DESAFÍOS (Economic Valuation of Ecosystem Services in Chilean Temperate Forests: Results and Challenges). Nahuelhual, L. Instituto de Economía Agraria, Núcleo Milenio FORECOS, Universidad Austral de Chile

Los bosques templados de Chile proveen servicios ecosistémicos de importancia local y global. Entre estos se encuentran la provisión de oportunidades recreacionales y de belleza escénica, la mantención de un clima favorable, la provisión de agua para usos consuntivos y no consuntivos, la mantención de la fertilidad del suelo, y la conservación de la diversidad biológica. Ya que estos servicios no se registran en los mercados formales o no son evaluados en términos comparables a otros bienes de mercado, su valor no se refleja en las decisiones públicas y privadas respecto de la conservación o transformación de los ecosistemas boscosos. Un gran desafío en la valoración de los servicios ecosistémicos radica en poder integrar el conocimiento sobre el funcionamiento ecológico de los mismos y herramientas económicas. El entendimiento de los distintos servicios, sus interacciones, y las condiciones de sustentabilidad deben generarse de la investigación ecológica. La valoración económica, por otra parte, ofrece una forma sistemática en la cual una amplia gama de valores pueden ser asignados a tales servicios e incluidos en la discusión de política ambiental.
La investigación del núcleo científico FORECOS se centra en la cuantificación y valoración económica de los servicios ecosistémicos de los bosques de la Ecorregión Valdiviana (35ºS-48ºS), hacia el diseño de esquemas de manejo sustentables que permitan mantenerlos o aumentarlos. En este estudio se presentan resultados del valor económico de los servicios de producción de madera y productos no madereros, oportunidades de recreación, y provisión de agua para consumo humano.
Agradecimientos: Iniciativa Científica Milenio, Universidad Austral de Chile.

 

PROPUESTA DE UN MECANISMO PARA LA IMPLEMENTACIÓN DE PAGO POR SERVICIOS AMBIENTALES (PSA): CASO EXPERIMENTAL EN RELICTOS DE NOTHOFAGUS ALESSANDRI (RUIL) EXISTENTES EN LA COMUNA DE CUREPTO, VII REGIÓN DEL MAULE - CHILE. (Proposal of payment schemes for environmental services: a case study in natural forest Nothofagus alessandri (ruil), seventh region - Chile.)

Villalobos, P.(1) y Huenchuleo, C.(1)
(1)
Departamento de Economía Agraria, Universidad de Talca - pvillal@utalca.cl (2) Norte 685 Casilla 747 _ Talca _ Chile

Las inadecuadas prácticas productivas han afectado sistemáticamente los ecosistemas forestales naturales. Este es el caso del Nothofagus alessandri (Ruil), especie endémica de la Región del Maule, considerada un hotspot a nivel mundial.
La investigación realizada desde Abril 2004 hasta Enero último, tuvo por finalidad diseñar una propuesta de mecanismo para el desarrollo de un Sistema de Pagos por Servicios Ambientales (PSA), a partir de la valoración económica del relicto Ruil, presente en la comuna de Curepto.
Para ello se llevó a cabo un estudio de valoración contingente, con el propósito de determinar la disposición a pagar de los habitantes de la comuna para la creación de un Fondo de Protección Ambiental, como parte del diseño de un mecanismo de implementación de PSA. Los resultados más destacados son: 1) Existe una positiva disposición a pagar por contribuir al Fondo de Protección Ambiental, 2) Los entrevistados consideran adecuado, en su gran mayoría, tanto el mecanismo de pago como la forma de articulación social para el diseño que sustenta la gestión del mecanismo, 3) Los fondos recaudados cubren los costos de oportunidad de los agricultores oferentes de los servicios. Los principales factores que determinan una positiva disposición a pagar son: la preocupación por la pérdida del bosque nativo y el ingreso familiar mensual.

SIMPOSIO SOCIEDAD DE ECOLOGÍA DE CHILE

ABRIENDO NUEVAS FRONTERAS USANDO MÉTODOS MOLECULARES EN LA ECOLOGÍA Y EVOLUCIÓN

Organizado por: Núcleo Milenio - Centro Milenio de Ecología Avanzada y de Investigación en Biodiversidad (CMEB)

Coordinadores: Mary Kalin y Rodrigo Medel

Stochastic CHARACTER mapping of morphological TRAITS in evolutionary studies. Bollback, JP. Center for Bioinformatics, University of Copenhagen, Universitetsparken 15, Byning 10, DK-2100, Copenhagen Ø, Denmark.

Inferring ancestral histories has been an invaluable tool in evolutionary studies. The use of ancestral character histories can be found across a diverse range of biological disciplines, reaching from molecular evolution and population genetics, to inquiries in morphology, paleontology, and ecology. While the history of a character is not directly observable, we can infer these histories given information about the character states of a group of species and a phylogeny describing the species relationships. While, current statistical methods for reconstructing ancestral histories — maximum likelihood and Bayesian inference — do not suffer from the problems of the parsimony method, they, unfortunately, often still rely on parsimony to infer character state changes. A new method, Bayesian stochastic character mapping, is introduced that provides a parsimony free approach to inferring morphological ancestral histories. Unlike, other statistical approaches, stochastic character mapping provides more detailed information about character evolution — timing of changes, placement of changes, and the order of changes on the phylogeny — and easily accommodates uncertainty in the phylogeny and character model. These aspects of the method permit a wide diversity of evolutionary questions to be addressed; correlated character evolution, tests of key innovations and homoplasy, and direction and order of state changes, among others.

 

ANÁLISIS FILOGENÉTICO DE LA PREDICTIBILIDAD DE LOS SÍNDROMES DE POLINIZACIÓN EN SCHIZANTHUS (SOLANACEAE) (Phylogenetic analysis of pollination syndrome predictability in Schizanthus). Pérez F, Arroyo MTK, Medel R, & Hershkovitz M. Departamento de Ecología, Facultad de Ciencias, Universidad de Chile, Santiago, Chile.

El reconocimiento de síndromes de polinización en plantas ha sido una de las principales evidencias del papel de los polinizadores en la evolución de la morfología floral. Sin embargo, estudios ecológicos muestran que la posesión de un síndrome raramente impide la polinización por animales distintos a los esperados por éste. Nuestro objetivo fue estudiar el grado de correspondencia entre los visitantes de las flores y los síndromes de polinización presentes en Schizanthus (abejas, polillas y picaflores) y evaluar si los "desajustes" entre ellos podían ser el reflejo de restricciones filogenéticas en la evolución de los caracteres florales o de sus patrones de correlación. Basados en una filogenia molecular, reconstruimos los estados ancestrales de los caracteres florales, examinamos las trayectorias evolutivas de los síndromes y evaluamos la influencia de la filogenia en la evolución de los caracteres y de sus patrones de correlación. Observamos distintos grados de correspondencia entre los síndromes y los visitantes. Los aparentes "desajustes" no pudieron ser atribuidos a restricciones filogenéticas. Sin embargo, encontramos evidencias de la ocurrencia de estados intermedios generalistas que podían dar cuenta parcialmente de estos "desajustes".
Beca Postdoctoral del Proyecto P-02-051-F Núcleo Milenio CMEB.

 

FILOGEOGRAFÍA DE ROEDORES SIGMODONTINOS DE LOS BOSQUES RELICTOS Y TEMPLADOS DE CHILE (Phylogeography of sigmodontine rodents of the relictual and southern temperate forests of Chile). Palma RE12, Boric-Barguetto, D1, Cancino R1 & Muñoz JC1. Departamento de Ecología1 y Centro de Estudios Avanzados en Ecología y Biodiversidad2, Facultad de Ciencias Biológicas, Pontificia Universidad Católica de Chile, Santiago.

En las costas de Chile central (30-33ºS) existen bosques relictos que presentan conexiones florísticas y faunísticas con los bosques templados del sur. Estas áreas relictuales se habrían originado como consecuencia de los ciclos glaciares e interglaciares que afectaron la biota del sur de Chile durante el Pleistoceno. Se evaluaron los efectos del aislamiento en poblaciones de roedores sigmodontinos de los géneros Abrothrix y Oligoryzomys que habitan bosques relictos y templados. Usando marcadores moleculares evaluamos si las poblaciones de sigmodontinos de ambas comunidades han respondido genéticamente de manera diferente al fenómeno de aislamiento en bosques relictos. Evaluamos si existe una mayor diferenciación genética a nivel nucleotídico en especies de Abrothrix que en Oligoryzomys debido a que ambos taxa se caracterizan por una ecología diferente. Para evaluar estos objetivos secuenciamos el Dominio Hipervariable I de la región control del mtDNA en 93 especímenes de A. olivaceus y 118 de O. longicaudatus. Los datos fueron analizados filogenética y filogeográficamente. Las poblaciones de Abrothrix de los bosques relictos están estructuradas y presentan una marcada diferenciación genética con las de bosques templados, patrón que no es observable en Oligoryzomys.
FONDECYT 1030488; FONDECYT-FONDAP-CASEB; NIH-ICIDR 1 U19 AI45452-01

 

PATRONES DE DIVERSIFICACIÓN Y BIOGEOGRAFÍA EN EL GÉNERO SUDAMERICANO CHAETANTHERA (ASTERACEAE) (Patterns of diversification and biogeography in the South American genus Chaetanthera (Asteraceae)). Hershkovitz M, Arroyo MTK & Medel R. Departamento de Ciencias Ecológicas, Universidad de Chile, Santiago, Chile.

Chaetanthera Ruíz & Pav. (Asteraceae: Mutiseae) comprende 40-50 taxa distribuidos desde los Andes de Perú a Chile y Argentina, llegando a los desiertos y zona mediterránea de Chile. Se están secuenciando las regiones rDNA-ITS nuclear y los espaciadores intergénicos cloroplasmáticos ycf3-trnS y rp132-trnL para especies del género. Los datos preliminares indican que los subgéneros de altura, Egania y Oriastrum, son taxa hermanos monofiléticos. Egania presenta especies perennes distribuidas en el altiplano y en los Andes de Chile central y Argentina, mientras que Oriastrum comprende principalmente especies anuales de los Andes de Chile central y Argentina. La divergencia de estos dos subgéneros data probablemente del Mioceno y su divergencia de otros integrantes del género posiblemente del Cretácico Superior o Eoceno. Los subgéneros Tylloma y Carmelita son artificiales, pero juntos comprenden un clado de edad comparable a aquel compuesto por Egania y Oriastrum. Los subgéneros Euchaetanthera y Proselia también son polifiléticos - las relaciones entre estos últimos, y de estos con el subgénero Glandulosa, crean conflictos entre los árboles de ADN nuclear y cloroplasmático. Esto sugiere que estos taxa podrían ser el producto de una hibridización antigua. Nuestros datos indican que algunos de los taxa delineados por caracteres morfológicos son polifiléticos, demostrando el poder de la aproximación molecular.
Fondecyt 1020956; Ecos-Chile-France; ICM P02-051-F

Inferencia genética acerca de la historia demográfica de los pequeños peces pelágicos del Pacífico Este (Population genetic inference of the demographic history of small pelagic fish in the East Pacific).

Poulin E & Silva A. Departamento de Ciencias Ecológicas, Universidad de Chile, El jurel, la anchoveta y la sardina española pertenecen a los tres géneros de pequeños peces pelágicos (Trachurus, Engraulis, Sardinops) que constituyen grandes poblaciones en el Pacífico Este, tanto en el Hemisferio Norte como en el Sur. El hábitat que comparten se caracteriza por la ocurrencia recurrente de surgencias que determinan el alto nivel de productividad del sistema y explican la gran abundancia de estos recursos pesqueros. Sin embargo, esta alta productividad ha sido y está actualmente siendo afectada por eventos climáticos de diferentes escalas, tales como las provocadas por la Oscilación del Sur, Oscilación Decadal o las glaciaciones pleistocénicas, resultando en variaciones notables de los tamaños poblaciones en los diferentes componentes del ecosistema pelágico. Dado que las disminuciones drásticas en abundancia dejan huellas sobre la diversidad genética de las poblaciones, estamos comparando las señales encontradas en la variabilidad de la región Dloop del ADN mitocondrial entre especies y entre hemisferios para inferir y comparar la historia demográfica de los peces pelágicos del Pacífico Este. Se presentarán datos sobre cuellos de botella que han afectado a las especies en estudio y sus implicancias ecológicas y evolutivas.
Fondecyt 1040785, Fondap-Fondecyt 1501-0001, Corpeca S. A.

SIMPOSIO SOCIEDAD DE ECOLOGÍA DE CHILE

SOCIEDAD DE MICROBIOLOGÍA DE CHILE

ECOSISTEMAS Y MICROORGANISMOS

Coordinador: Bernardo González

PAPEL FUNCIONAL DE LOS MICROORGANISMOS EN ECOSISTEMAS TERRESTRES: PROCESOS BIOGEOQUÍMICOS EN BOSQUES DEL SUR DE CHILE (Functional role of microorganisms in terrestrial ecosystems: biogeochemical processes in southern Chilean forests) Carmona M. R.; Armesto J. J.; Guevara, R. & Pérez, C. Center for Advanced Studies in Ecology and Biodiversity (CASEB), P. Universidad Católica, y CMEB, Facultad de Ciencias, Universidad de Chile.

A nivel global se estima que el 50% del carbono biológico y el 90% del nitrógeno está contenido en organismos procariontes. Los microorganismos participan en procesos ecosistémicos claves de ecosistemas terrestres como la mineralización de materia orgánica en el suelo y el ciclaje interno de Nitrógeno (N). La disponibilidad de N combinado es limitante para la producción primaria de muchos ambientes terrestres y, recientemente, este ciclo ha sido alterado drásticamente por la producción antropogénica de N y empleo generalizado de fertilizantes. A través de investigaciones realizadas en bosques templados de la Isla de Chiloé, se ha documentado el papel funcional de los microorganismos en los flujos de N, bajo distintos grados de perturbación humana. Estos trabajos ilustran la relevancia del los microorganismos a diferentes escalas en los ecosistemas. Se discuten las consecuencias de la perturbación de los bosques en procesos microbianos del suelo y la importancia de una mirada conjunta de ecólogos y microbiólogos para abordar esta problemática.
Apoyado por el proyecto FONDAP-FONDECYT (proyecto 1501-0001, programa 3).

 

DIVERSIDAD GENÉTICA DE ENSAMBLES MICROBIANOS RELACIONADOS CON EL CICLO DEL NITRÓGENO (Genetic diversity of microbial assemblages involved in the nitrogen cycle) Carú, M.; Guevara, R; Chavez, M. & Corredor, P. Depto de Ciencias Ecológicas, Facultad de Ciencias Universidad de Chile. mcaru@codon.ciencias.uchile.cl

Los microorganismos cumplen funciones únicas en los ciclos biogeoquímicos y por lo tanto pueden ser considerados componentes claves de los ecosistemas. Sin embargo, poco se conoce sobre su diversidad genética y función en su habitat natural, debido principalmente a que la mayoría de los microorganismos son refractarios al aislamiento y cultivo. Actualmente, con el desarrollo de técnicas moleculares es posible acceder a la diversidad microbiana, utilizando biomarcadores que permiten rastrear su presencia en muestras ambientales.
El ciclo del nitrógeno comprende una serie de transformaciones de óxido/reducción, mediadas por grupos de microorganismos
que son metabólicamente diversos. Para estudiar estos grupos funcionales hemos seleccionado, como modelo de estudio, la rizósfera de plantas que establecen simbiosis con bacterias diazótrofas (actinorrícicas y rizobiales).
Los datos obtenidos indican que las poblaciones de microsimbiontes presentes en los nódulos radiculares son poco variables, pero con una importante capacidad de fijación de nitrógeno en el suelo comparada con los fijadores libres. La presencia de la planta modifica el contenido de nitrógeno disponible en el suelo y la composición de grupos muy relacionados fisiológicamente como las bacterias oxidadoras de amonio o las bacterias rizobiales o actinorrícicas dentro del ensamble de diazótrofos.
Determinar la diversidad y función de estos ensambles microbianos es relevante para comprender el papel de la microbiota en los ecosistemas.
Financiamiento Proy. FONDECYT 1040880

 

RESPUESTAS DE ENSAMBLES DE MACROALGAS E INVERTEBRADOS AL ENRIQUECIMIENTO CRÓNICO POR COBRE EN AMBIENTES COSTEROS DEL NORTE DE CHILE. (Responses of seaweed and invertebrate assemblages to chronic copper enrichments of coastal areas in northern Chile). Correa, J.A. Depto. de Ecología, y Center for Advanced Studies in Ecology and Biodiversity (CASEB). Facultad de Ciencias Biológicas. P. Universidad Católica de Chile. Santiago, Chile. jcorrea@bio.puc.cl

Perturbaciones con efectos severos y persistentes sobre la diversidad, estructura y función de los ensambles de macro-organismos bentónicos que normalmente ocurren en la zona intermareal pueden estar asociadas a eventos naturales (e.g. el Niño), o a actividades antrópicas. En este contexto, las actividades de la minería cuprífera, especialmente aquellas implementadas con anterioridad a regulaciones que atenúan su impacto sobre el entorno, son reconocidas por su efecto reductor de la riqueza de especies y cambios en las abundancias relativas de las especies que persisten. En Chile, hemos usado la zona vecina al puerto de Chañaral como modelo para estudiar las respuestas de los ensambles de algas e invertebrados intermareales a la contaminación por cobre de las aguas costeras, resultado de las descargas de residuos provenientes del complejo Potrerillos-El Salvador y que han impactado el sector por más de sesenta años. Esta presentación incluirá las respuestas de la biota de playas rocosas y de arena, enfatizando los cambios en términos del número y estrategias de vida de las especies de macro-algas que persisten en el área impactada así como la estructura comunitaria simplificada resultante. Se entregarán, además, elementos conceptuales para discutir de manera integrada los efectos del cobre sobre ensambles de macro y micro-organismos.
Apoyado por FONDAP-FONDECYT (1501-0001, programa 7), Genómica Marina CONICYT Bicentenario e International Copper Association.

RESPUESTAS DE LA COMUNIDAD MICROBIANA A PERTURBACIONES AMBIENTALES. (MICROBIAL COMMUNITY RESPONSES TO ENVIRONMENTAL PERTURBATIONS). González, B. Depto. de Genética Molecular y Microbiología, y Center for Advanced Studies in Ecology and Biodiversity (CASEB). Facultad de Ciencias Biológicas. P. Universidad Católica de Chile. Santiago, Chile. bgonzale@puc.cl

Es bien aceptado que los microorganismos cumplen múltiples funciones en el ambiente, cuyo estudio, por años, ha estado limitada por el empleo de técnicas dependientes de cultivo, las que solo permiten analizar una fracción muy pequeña de los microorganismos. El reciente desarrollo y uso de técnicas moleculares, independientes de cultivo, para estudiar la presencia y actividad de los microorganismos ha producido una verdadera explosión de información sobre la actividad de estos en el ambiente. En esta exposición se analizarán resultados recientes, obtenidos mediante estas técnicas, respecto a las respuestas de los microorganismos frente a perturbaciones ambientales. Se dará evidencia sobre la resiliencia de los microorganismos ante la presencia de un antimicrobiano excretado por una planta; los efectos en la estructura de la comunidad bacteriana frente a la presencia de distintos tipos de herbicida; la gran diversidad de genes catabólicos claves que se observa en un suelo expuesto a distintos tipos de herbicida; las respuestas de la comunidad microbiana ante la introducción de una bacteria especializada en degradar contaminantes organoclorados y los efectos del cobre en las comunidades bacterianas presentes en relaves de cobre y en el intermareal rocoso del norte de Chile. En este último ecosistema se han determinado respuestas diferentes de la comunidad microbiana en los distintos compartimentos: algas, roca, agua de mar y sedimentos.
Apoyado por el proyecto FONDECYT 1030493, FONDAP-FONDECYT (proyecto 1501-0001, programa 7), el proyecto ICA4-CT-2002-10011 (ACCESS) de la Comunidad Europea, el proyecto Genómica Marina-CONICYT, y FUNDACION ANDES, proyecto C-13851.

 

TALLER DE BIOÉTICA: FUENTES DE FINANCIAMIENTO DE LA INVESTIGACIÓN Y LOS EVENTUALES CONFLICTOS DE INTERÉS

Coordinador: M. Santos

Damian Campos1; Manuel Santos2,5; Tito Ureta3,5; Carlos Valenzuela4,5; 1Fundación Chilectra Activa, Santiago, Chile; 2Facultad de Ciencias Biológicas, Pontificia Universidad Católica de Chile; 3Facultad de Ciencias, Universidad de Chile; 4Facultad de Medicina, Universidad de Chile; 5Comité de Ética y Bioética, Sociedad de Biología de Chile.

Los eventuales conflictos de interés derivados del legítimo financiamiento estatal o privado de la investigación en el ámbito científico biológico y biomédico han suscitado controversias en diferentes países por las connotaciones éticas derivadas de ellos. En Chile la comunidad científica se ve, cada vez más involucrada en estos conflictos, especialmente en los que atañen al ecosistema y a la investigación en seres humanos y animales. Casos particulares han tenido un gran impacto mediático no solo a nivel de la comunidad científica, sino que a nivel de toda sociedad. Las repercusiones éticas de estas situaciones son muy importantes, por lo que la Sociedad de Biología de Chile ha optado por realizar un debate abierto sobre el tema.
En este taller se debatirá acerca de las implicancias éticas que suscita los eventuales conflictos de interés derivados de financiamiento privado de investigación científica biológica y biomédica en Chile. Conoceremos la visión desde el mundo privado y público. Y conoceremos acerca de los primeros intentos por regular esta situación por parte de alguna sociedades científicadas o colegios profesionales chilenos.

INCORPORACIONES

 

INCORPORACIONES I

EVIDENCE FOR A FUNCTIONAL QUORUM SENSING TYPE AI-1 SYSTEM IN THE EXTREMOPHILIC BACTERIUM ACIDITHIOBACILLUS FERROOXIDANS. Carolina Farah1, Mario Vera1, Danièle Morin2, Dominique Haras2, Carlos A. Jerez1 and Guiliani, N.1 1, Laboratorio de Microbiología Molecular y Biotecnología, Facultad de Ciencias, Universidad de Chile; 2, Laboratoire de Biologie et Chimie Marines (EA 3884), Université de Bretagne-Sud, Lorient, France.

Acidithiobacillus ferrooxidans is one of the main acidophilic chemolithotrophic bacteria involved in the bioleaching of metal sulfide ores. The bacterium-mineral interaction requires the development of biofilms whose formation is regulated in many microorganisms by quorum sensing of type AI-1. Here, we report the existence and characterization of a functional type AI-1 quorum sensing system in A. ferrooxidans. This microorganism produced mainly acyl-homoserine lactones (AHL) with medium and large acyl-chains and different C3 substitutions: 3-hydroxy-C8-AHL, 3-hydroxy-C10-AHL, C12-AHL, 3-oxo-C12-AHL, 3-hydroxy-C12-AHL, C14-AHL, 3-oxo-C14-AHL, 3-hydroxy-C14-AHL and 3-hydroxy-C16-AHL. A quorum sensing genetic locus including two open reading frames, afeI and afeR with opposite orientations and coding for proteins with high similarities to members of the acyl-synthase (I) and transcriptional regulator (R) protein families, respectively, was identified. Overexpression of AfeI in E. coli and the associated synthesis of AHLs confirmed it as an AHL synthase. As determined by RT-PCR, afeI and afeR genes were transcribed in A. ferrooxidans. The transcription levels of afeI gene were higher in cells grown in sulfur and thiosulfate media than in iron-grown cells. Phosphate starvation induced an increase of the transcription levels of afeI which correlated with an increase in AHL levels. Two afe boxes which could correspond to the AfeR binding sites were identified upstream of the afeI gene. This is the first report of a functional quorum sensing type AI-1 system in an acidophilic chemolithotrophic microorganism and it opens a very interesting opportunity to explore the control and regulation of biofilm formation during the bioleaching process.
Financiamiento: Proyectos FONDECYT 1040676; Fundación Andes; DID I-02/4-2.

 

OPERÓN TIPO-COP: ESTRUCTURA Y ORGANIZACIÓN EN ESPECIES DEL ORDEN Lactobacillale. (Cop-like operon: Structure and organization in species of the Lactobacillale order). Reyes A*#. Retdland.N#, Figueroa.G*, González.M#. *Laboratorio de microbiología, #Laboratorio de Expresión Génica y Bioinformática, INTA-Universidad de Chile.

En procariontes, el operón cop de Enterococcus hirae constituye el mecanismo de homeostasis de Cu mejor caracterizado. Sin embargo el contexto genómico del operón es desconocido. En este trabajo se rastreó el operón cop en bacterias con genoma anotado, con al menos 2 ortologos (>40% identidad) del operón separados por menos de 50 bp. Las ocho especies que mejor satisfacen estos criterios, corresponden a 14 cepas del orden Lactobacillale. Todas contenían el regulador transcripcional (CopY), su sitio de unión en la región promotora del operón y una ATPasa transportadora de Cu (CopA). Esto sugiere que el operón cop proviene de un ancestro común y que su función es conservada en las especies del orden. Este estudio describe la estructura y organización del operón cop y discute una hipótesis filogenética basada en las diferencias observadas en la organización del operón y su regulación. Además, considerando que, E. faecalis es la especie filogenéticamente más cercana a E. hirae, fue elegida para evaluar qué otros elementos codificados en el genoma complementan la función del operón cop. Utilizando un algoritmo de búsqueda basado en (PHI-Blast/Blastp) hemos identificado otras 9 proteínas candidatas a participar en la homeostasis de Cu en esta especie. Las curvas de proliferación y la respuesta a concentraciones crecientes de CuSO4 de E. faecalis y E. hirae, son similares, donde el tiempo de generación fue de 32min y la CMI-Cu de 2mM. La toxicidad por Cu fue mediada principalmente por Cu(I).
Fondecyt Nº 1030618

IMPORTACIÓN COOPERATIVA DE LA MICROCINA E492 POR LOS RECEPTORES FEPA, FIU Y CIR Y SU INHIBICIÓN POR EL SIDEROFORO ENTEROQUELINA Y SUS PRODUCTOS DE HIDRÓLISIS DIMÉRICOS Y TRIMÉRICOS. (Cooperative uptake of microcin E492 by receptors FepA, Fiu and Cir and inhibition by the siderophore enterochelin and its dimeric and trimeric hydrolisis products). Strahsburger, E., Lagos, R. Universidad Nacional Andrés Bello, Universidad de Chile.

La microcina E492 es una bacteriocina formadora de poro producida por Klebsiella pneumoniae RYC492. La microcina utiliza las proteínas de membrana externa FepA, Fiu y Cir, los cuales son receptores de la forma férrica de enteroquelina y de sus productos de hidrólisis en su forma monomérica, dimérica y trimérica lineal. Esta vía depende del sistema transductor de energía TonB, el cual estimula la apertura de los receptores permitiendo el paso de la enteroquelina férrica a través del canal. La enteroquelina es un antagonista de la actividad de la microcina E492, mientras que su forma férrica no tiene dicha actividad. Nuestro objetivo fue determinar la contribución de estos tres receptores en la importación de microcina E492 y la posible actividad antagonista de los productos de hidrólisis de la enteroquelina. El presente trabajo muestra una importación cooperativa por estos tres receptores, siendo FepA el principal receptor, seguido por los receptores Fiu y Cir. Ninguna interacción TonB-receptor fue necesaria para que la microcina E492 ejerciera su acción a nivel de la membrana citoplasmática. Además se identificó a la forma dimérica y trimérica lineal como antagonistas de la microcina E492.

 

La proteÍna de inmunidad MceB ejerce su acción protectora contra la microcina E492 por medio de una interacciÓn con TonB.(The immunity mechanism of MceB against microcin E492 involves an interaction with TonB). Baeza, M1., Monasterio O.2 y Lagos R.2. 1, Depto. de Cs. Ecológicas y 2, Depto. de Biología. - Fac. de Ciencias, Universidad de Chile.

La microcina E492 ejerce su acción bactericida mediante la formación de canales iónicos en la membrana interna de bacterias de la familia Enterobacteriaceae. Para alcanzar su blanco de acción requiere de TonB, una proteína periplasmática anclada a la membrana interna y que interacciona con proteínas de la membrana externa para importe de nutrientes en bacterias gram negativas. Las células productoras de microcina se protegen de su efecto tóxico mediante la síntesis de la proteína integral de membrana MceB (inmunidad). En este trabajo se estudió el mecanismo de acción de MceB y su posible interacción con TonB, mediante experimentos genéticos de compensación de mutaciones puntuales. Por medio de mutagénesis al azar se obtuvieron mutantes puntuales de MceB que pierden su acción protectora (imm-) y posteriormente mediante la misma metodología se buscaron mutantes de TonB que compensaran este fenotipo imm-. La caracterización molecular reveló que cambios puntuales y conservados (AÆV) en las hélices transmembrana I o III de MceB reducen fuertemente su acción protectora. Por otro lado, se encontraron dos tipos de mutantes compensatorias en tonB, que llevarían a la síntesis de proteínas truncas y otra que tendría el cambio puntual TonBS16L. Estas mutantes son sensibles a la microcina E492, pero presentarían deficiencias en su interacción normal con proteínas de membrana interna y/o externa. Nuestros resultados nos permiten concluir que solo la región N-terminal de TonB es necesaria para la acción de la microcina E492 y que MceB cumple su acción protectora mediante una interacción con la región transmembrana de TonB.
Financiado por Proyecto FONDECYT 2990028 y 1020757.

 

INCORPORACIONES II

MORFOMETRÍA TRADICIONAL Y GEOMÉTRICA EN LAS CONCHAS DE UN CARACOL INTERMAREAL (Traditional and geometric morphometrics on the intertidal snail shells) Sepúlveda, R.D.1, Ibáñez, C.M.2, Moreno, R.A.3 & Gallardo, C.A.1
1
Universidad Austral de Chile. Valdivia. rogersepulveda@uach.cl 2Universidad Católica de Concepción; 3Pontificia Universidad Católica de Chile.

Acanthina monodon es un gastrópodo intermareal que presenta gran polimorfismo en sus conchas, variando en forma, color y grosor. Su distribución abarca desde Coquimbo al Cabo de Hornos en la costa de Chile. El objetivo del presente trabajo fue determinar la variabilidad morfológica de las conchas en un gradiente latitudinal, a partir de dos aproximaciones: morfometría tradicional (AT) y geométrica (AG). Los ejemplares fueron recolectados en 13 localidades entre las latitudes 30º y 54ºS. El AT fue realizado en 392 ejemplares con cinco variables estandarizadas por la longitud peristomial. El AG fue realizado en 195 fotografías de conchas con el programa TPS. Diez hitos homólogos fueron digitalizados sobre cada fotografía. Ambos análisis mostraron resultados similares: en el AT, altura de espira y grosor de labio fueron las variables más importantes en determinar la variabilidad morfológica, mientras que el AG lo fueron los hitos relacionados al canal sifonal y grosor del labio. Las dos aproximaciones mostraron una zona de mezcla (ca. 41ºS) de morfotipos de conchas del sur y norte a esta latitud. Se propone que la variación de las conchas entre poblaciones es causada por un mecanismo de acción conjunta entre factores físicos y biológicos, que actúan a diferentes escalas, produciendo eco-fenotipos adaptados a condiciones locales muy particulares.

 

¿ingenieros ecosistémicos que comparten características comunes tienen efectos generalizados o idiosincrásicos sobre la diversidad de especies? (Do ecosystem engineers sharing common features have generalized or idiosyncratic effects on species diversity?) Badano, E.I, & Cavieres, L.A. ECOBIOSIS, Departamento de Botánica, Facultad de Ciencias Naturales y Oceanográficas, U. de Concepción.

Los ingenieros ecosistémicos (especies que crean o destruyen hábitat) pueden alterar la riqueza y la equidad de especies en las comunidades, pero aun no se ha evaluado si estos efectos repercuten en la diversidad de especies o si constituyen un fenómeno generalizado entre especies ingenieras que comparten características comunes. Este estudio evalúa los efectos de ocho especies de plantas en cojín sobre la riqueza, diversidad y equidad de plantas vasculares en cuatro sitios alto-andinos. Se propuso que los cojines poseen efectos generalizados si todas las especies controlan la diversidad mediante sus efectos sobre la riqueza, la equidad o ambas. En cambio, sus efectos serían idiosincrásicos si algunas especies controlan la diversidad mediante sus efectos sobre la riqueza mientras otras lo hacen alterando la equidad. Los resultados indicaron que los cojines incrementan la riqueza, la diversidad (índice de Shannon-Wiener) y la equidad de especies en todos los sitios; también indicaron que diferentes especies en cojín presentes en un mismo sitio controlan la diversidad de manera similar, pero cojines de diferentes sitios lo hacen de manera distinta. Esto sugiere que los efectos de las plantas en cojín sobre la diversidad son generalizados dentro de un mismo sitio, pero idiosincrásicos entre sitios.
FONDECYT 1030821

 

INSPECCIÓN VISUAL DE DEPREDADORES EN EL PEZ INTERMAREAL Auchenionchus microcirrhis. LA VISIÓN Y EL TAMAÑO CORPORAL COMO FACTORES MODULARES DE LA CONDUCTA. Visual inspection of predators in the intertidal fish Aucheninchus microcirrhis. The vision and the body size as regulating factors of behaviour. Rojas J. M B & Ojeda F. P. Centro de Estudios Avanzados en Ecología y Biodiversidad, Facultad de Ciencias Biológicas, Pontificia Universidad Católica de Chile. Casilla 114-D, Santiago, Chile. jmrojas@bio.puc.cl

En un importante número de especies dulceacuícolas se ha descrito la ocurrencia de una aproximación de los peces presas a sus depredadores piscívoros como una estrategia de evaluación visual del riesgo de depredación. En peces marinos esta conducta no ha sido descrita. Observaciones preliminares en el pez intermareal Aucheninchus microcirrhis muestran un patrón conductual similar al descrito en especies dulceacuícolas. Para esta especie ha sido señalada una sensibilidad fótica espectral entre los 350 a los 530 nm (UV- verde). Si consideramos sobre estos antecedentes que las características hidrodinámicas del sistema intermareal rocoso condicionan un ambiente lumínico inestable, con una preponderancia del rango espectral entre los 510 a 580 nm (verde-amarillo), y la ocurrencia en peces de una correlación positiva entre la capacidad resolutiva del ojo y el tamaño corporal, podríamos establecer un escenario visualmente complejo para la evaluación del riesgo de depredación por piscivoría. En este trabajo se realizaron estudios de laboratorio bajo condiciones lumínicas controladas, con el objetivo de documentar y describir la conducta de inspección visual de depredadores en A. microcirrhis, y los elementos involucrados en la modulación de las decisiones ligadas a su despliegue. Los resultados señalan que individuos de pequeño tamaño corporal se conducirían con mayor cautela que los de mayor tamaño en condiciones fóticas óptimas durante un evento de inspección. Situación"opuesta fue registrada bajo condiciones lumínicas adversas, probablemente asociadas a una mayor capacidad resolutiva. No obstante, todos los individuos invirtieron un tiempo significativamente mayor en inspección bajo esta última condición ambiental. Estos resultados, aparentemente están relacionados con un compromiso entre el riesgo de depredación durante la inspección y la calidad de la información a adquirir, donde el riesgo de depredación estaría definido por la susceptibilidad a la depredación asociada con el tamaño corporal del individuo.

INCORPORACIONES III

RECONSTRUCCIÓN DE PROTEÍNAS ANCESTRALES: APLICACIÓN EN PROTEÍNAS FLUORESCENTES DE CORALES. (Reconstruction of ancestral proteins: Application in coral fluorescent proteins). Ugalde J.A.1, Chang, B.S.W2, Matz, M.V.3 1.Laboratorio de Bioinformática y Matemática del Genoma, CMM-Universidad de Chile. 2.Whitney Laboratory, University of Florida. 3.Department of Zoology, University of Toronto.
Socio Patrocinante: Dr. Tito Ureta

Los homólogos de la proteína fluorescente verde (GFP) representan un tipo particular de pigmentos en donde el color esta determinado exclusivamente por la secuencia aminoacídica de la proteína y los grupos catalíticos para la biosíntesis del`cromóforo son parte de la misma. Para la formación de un cromóforo verde se requieren dos etapas autocatalíticas, mientras que el rojo requiere de tres etapas, indicando un mayor grado de complejidad de este último. Análisis filogenéticos de estas proteínas evidencian múltiples eventos de aparición del color rojo en la historia evolutiva, sugiriendo una evolución convergente de la complejidad a nivel molecular. Una hipótesis alternativa, que es apoyada por resultados de mutagénesis en estas proteínas, sería un único origen para la forma roja, y en donde la forma verde surge posteriormente a través de un proceso "degenerativo". Para estudiar este proceso evolutivo, a partir de secuencias provenientes de Montastraea cavernosa ("coral gran estrella"), se infirieron las secuencias de las proteínas ancestrales para un grupo de estas proteínas. Estas se sintetizaron, y se midieron sus propiedades espectroscópicas, reconstruyendo de esta forma el camino evolutivo de la diversificación del color, demostrando que ocurre desde una forma menos compleja (verde), hacia una forma más compleja (roja) a través de pasos intermedios en los cuales ambos colores se encuentran presentes.
NIH R01-GM66243, Grass Foundation (Latin American Exchange Program).

Teoría cinética para enzimas de vías de señalamiento lipídico en membranas con reordenamiento de sustrato. (Kinetic Theory for Enzymes of Lipid Signaling Pathways in Membranes with Substrate Reordering) Salinas, D.1; De La Fuente, M.2; Reyes, J.3
1
Facultad de Ciencias de la Salud, Universidad Diego Portales; 2Instituto de Ciencias Biomédicas, Facultad de Medicina, Universidad de Chile; 3Instituto de Química, Pontificia Universidad Católica de Valparaíso.

Se conocen numerosos experimentos en los cuales la adición de algunas moléculas permite reagrupar los fosfolípidos de membrana. Esta reagrupación puede alterar la actividad de aquellas enzimas que actúan sobre dichos fosfolípidos, tal como la PLC, implicada en una de las principales vías de señalamiento lipídico. Hasta ahora, las interpretaciones de estos resultados habían sido, en muchos casos, contradictorias. Para explicar estos resultados, este trabajo presenta una generalización de la teoría cinética de enzimas lipolíticas actuando en membranas con distribución homogénea del sustrato fosfolipídico a aquellos casos en los que dicho sustrato se ha reordenado en dominios. Las derivaciones de esta teoría permiten explicar los aspectos cualitativos de los efectos de la inducción de dominios fosfolipídicos en la actividad de enzimas lipolíticas. Además, se sugiere cómo el uso de esta teoría facilitaría la investigación de los distintos modelos cinéticos de las enzimas lipolíticas (Proyectos FONDECYT 2990111 y Fondecyt 1000691).

 

Regulación de la Expresión de Rutas de Degradación en Pseudomonas. (Regulation of catabolic pathway in Pseudomonas) Dinamarca, M.,A.1,2, Rojo, F.2. 1 Laboratorio de Biotecnología Microbiana, Facultad de Farmacia, Universidad de Valparaíso, Chile. Avenida Gran Bretaña 1093, Valparaíso. 2 Departamento de Biotecnología Microbiana, Centro Nacional de Biotecnología, CSIC, Madrid, España.
e-mail autor: alejandro.dinamarca@uv.cl
Patrocinio: Dr. Michael Seeger Pfeiffer.

El género Pseudomonas se caracteriza por tener una gran versatilidad metabólica en la que se destaca su capacidad de usar como sustratos de crecimiento compuestos xenobióticos. No obstante, muchas especies de este género cuando se ven expuestas a una mezcla de fuentes de carbono, asimilan de manera jerarquizada los diferentes compuestos, sometiendo a represión la ruta de degradación del sustrato no preferido. Actualmente, este mecanismo es conocido como "Control Fisiológico" y modula la expresión génica de diferentes rutas catabólicas, conectando su expresión a la fisiología y ecología del microorganismo (1). Entre los elementos que participan en la regulación por control fisiológico están: factores de transcripción (sN, sS, sH), reguladores globales (Crc, Ftsh) y sistemas generadores de señales metabólicas (Cyo ubiquinol oxidasa). Por su parte, entre las señales involucradas están: represión catabólica, carencia de nutrientes y velocidad y fase de crecimiento microbiano. Entre las rutas conocidas que integran este tipo de mecanismo está la ruta alk de Pseudomonas putida GP01. Finalmente, la regulación por control fisiológico permite además comprender rutas de degradación, nuevas y poco estudias, que asimilan compuestos de reciente aparición en la naturaleza.
1. Rojo, F., and M. A. Dinamarca. 2004. Catabolite Repression and Physiological Control, Vol II. Virulence and Gene Regulation. Kluwer Academic Publishers, New York.
Financiamiento: BIO2000-0939 y AGL2001-1423. Ministerio Español de Ciencia y Tecnología. OLK3-CT2000-0170 Comisión Europea. MAD AECI, CONICYT-BID. FONDECYT 3050052.

 

UN VECTOR ADENOVIRAL PORTADOR DE UN GEN ANTISENTIDO CONTRA LA DESHIDROGENASA ALDEHÍDICA MITOCONDRIAL INVOCA EL FENOTIPO NO BEBEDOR DE ASIÁTICOS (Adenoviral vector carrying a mitochondrial aldehyde dehydrogenase antisense gene mimicks the Asian non-drinking phenotype) Karahanian, E.1; Ocaranza, P.2; Israel Y.2 1Facultad de Ciencias de la Salud, Universidad Diego Portales y 2Laboratorio de Farmacoterapia Génica, Facultad de Ciencias Químicas y Farmacéuticas, Universidad de Chile.

Los individuos de origen asiático que poseen una mutación inactivante en el gen de la aldehído deshidrogenasa mitocondrial (ALDH2) poseen una capacidad reducida para metabolizar acetaldehído un metabolito del etanol. Esta deficiencia produce un aumento en los niveles de acetaldehído sanguíneo cuando los sujetos beben alcohol, lo que produce una aversión a su consumo y a una marcada protección contra el alcoholismo. El objetivo de nuestros estudios es imitar este fenotipo de baja actividad ALDH2 y altos niveles de acetaldehído mediante la inhibición de la expresión del gen ALDH2 in vitro e in vivo. Para ello, construimos un adenovirus recombinante portador de un gen antisentido contra ALDH2. En estudios in vitro, la administración de este vector adenoviral a células de hepatoma de rata produjo una disminución de 65 % en la actividad ALDH2 y un notable aumento en los niveles de acetaldehído acumulado cuando estas células metabolizan etanol. En estudios in vivo _ver trabajo de Ocaranza y col. en este Congreso- se administraron los adenovirus portadores del gen antisentido a ratas bebedoras UChB (Facultad de Medicina, Univ. de Chile). Se observó una importante disminución en el consumo de alcohol, inhibición que fue duradera.
Financiamiento FONDECYT 1040555.

INCORPORACIONES IV

PHYLOGENETIC INFERENCES ON CABERNET SAUVIGNON GEOGRAPHICAL DISPERSAL TRACED WITH POLYMORPHIC MICROSATELLITE LOCI. Inferencias filogenéticas de la dispersion geográfica del cv. Cabernet Sauvignon obtenidas a partir de loci polimórficos de microsatélites. Moncada,a X.c, Frédérique Pelsyb, Didier Merdinoglub, Patricio Hinrichsena*
a
Laboratorio de Biotecnología, Centro de Investigación La Platina, Instituto de Investigaciones Agropecuarias, INIA, Chile. PO Box 439-3, Santiago, Chile bLaboratoire de Génétique et d'Amélioration des Plantes, Institut National de la Recherche Agronomique, INRA-Colmar, France. BP 507, 28 rue de Herrlisheim, F-68021, Colmar Cedex, France. cPresent Address: Centro de Estudios Avanzados en Zonas Áridas, Universidad de La Serena, Benavente 980, Casilla 599, La Serena, Chile.

Genetic diversity of the grapevine cv. Cabernet Sauvignon (Vitis vinifera L.) was analyzed using 84 microsatellite markers. Fifty nine clonal samples obtained from seven countries (Chile, France, Spain, Australia, Hungary, USA and Italy) were considered in order to detect the distribution and amount of accumulated somatic mutations. The presence of chimeric clones was evidenced by the comparison of triallelic loci with the reference genotype obtained at each locus by simultaneous microsatellite analysis of the parents Cabernet franc and Sauvignon blanc. A segregation analysis of descendants by self-pollination of a Chilean clone showed a mutation in the L2 cell layer for the polymorphic locus VMC5g7. Eighteen polymorphic microsatellite loci (21.4%) were detected, but because most of them were unique to one or a few genotypes (except VMC5g7 and VMC9a2-1), a genetic similarity of over 98% was estimated finding 22 different genotypes in the population analyzed. Only two clones (obtained from France and Australia) showed the ancestral genotype and the most divergent one was shown by a French clone, with five somatic mutation events. Both antecedents enabled the tracing of geographical dispersal with a phylogenetic proposal supporting France as the center of origin of diversification and dispersal of Cabernet Sauvignon.

 

SISTEMÁTICA MOLECULAR Y FILOGEOGRAFÍA DE CAMÉLIDOS SUDAMERICANOS: IMPLICANCIAS PARA SU CONSERVACIÓN Y MANEJO. Marín, J.C.1-4, Spotorno, A.1, Gonzalez, B.2, Bonacic, C.2, Wheeler, J.3, Poulin, E.4 y Palma, E.5, 1Programa de Genética Humana, ICBM, Universidad de Chile., 2Facultad de Agronomía, PUC, 3CONOPA, 4Laboratorio de Ecología Molecular, Facultad de Ciencias, Universidad de Chile, 5Departamento de Ecología, PUC.

Las vicuñas y los guanacos son los herbívoros nativos silvestres más importantes de América del Sur y los ungulados dominantes en una fauna rica en roedores pero pobre en grandes mamíferos. Conocer su historia evolutiva, así como el proceso de domesticación del que fueron objeto, no es solo importante para el grupo, sino útil para comprender el proceso histórico por el cual atravesó la fauna que llegó a Sudamérica durante el gran intercambio.
Con el uso de la secuencia completa del gen para citocromo b y la secuencia parcial de la Región Control del DNA mitocondrial, evaluamos las relaciones de parentesco de la Familia Camelidae, la filogeografía y diferenciación subespecífica de guanacos y vicuñas.
Los análisis filogenéticos realizados mostraron que Vicugna vicugna es taxon hermano de Lama guanicoe siendo ambos grupos recíprocamente monofiléticos. El análisis de las secuencias de ambos genes mostró dos clados entre las vicuñas. Sin embargo, los resultados obtenidos del análisis de poblaciones de guanacos no reflejó las cuatro subespecies propuestas, aunque se detectó la diferenciación de las poblaciones de L. g. cacsilensis respecto del resto de los guanacos.
Beca de Apoyo a Tesis Doctoral, CONICYT y Proyecto Post-Doctoral FONDECYT Nº 3050046.

 

Correlaciones fisiológicas de la desaparición de una población del cisne de cuello negro (Cygnus melanocoryphus) en un área prioritaria para la conservación. (Physiological correlates of a population crash of the black_necked swan (Cygnus melanocoryphus) in a conservation priority area) 1Artacho, P., 1Castañeda L.E., 2Soto-Gamboa M., 3Verdugo C.M.& 1Nespolo R.F. 1Instituto de Ecología y Evolución, 2Instituto de Zoología,`3Centro de Fauna Silvestre, Universidad Austral de Chile.

Los parámetros bioquímicos sanguíneos son herramientas útiles para evaluar el estado nutricional y fisiológico de vertebrados silvestres. Con este objetivo se analizaron parámetros bioquímicos en una población del cisne de cuello negro perteneciente al Santuario Carlos Anwandter, Río Cruces, Chile. Esta población se redujo en un 95% durante el año 2004, debido a que la reciente contaminación del río produjo la disminución de su principal alimento. Entre Agosto y Diciembre, se obtuvieron muestras de sangre de 119 animales adultos en el Santuario. La sangre se tranfirió a tubos con anticoagulante, y en el laboratorio se determinaron 12 variables bioquímicas. Como control se utilizaron datos adquiridos el 2003 en el mismo lugar.
Los resultados muestran que la condición corporal decreció cerca de 30% con respecto al año 2003. El ácido úrico y triglicéridos disminuyeron durante el año, mientras que proteínas totales, globulinas, urea, creatinina y b-hidroxibutirato incrementaron.
Los resultados sugieren que esta población de aves presentó desnutrición, alcanzando el estado I del modelo de ayuno clásico, lo cual anuló la reproducción, incrementó la mortalidad e indujo la emigración.
Agradecimientos: SAG, CONAF, FONDECYT, MECESUP and CONICYT

 

RESPUESTAS DE TOLERANCIA A COBRE EN MACROALGAS (Tolerance responses to copper in seaweed). Contreras, L. Departamento de Ecología & Center for Advanced Studies in Ecology and Biodiversity, PUC. FONDAP 1501 0001, Programa Nº 7.

La actividad minera ha ocasionado efectos negativos sobre los ecosistemas marinos costeros en el norte de Chile (Chañaral, III Región). Aunque se han realizado cambios para mejorar la calidad de las descargas mineras, aun persisten altos niveles de cobre en las aguas costeras del sector afectado, los cuales podrían ser responsable de la ausencia de numerosas especies en las áreas impactadas. En la zona intermareal impactada el ensamble de macroalgas está constituido por tres especies, con dominancia de Scytosiphon lomentaria (Phaeophyceae) y está ausente de especies estructuradoras como Lessonia nigrescens (Phaeophyceae). En este contexto, se postula que la presencia de macroalgas en los sitios impactados se debe a su capacidad de atenuar el estrés generado por los altos niveles de cobre. Este estudio demostró que el cobre genera en S. lomentaria y en L. nigrescens estrés oxidativo. S. lomentaria activa mecanismos de tolerancia que involucran el consumo de compuestos antioxidantes, activación de enzimas antioxidantes y un aumento en los transcritos de genes de tolerancia. En L. nigrescens se observó daño a nivel celular, inactivación de enzimas antioxidantes y disminución en los transcritos de genes de tolerancia. La capacidad diferencial que presentan estas macroalgas para responder al estrés generado por cobre ayuda a explicar la persistencia de S. lomentaria y la ausencia de L. nigrescens en sitios aledaños a Chañaral.

COMUNICACIONES ORALES

ECOLOGÍA EVOLUTIVA

Diversidad citogenética: su significancia evolutiva y en la conservación: El caso de la rana chilena Batrachyla antartandica (Leptodactylidae) (Cytogenetic diversity: its significance in evolution and conservation. The case of the chilean frog Batrachyla antartandica). Cuevas P. C. C., Estudiante Doctorado en Ciencias, Mc. Sistemática y Ecología, Instituto de Zoología, Casilla 567, Universidad Austral de Chile, Valdivia, Chile. E-mail: ccuevas@uach.cl.

Durante un estudio preliminar desarrollado en la rana Sud Americana Batrachyla antartandica, se detectó una importante diversidad citogenética en tres poblaciones provenientes de la zona Sur de Chile. En este trabajo se presentan resultados de 5 localidades adicionales tomadas del área de distribución de esta especie. El análisis cromosómico realizado, reveló diferencias en la localización de las constricciones secundarias, regiones organizadoras del nucléolo en las ocho poblaciones estudiadas, a pesar de presentar todas ellas el mismo número diploide y número fundamental de brazos. Esta información es asumida como una evidencia valiosa en el contexto de evaluar una nueva aproximación a la conservación del patrimonio genéticos de esta especie, considerando que la conservación de la diversidad genética dentro de una especie es un desafío mayor, y uno de los tres niveles priorizados por la IUCN. Adicionalmente se proponen algunas hipótesis para explicar la significancia evolutiva y el valor de las Ag-NOR y los patrones de bandeo-C como marcadores a nivel específico.
Resultados Unidad Investigación
Beca CONICYT

 

DIVERGENCIA GENÉTICA ENTRE EQUINODERMOS ANTÁRTICOS Y CONTINENTALES DEL GÉNERO Sterechinus (Genetic divergence between Antarctic and continental echinoids of the genus Sterechinus) Díaz, A.1, Palma A. 2,3 & Poulin E. 1,3
1
Departamento de Ciencias Ecológicas, Facultad de Ciencias, Universidad de Chile. Las Palmeras 357, Casilla 653 Santiago. 2Departamento de Ecología Pontificia Universidad Católica de Chile. Casilla 114-D. Santiago, Chile. 3 Center for Advanced Studies in Ecology and Biodiversity, P. Universidad Católica de Chile

El continente antártico presenta una gran diversidad de invertebrados marinos bentónicos, caracterizados por altos niveles de endemismo. De este escenario surgen interrogantes acerca de cuál ha sido el mecanismo que ha dado origen a la fauna marina, problemática que ha sido ampliamente debatida, pero sin una clara respuesta aún. La especiación por vicarianza ha sido planteada como una posible hipótesis para la existencia de especies congéneres en ambos continentes, generada por la separación de placas durante el Mioceno.
El genero Sterechinus representa a erizos regulares de capacidad dispersiva (larva planctotrófica), que posee especies en el continente antártico y en las costas de Argentina, lo que hace que sea un buen modelo para abordar la interrogante anterior. Del análisis de la región COI del mDNA, de individuos de ambos lugares, se compara la diversidad molecular y se infiere el tiempo de divergencia entre las especies. Nuestros resultados indican que ambas poblaciones están en una fase de expansión reciente y que su tiempo de divergencia sería mucho más próximo al presente, probablemente relacionado al comienzo del pleistoceno.
Agradecimientos: Proyecto Antártico y CASEB

 

Efecto de la calidad de la dieta sobre rasgos fisiológicos y de historia de vida en Pachyloidellus fulvigranulatus (Effect of diet quality on physiological and life history traits in Pachyloidellus fulvigranulatus) Naya, D. E.1, Lardies, M. A.2, Bozinovic, F.1
1CASEB Pontificia Universidad Católica de Chile, Santiago, Chile. 2Departamento de Ciencias Básicas, Universidad Santo Tomás, Chile.

En el presente trabajo se analiza el efecto, a largo plazo, de la calidad de la dieta sobre rasgos fisiológicos y de historia de vida en el opilión Pachyloidellus fulvigranulatus. Se usó una dieta con alto contenido de proteínas y otra rica en hidratos de carbono, cuantificándose, después de cinco meses de aclimatación, la tasa metabólica estándar, el cambio en la condición corporal y la fecundidad. Los datos indican que los animales que consumieron la dieta rica en proteínas presentaron tasas metabólicas más altas, mejor condición corporal y mayor fecundidad que los animales alimentados con la dieta rica en carbohidratos. Un análisis de vías sugiere que cuando la calidad de la dieta es alta los animales incrementan la masa visceral, la cual si bien determina un mayor costo de mantenimiento, permite la síntesis de huevos. Por el contrario, una dieta rica en carbohidratos no permite una inversión reproductiva importante, aunque sí la supervivencia por un largo período de tiempo. En suma, los animales bajo estudio parecen adoptar distintas estrategias de acuerdo a la calidad de la dieta disponible, mediante ajustes fenotípicos a niveles fisiológico, morfológico y de historia de vida.
Agradecimientos: CASEB (Programa 1) y CONICYT.

 

UNA APROXIMACIÓN BAYESIANA PARA EVALUAR LA INCERTIDUMBRE FILOGENÉTICA EN LA BIOGEOGRAFÍA HISTÓRICA Y EL TAMAÑO CORPORAL ANCESTRAL DEL GÉNERO Oligoryzomys (RODENTIA: SIGMODONTINAE) (A Bayesian approach to assess phylogenetic uncertainty in the historical biogeography and ancestral body-size of the genus Oligoryzomys (Rodentia: Sigmodontinae)) Hernández, C. E. 1, 2, Rodríguez-Serrano, E.1, Boric, D.1 & Palma, R. E.1 1-CASEB, P. Universidad Católica de Chile, Casilla 114-D-Santiago. 2-Laboratorio de Diversidad Molecular y Filoinformática, Departamento de Zoología, Universidad de Concepción, Casilla 160-C-Concepción.

Existe un considerable debate en cuanto a los procesos evolutivos que originaron los patrones de distribución y biodiversidad del género Oligoryzomys en Sudamérica. Se ha sugerido que la diversificación de éste género ocurrió desde el extremo Norte de Sudamérica, con una posterior dispersión y radiación hacia el Sur, representando un grupo basal dentro de los Sigmodontinos. En este estudio se usó una aproximación Bayesiana filogenética molecular (Secuencias del gen Citocromo-b) para evaluar la hipótesis: "el antepasado del género Oligoryzomys tiene mayor probabilidad de ser localizado en los Andes del Norte, apoyando el origen Norteamericano de Sigmodontinae en Sudamérica". Los resultados no sustentan la hipótesis planteada y sugieren que este género se habría originado con mayor probabilidad en el extremo Austral de Sudamérica, desde altitudes medias-bajas, y ancestros de tamaño corporal grande. La posterior radiación habría ocurrido hacia el Norte, primero con una gran diversificación en el área Centro y Este de Sudamérica, y luego hacia el extremo Noroeste de Sudamérica. Estos resultados, junto con una tendencia a la miniaturización de los tamaños corporales, sugieren un nuevo escenario histórico de Oligoryzomys en Sudamérica.
Agradecimientos: FONDECYT-3050092, 1030488; FONDECYT-CASEB-1501-0001

 

Morfología y Evolución del Clado Andino (Rodentia; Sigmodontinae). (Morphology and Evolution of the Andean Clade (Rodentia; Sigmodontinae). Rodríguez-Serrano1, E. & Hernández1, 3, C. Palma1, 2 R. E. 1Laboratorio de Biología Evolutiva, Facultad de Ciencias Biológicas, P. U. C. 2CASEB, P. Universidad Católica de Chile, Casilla 114-D-Santiago. 3Laboratorio de Diversidad Molecular y Filoinformática, Departamento de Zoología, Universidad de Concepción, Casilla 160-C-Concepción.

El Clado Andino aparece como resultado de los recientes estudios filogenéticos moleculares de Sigmodontinae. Su particularidad radica en su distribución geográfica y en sus adaptaciones ecomorfológicas, únicas dentro de la subfamilia. Se ha postulado que la adaptación fosorial en este grupo se sustenta en la dispersión desde los Andes Centrales hacia el Sur y la posterior colonización de nuevos ambientes. En este estudio utilizamos una aproximación filogenética molecular y biogeografía histórica para poner a prueba dicha hipótesis, determinando el momento en que aparece esta adaptación, y las áreas ancestrales donde se habrían originado los ancestros fosoriales. Los resultados indican una rápida aparición de dichas características en el Clado Andino, pero no a partir de procesos de dispersión, sino que debido a procesos vicariantes.
Agradecimientos FONDECYT 1030488, FONDECYT-FONDAP CASEB

MORFOMETRÍA PULMONAR DE AVES Y MAMÍFEROS CURSORIALES Y VOLADORES (Lung morphometry in cursorial and flying birds and mammals). Figueroa D., Ricardo Olivares, Michel Salaberry, Pablo Sabat y Mauricio Canals. Departamento de Ciencias Ecológicas. Facultad de Ciencias. Universidad de Chile. Casilla 653. Santiago. Chile. e-mail: mcanals@uchile.cl. Departamento de Ciencias Biológicas Animales. Facultad de Ciencias Veterinarias y Pecuarias.

Estudiamos los parámetros de difusión pulmonar en dos especies de aves: Notoprocta perdicaria y Zenaida auriculata (Perdiz y Tórtola); y en dos especies de mamíferos: Phyllotis darwini y Myotis chiloensis (Lauchón orejudo y murciélago orejas de ratón). Exploramos si los parámetros estructurales del pulmón de estas especies pueden estar asociados a su modo de locomoción: cursorial o volador.
La membrana alvéolo-capilar fue muy fina en todas las especies, a excepción de la perdiz que mostró una barrera gruesa, semejante a la que se encuentra en las Galliformes (lejanas filogenéticamente). La densidad de superficie respiratoria (superficie respiratoria/unidad de volumen pulmonar) fue significativamente mayor en la tórtola y el murciélago. Las estimaciones morfométricas de la capacidad de difusión de oxígeno, DtO2, siguió el mismo patrón, con los valores más elevados en las especies voladoras. La menor conductancia se encontró en la perdiz. Las especies estudiadas muestran refinamientos en sus parámetros pulmonares asociados a sus modos de locomoción, independientemente de su origen filogenético (ave o mamífero). Como la barrera alvéolo-capilar fue fina en todas las especies a excepción de la perdiz, la diferencia en conductancia de oxígeno entre las especies buenas voladoras y P. darwini se encuentra sustentada en la gran densidad de superficie respiratoria de éstas. FONDECYT 1040649

 

VARIACIÓN GENÉTICO CUANTITATIVA EN EL METABOLISMO DEL GRILLO DE LAS DUNAS, GRYLLUS FIRMUS, INFERIDO POR ANÁLISIS DE LÍNEAS ENDOGÁMICAS (Quantitative genetic variation in metabolismo of the sand cricket Gryllus firmus, inferred by inbred-line análisis). Nespolo, RF, Castañeda, LE & Roff, DA*.
Instituto de Ecología y Evolución, Universidad Austral de Chile. *Department of Life Sciences, University of California, Riverside

La variación genética de rasgos metabólicos en animales es poco conocida comparada con rasgos morfológicos y de historia de vida, principalmente por la dificultad de mantener y medir grandes cantidades de individuos en el laboratorio, como exigen los estudios de pedigríes. Mediante respirometría de flujo continuo y determinación simultánea de actividad, determinamos el metabolismo de las ninfas de G. firmus provenientes de cuatro líneas endogámicas. La variación de estas líneas entrega una medida de la heredabilidad en sentido amplio. Además, como control se determinaron un número de variables morfológicas en estas líneas, tanto en adultos como en ninfas. Los resultados muestran que el metabolismo de G. firmus presenta variación significativa entre líneas en 4. 5%, 5. 2%, 10. 3% y 8. 5% en metabolismo promedio, de reposo, mínimo y máximo, respectivamente (determinado mediante MANOVA). La variación morfológica resultó ser significativa y del orden del 18%. Este estudio muestra que la tasa metabólica de insectos presenta variación heredable y por lo tanto potencialidad de respuesta a la selección, pero que hacen falta estudios más detallados para indicar qué porcentaje de esta varianza es debida a efectos genético-aditivos, maternos y de ambiente en común.
Financiado por FONDECYT 3030032.

 

COMPARACIÓN MORFOMÉTRICA Y MOLECULAR ENTRE INDIVIDUOS DE Bufo spinulosus y Bufo papillosus (ANURA: BUFONIDAE). (Morphometric and molecular comparison among individuals of B. spinulosus and B. papillosus (Anura: Bufonidae). Correa, C.1,2, Jimenez-Huidobro, P. 1,2 & Méndez, M. A.1,2
1
Departamento de Ciencias Ecológicas, Facultad de Ciencias, Universidad de Chile.2Laboratorio de Bioinformática y Expresión Génica, INTA, Universidad de Chile

Bufo spinulosus Wiegmann 1835, presenta en Chile poblaciones en la Primera, Segunda Región (hasta el sur del Salar de Atacama) y en la Zona Central (Regiones Quinta y Metropolitana). Por otra parte, Bufo papillosus Philippi 1902, en un continuo de distribución, habita desde la Séptima hasta la Décima Región. Estudios sistemáticos previos han considerado a ambas entidades como especies validas. En el presente trabajo se examina la existencia de ambas especies como linajes independientes utilizando caracteres morfológicos y moleculares.
Se analizó la variación morfológica en larvas y adultos de seis poblaciones mediante estadística multivariada. A nivel molecular se estudiaron 126 individuos (29 poblaciones), utilizando dos marcadores (RAPDs y secuencias D-Loop). Se estimó la variabilidad interpoblacional y los niveles de subestructuración genética. Con las secuencias D-Loop se determinaron las relaciones filogenéticas entre poblaciones.
Se encontró una alta diferenciación interpoblacional a nivel morfológico y molecular, que mostró estar correlacionada con la distancia geográfica entre localidades, sugiriendo una marcada estructuración filogeográfica. Finalmente, nuestros análisis indican que para las poblaciones examinadas ambas entidades corresponden a un mismo linaje, adscribiendo a B. papillosus a una extremo de la variación geográfica de B. spinulosus.

DIVERSIDAD GENÉTICA DE PEQUEÑOS PECES PELÁGICOS DE LAS COSTAS DEL PACÍFICO ORIENTAL (Genetic diversity in pelagic fishes of the East Pacific) Silva1 A., Ojeda2 F. P. y Poulin1 E.
1Departamento de Ciencias Ecológicas, Facultad de Ciencias, Universidad de Chile. Las Palmeras 357, Casilla 653 Santiago. 2Center for Advanced Studies in Ecology and Biodiversity, Facultad de Ciencias Biológicas, Pontificia Universidad Católica de Chile. Alameda 340, Santiago

La distribución antitropical en el Pacifico-Este ha sido descrita para distintas especies de peces marinos, entre las cuales se cuentan las especies del género Trachurus representado en las costas chilenas por T. murphyi, y en las costas californianas por T. simetricus, género Engraulis representadas en las costas chilenas por E. ringers y en las costas californianas por E. mordaz. Lo anterior plantea importantes preguntas sobre el origen y cronología de su divergencia transecuatorial. Estudiando la región control del mDNA de las cuatro especies, se compararon la diversidad molecular y se infirió sus tiempos de divergencia transecuatorial. Nuestros resultados indican que existió un fenómeno de cuello de botella poblacional ancestral que afectó a los dos géneros en cuestión. Por otro lado, las mutaciones acumuladas entre T. murphyi y T. simetricus son menores que las de E. ringers y E. mordaz, lo que indicaría (1) fechas de divergencia transecuatorial distintas o (2) tasas mutacionales diferentes. La estimación de tiempos de divergencia con criterios de coalescencia y reloj molecular, podría resolver dichas controversias.
Agradecimientos: Fondecyt 1040785 y CASEB.

 

BIOQUÍMICA Y BIOLOGÍA MOLECULAR

MUTAGÉNESIS SITIO-DIRIGIDA PERMITE IDENTIFICAR UNA REGIÓN ENDOFACIAL DEL TRANSPORTADOR GLUT1 REQUERIDA PARA SU SENSIBILIDAD FRENTE A CITOCALASINA B (Site-directed mutagénesis permits to identify a region on the GLUT1 transporter required for its sensitivity towards cytochalasin B). Valenzuela X., Raddatz N., Pérez A, Bulnes P. y Reyes A. M.. Instituto de Bioquímica, Facultad de Ciencias, Universidad Austral de Chile, Casilla 567, Valdivia, Chile (areyes@uach.cl).

GLUT1 es el principal representante de las proteínas integrales de membrana que facilitan el transporte de hexosas en células animales. Aunque no requiere de la hidrólisis de ATP para su función, su secuencia contiene tres dominios con homología con sitios de unión de nucleótidos. Para probar la importancia de uno de estos dominios (residuos 332-338) para la funcionalidad del transportador, preparamos mutantes puntuales para los aminoácidos conservados en esta región y, luego de su expresión en ovocitos de Xenopus, las evaluamos cinéticamente mediante ensayos trans-cero de influjo, trans-cero de eflujo y ensayos de intercambio en equilibrio y de sensibilidad frente a inhibidores. Dos mutaciones T335L y H337N muestran una muy reducida respuesta frente a citocalasina B, un clásico inhibidor de GLUT1 que se une por la cara endofacial de la proteína. En contraste, la mutación L338T no afecta la interacción de citocalasina B con la proteína. Las mutantes no exhiben otras diferencias significativas en cuanto a afinidad por el sustrato, niveles de expresión o sensibilidad frente a otros inhibidores que se unen al transportador por su superficie exofacial. Debido a la posición predicha de estos residuos en la cara endofacial de la proteína, es posible sugerir que los residuos T335 y H337 contribuyen a la formación del sitio de unión para citocalasina B en el transportador GLUT1 (Financiado por el proyecto FONDECYT 1020908).

 

EFECTO DE LA MICROINYECCIÓN DE γ-TUBULINA RECOMBINANTE SOBRE EL DESARROLLO TEMPRANO DEL PEZ CEBRA. (Recombinant γ-tubulin microinjection effect on zebrafish early development). Pouchucq, L., Fuentes, R, Diaz, C., Lagos, R., Monasterio, O. Departamento de Biología, Facultad de Ciencias, Universidad de Chile.

Los microtúbulos (MT) son componentes altamente dinámicos del citoesqueleto. Están constituidos por heterodímeros de αβ-tubulina que interaccionan longitudinal y lateralmente. El ensamblaje in vitro de MT ocurre mediante una fase limitante de nucleación y una fase rápida de elongación. Se ha propuesto un mecanismo que involucra a γ-tubulina como responsable de la nucleación de MT in vivo. γ-tubulina es importante en la formación del huso mitótico y la regulación del ciclo celular. En el citoplasma γ-tubulina forma parte de estructuras anulares que se asocian al extremo(-) de los MT, las cuales son abundantes en la matriz pericentriolar. En este trabajo se determinó la expresión de γ-tubulina endógena y se microinyectó γ-tubulina recombinante marcada con TAMRA(carboxitetrametil-rodamina) no funcional en embriones tempranos del pez cebra. El desarrollo temprano de los embriones microinyectados se visualizó por microscopía de fluorescencia y microscopía DIC. En estadios tempranos del desarrollo, el pez cebra contiene γ-tubulina endógena y su mensajero. La microinyección de γ-tubulina recombinante en estadíos tempranos del desarrollo generó alteraciones en la división celular, en la estructura, la dinámica y la segregación ovoplásmica de los embriones. La microinyección de α-tubulina en la mismas condiciones no altera el desarrollo de los embriones, indicando que el efecto observado al microinyectar γ-tubulina es específico. Proyecto FONDECYT 1050677.

 

FOSFORILACIÓN POR PROTEÍNA QUINASA C REGULA INTERACCIONES PROTEÍNA-PROTEÍNA ENTRE LOS FACTORES DE TRANSCRIPCIÓN RUNX2, C/EBPβ Y VDR (Protein kinase C phosphorylation regulates protein-protein interactions between the transcription factors Runx2, C/EBPβ and VDR) Bruna, C., Arriagada, G., Ugarte, G., Paredes, R., Martínez-Oyanedel, J., Bunster, M., Montecino, M.
Laboratorio de Biología Celular y Molecular. Departamento de Bioquímica y Biología Molecular. Universidad de Concepción.

El factor de transcripción Runx2 es un transactivador esencial en el proceso de diferenciación osteoblástica.
La proteína Runx2 se ha descrito como modular, destacándose los siguientes dominios: Runt, a través del cual se une al ADN en sus genes blanco. NLS y NMTS, que localizan a Runx2 en el núcleo y en sitios transcripcionalmente activos. T1 y T2, con los cuales interacciona con Smads y recluta complejos remodeladores de cromatina.
Recientemente, hemos identificado un nuevo dominio de transactivación que comprende los residuos 209-361, el cual regula transcripción a través de interacciones directas con otras proteínas, como el receptor de vitamina D3 y C/EBPb. Estas interacciones resultan en una activación sinérgica de genes controlados por Runx2.
El análisis de la secuencia de Runx2 revela la presencia de 8 posibles sitios de fosforilación por proteína quinasa C, 4 de los cuales están localizados en el dominio 209-361.
En este trabajo se estudió la contribución de la fosforilación por PKC sobre las interacciones entre Runx2, VDR y C/EBPβ.
Para ello, se produjeron proteínas recombinantes, se las fosforiló in vitro por PKC y se ensayó interacción directa mediante GST pull-down.
Nuestros resultados indican un mecanismo regulatorio de interacciones proteína-proteína mediado por proteína quinasa C, el que tendría un rol importante en la expresión de genes tejido óseo-específico.

 

UN NUEVO MÉTODO PARA ENCONTRAR RELACIONES FUNCIONALES DISTANTES ENTRE PROTEÍNAS (A novel method for finding distant functional relationships among proteins). Veloso, F., Holmes, D.
Laboratorio de Bioinformática y Biología Genómica, Universidad Andrés Bello e Instituto Milenio de Biología Fundamental y Aplicada, Santiago, Chile. Email: fa_veloso@yahoo. com

Fundamento: Hasta hoy, la búsqueda de relaciones funcionales entre genes se ha basado en aminoácidos conservados en alineamientos y patrones detectados en las secuencias proteicas asociadas. Se presenta un enfoque distinto para este fin, consistente en la comparación entre la composición aminoacídica de proteínas reales y la de proteínas derivadas de genes teóricos sin restricción biológica alguna (uso de codones, pentámeros, etc.) . Lo anterior se expresa matemáticamente como un contenido de información en las proteínas reales.
Métodos: Se calculó este contenido (en bits) por aminoácido, por proteína, y por organismo en 162 genomas (500. 000 proteínas aprox.) , entre bacterias y archaeas.
Resultados: Los aminoácidos con mayor contenido de información son Cys, Arg, Glu y Ser, mientras que Leu, Tyr, Gln y Asn son los de menor contenido. Este resultado difiere de lo establecido en las matrices de sustitución de BLAST, el estándar para la comunidad científica. Además, existe una relación entre la función proteica y el perfil de información por cada aminoácido.
Conclusión: Este enfoque (i) provee una nueva manera para identificar similitud funcional de proteínas disímiles en secuencia, (ii) plantea la necesidad de recalibrar las matrices de sustitución de BLAST y (iii) entrega otro parámetro a considerar en genómica comparativa.
Financiamiento: Proyecto FONDECYT 10500

 

AZAR EVOLUTIVO (Evolutionary randomness). Valenzuela C. Y. Programa de Genética Humana, ICBM, Facultad de Medicina, Universidad de Chile.

Hay una falsa concepción de azar como desorden. El azar se relaciona con entropía, movimiento Browniano y evolución azarosa o por deriva. El azar implica isoprobabilidad de alternativas equivalentes, lo que es un orden perfecto. Lanzar una moneda al aire múltiples veces y constatar que sale cerca de 0, 5 cara y 0, 5 sello, con una varianza de 0, 25 y ajuste a los momentos de la distribución binomial es admirable. Lo mismo vale para todas las distribuciones probabilísticas construidas de acuerdo al azar. En movimiento Browniano la esperanza de movimiento en una dirección es la misma para cualquier partícula de la misma sustancia presente en el sistema. En evolución molecular neutral, la deriva implica que en un sitio nucleotídico se espera que las 4 bases (A, T, G, C) se encuentren en la proporción 0, 25 cada una, tanto entre genomas distintos como dentro de un mismo genoma. Esto es si comparamos genomas que han evolucionado aparte por más de 100. 000. 000 de generaciones que en bacterias es cerca de 100. 000 años. Por un error de concepción del azar se pensó que la deriva llevaba a los alelos a fijarse o a ser eliminados, lo que explicaría la inmensa conservación de las secuencias genómicas. La deriva puede permitir una sustitución, pero es imposible que mantenga una frecuencia fijada. El movimiento Browniano podría producir la pirámide de Keops pero es imposible que la mantenga.

 

ESTRUCTURA DE LOS RNA QUIMÉRICOS MITOCONDRIALES (Structure of the mitochondrial chimeric RNAs). Burzio, V., Villegas, J., Villota, C. and Burzio, L. O. Instituto Milenio MIFAB, Fundación Ciencia para la Vida y BiosChile I. G. Av. Zañartu 1482, Santiago.

En los últimos años el dogma central de la biología se está re-analizando debido al descubrimiento de una familia cada vez más abundante de RNAs que no codifican para proteínas. Estos transcritos nucleares parecieran cumplir funciones tan diversas como en desarrollo, como señales epigenéticas y en varias enfermedades. Nuestro laboratorio ha descubierto en ratón y humano una familia de nuevos RNAs mitocondriales que tampoco codifican para proteínas y que funcionalmente están relacionados con proliferación celular y cáncer. En general estos transcritos están formados por repetidos invertidos (RI) de diferente longitud unidos covalentemente al RNA mitocondrial sentido 16S (mt16S) o al RNA mitocondrial antisentido 16S. Debido a que transcripción de los dos componentes de estos transcritos (RI + mt16S) depende de diferentes promotores, hemos denominado a estos transcritos como RNA quiméricos (RNAq) sentido o antisentido. El RNAq sentido-1 contiene un RI de 815 nts (humano) o 732 nts (ratón) unido al 16S sentido. El RNAq sentido-2 y -3, tienen RI más cortos y se expresan solo en células transformadas con virus oncogénicos (HPV y HTLV-1). Los tres RNAq antisentido humano tienen RI que varían entre 189 a 514 nts. Se discutirán estos resultados así como las nuevas estrategias utilizadas para la secuenciación (Proyectos P04-071-F, MIFAB, DI-26-04, DI-57-04 y DI 32-03 U. Andrés Bello).

 

ANÁLISIS DEL PROMOTOR DEL GEN—SDH2-3 DE—ARABIDOPSIS THALIANA (Analysis of the Arabidopsis thaliana SDH2-3 gene promoter) Roschzttardtz H.1, Gómez I.1, Araya A.2 y Jordana X. 1 (1)Departamento de Genética Molecular y Microbiología, Facultad de Ciencias Biológicas, P. Universidad Católica de Chile, Santiago, Chile; (2)Laboratoire de Réplication et Expression des Gènes Eucaryotes et Rétroviraux, UMR 5097, CNRS et Université Victor Segalen-Bordeaux II, 33076 Bordeaux-Cedex, Francia.

En Arabidopsis tres genes nucleares (SDH2-1, SDH2-2 y SDH2-3) codifican para la subunidad hierro-azufre del complejo II de la cadena respiratoria mitocondrial. Los genes SDH2-1 y SDH2-2 se expresan en todos los tejidos de plantas adultas, mientras que el transcrito de
SDH2-3 solo es detectado en semillas durante la embriogénesis. El análisis de plantas transgénicas que contienen una construcción con el promotor de SDH2-3 fusionado al gen reportero GUS muestra que la actividad del promotor se inicia en cotiledones durante la maduración del embrión. Ello se correlaciona con la detección del transcrito, demostrando que la regulación es transcripcional. Hemos mutado el promotor de SDH2-3 y realizado fusiones al reportero GUS. También fusionamos una región del promotor de SDH2-3 a un promotor mínimo (caja TATA) seguido de GUS (ganancia de función). Se presentarán los resultados obtenidos con estas líneas transgénicas. Por otra parte, evaluamos la acumulación del transcrito SDH2-3 en semillas de plantas mutantes en factores de transcripción que se sabe son importantes para la expresión de genes durante la fase de maduración del embrión en Arabidopsis.
FONDECYT 1020930, PICS 2179 (CNRS-Francia) y CONICYT AT-4040013.

MICROBIOLOGÍA
AMBIENTAL I

AISLAMIENTO DE PSEUDOMONAS SP ARSENITO-OXIDANTES DESDE MUESTRAS DE ROCAS VOLCÁNICAS. (Isolation of Pseudomonas sp arsenite-oxidizing from volcanic rocks) 1Campos, V., 1Valenzuela, C., 2Zaror, C., 3Yañez, J., 1Mondaca, M. A. (1)Departamento de Microbiología. Facultad de Ciencias Biológicas. (2)Departamento de Ingeniería Química. Facultad de Ingeniería. (3)Departamento de Química Analítica, Facultad de Ciencias Químicas. Universidad de Concepción. vcampos@udec.cl.

El arsénico se encuentra en estado natural en rocas, suelo, agua, aire y es liberado al ambiente mediante fenómenos naturales tales como erupciones volcánicas, erosión de las rocas e incendios forestales, donde los microorganismos son esenciales para el ecosistema por su participación en diferentes procesos naturales. El objetivo fue aislar bacterias resistentes a arsenito, desde muestras de rocas provenientes de la Quebrada Camarones (I región). Las rocas fueron cultivadas en un medio mineral adicionado con arsenito (500 ug/ml) durante 7 días a temperatura ambiente y con agitación. Las cepas fueron aisladas en diferentes medios e identificadas mediante el sistema Rapid™ NF plus. La capacidad de oxidar arsénico fue realizada mediante ensayos con nitrato de plata y la detección de genes aox, mediante RT-PCR. Se aislaron bacilos Gram negativos, no fermentadores, identificados como Pseudomonas alcaligenes, todas ellas capaces de tolerar concentraciones igual o mayor a 8 mM de As(III). Los análisis mediante RT-PCR demuestran la presencia de genes aox, que codifica para una enzima oxidante que cataliza la oxidación de As(III)a As(V). La capacidad de oxidar arsenito de las cepas aisladas, favorecía la colonización de otras especies no tolerantes a arsénico importantes en los ciclos biogeoquímicos.
Fondecyt 1050088

 

CARACTERIZACIÓN DE BACTERIAS, RESISTENTES A ARSÉNICO, DESDE UN SISTEMA NATURAL ALTAMENTE CONTAMINADO CON EL METALOIDE. (Arsenic-resistant bacteria isolated from environment contaminated with arsenic) 1Mondaca, M. A., 2Paredes, E., 2Opazo, A., 1Escalante, G., 3Zaror, C., 1Campos, V. (1)Departamento de Microbiología. Facultad de Ciencias Biológicas. (2)Facultad de Farmacia. (3)Departamento de Ingeniería Química. Facultad de Ingeniería. Universidad de Concepción. mmondaca@udec.cl

Las bacterias presentes en ambientes contaminados con arsénico son afectadas, prosperando aquellos microorganismos que sean capaces de tolerar esta presión ambiental y adaptarse mediante mecanismos de resistencia. El objetivo del presente trabajo fue aislar bacterias resistentes a arsénico, desde sedimentos naturales con diferentes concentraciones del metaloide. Las muestras de sedimentos se obtuvieron desde el río Camarones (I región). Las muestras se incubaron en medio mineral durante 7 días, a temperatura ambiente, con agitación. Diluciones apropiadas de las muestras se sembraron en agar R2A, agar Cetrimide, agar Mc Conkey, agar R2A adicionado con rojo congo y se incubaron a 25ºC, durante 3 días. Se determinó los niveles de tolerancia a As(III), As(V) y a otros metales. Se investigó la presencia de genes aox por RT-PCR y ar por PCR. Los resultados muestran la presencia de bacterias resistentes a arsenito y arseniato, con niveles de tolerancia mayores a 8 mM. Las especies predominantes corresponden a bacilos Gram negativos no fermentadores. Las cepas analizadas mediante PCR y RT-PCR muestran la presencia de genes ar y aox. El hallazgo de cepas As-oxidantes permitiría su uso potencial en la detoxificación de aguas contaminadas con arsénico.
FONDECYT 1050088; Proyecto DIUC 204. 036. 027-1

 

FORMACIÓN DE MINERALES COMO RESULTADO DE LA RESPIRACIÓN BACTERIANA DE ARSÉNICO Demergasso1, C Escudero G.. L1, Chong D. G.2, Pedrós-Alió3 C.
1Laboratorio de Microbiología Técnica, Universidad Católica del Norte
2Centro de Investigación Científica y Tecnológica para la Minería (CICITEM), Región de Antofagasta.
3Instituto de Ciencias del Mar, CMIMA, CSIC, Barcelona, España.

Una gran concentración de boratos se sitúa en la región en la que los Andes alcanzan su anchura máxima, con particulares condiciones geotectónicas y de marco geológico, incluyendo una intensa actividad volcánica cenozoica. Como minerales de ganga asociadas aparecen, entre otros, sulfuros de arsénico tanto en los horizontes de boratos como en la sobrecarga. El objetivo de esta investigación es complementar el estudio de la participación de microorganismos que respiran arsénico en la formación de estos minerales en el Salar de Ascotán, Norte de Chile.
Se recolectaron muestras líquidas y de sedimentos, se midieron los parámetros fisicoquímicos en terreno y las concentraciones de arsénico en laboratorio. La abundancia de las bacterias reductoras de arsénico fue determinada a través del número más probable. Paralelamente se analizó por PCR la presencia de genes utilizados como marcadores de la respiración de As (V). Se hizo análisis de la población de genes 16S rRNA para la identificación filogenética de las comunidades procariotas involucradas.
El pH de las muestras líquidas fluctúa entre 7. 23 y 7. 98 y las concentraciones de arsénico entre 4. 38 y 183 mg/L. Los sedimentos tienen contenidos de arsénico que varían entre 781 y 6504 mg/Kg.
La población de bacterias reductoras de arsénico y sulfato oscila entre 3. 9x102 y 2. 8x105 cel/mL para las muestras líquidas y entre 2. 4x 105 y 1. 6x106 cel/g para los sedimentos. Solo el PCR de las muestras sólidas evidenció la presencia de microorganismos respiradores de arsénico, lo que analizado junto con los resultados del MPN indicaría que estamos bajo el límite de detección del análisis por PCR de estos genes.
Los ensayos de enriquecimiento y aislamiento permitieron obtener cultivos de algunas de las morfologías celulares observadas en las muestras originales.
La comunidad está formada tanto por Bacterias como por Archaeas.
Estos trabajos se realizaron en el marco del proyecto FONDECYT 1030441 y CTM2004-02586/MAR.

 

SECONDARY STRUCTURE OF THE 16S_23S rRNA INTERNAL TRANSCRIBED SPACER REGION: A PROBLEM FOR ecological studies in cyanobacteria. (Estructura secundaria en la región espaciadora transcrita del rRNA 16S-23S: un problema para estudios ecológicos en cianobacterias.) Lavin, P1., Gomez, P1., Gonzalez, B2. & Ulloa, O1. 1Depto. Oceanografía y Depto. Botánica, Facultad Ciencias Biológicas y Oceanográficas. UDEC. Concepción; 2Depto. Genética Molecular y Microbiología, Facultad Ciencias Biológicas. PUC. Santiago, Chile. palavin@udec.cl

Culture independent, molecular approaches are being increasingly used in microbial ecology. We amplified, cloned, and sequenced the 16S rRNA plus the 16S_23S internal transcribed spacer (ITS) regions from environmental samples of the cyanobacteria Synechococcus and Prochlorococcus, to investigate the potential use of ITS sequence in population genetic studies. Denaturing gradient gel electrophoresis (DGGE) and terminal restriction fragment length polymorphisms (TRFLP), two PCR-based techniques, were used to accomplish this. Typically, we obtained more than one band per environmental clone with DGGE, and more than one length per clone in TRFLP. To elucidate the possible effect of the secondary structure on the PCR products, each cloned ITS sequence was modeled at different temperatures. Our results show that the length of the PCR fragments resulting from the artifactual deletion of internal loops predicted by the secondary structure, are coincident with the length of the fragments obtained by TRFLP. To avoid anomalous PCR products, we have modified the standard TRFLP procedure by adding labeled primer to ITS in the last two cicles, obtaining positive results.
Work supported by FONDAP (grant 1501-00007/COPAS, Program-2, and grant 1501-0001/CASEB Program-7), Marine Genomics-CONICYT, and FUNDACION ANDES C-13851.

 

ESTRUCTURA Y FUNCIÓN DE ENSAMBLES MICROBIANOS ASOCIADOS AL SISTEMA ACTINORRÍCICO Frankia - Colletia hystrix (Structure and function of microbial assemblages associated to actinorhizal system Frankia-Colletia hystrix)
Orlando, J.; Bravo, L.; Chavez, M.; Alfaro, M.; Farías, F.; Guevara, R. y Carú, M. Lab. de Ecología Microbiana, Depto. de Ciencias Ecológicas, Facultad de Ciencias, Universidad de Chile. mcaru@codon. ciencias. uchile.cl.

La caracterización de las actividades microbianas asociadas al suelo y la rizósfera requiere la comprensión de la composición, estructura y función de los ensambles microbianos a nivel de comunidad y gremio. El objetivo de este trabajo fue caracterizar la estructura y función de la comunidad bacteriana del suelo y del gremio fijador de nitrógeno, utilizando como modelo la simbiosis actinorrícica Frankia - Colletia hystrix. Para ello se analizaron muestras de rizósfera y suelo de las fracciones total y cultivable mediante patrones de T-RFLP de los marcadores 16S rDNA y del gen nifH. Las asociaciones entre las muestras se estimaron mediante dendrogramas construidos a partir de los perfiles de T-RFLP. Los agrupamientos fueron confirmados por PCA. Se observó una clara separación entre la fracción total y cultivable, donde la comunidad de la rizósfera formó un grupo independiente bien definido, influenciado por el nitrógeno disponible según lo determinado por análisis de correspondencia canónica. La capacidad de fijación de nitrógeno, determinada por el ensayo de reducción de acetileno fue más baja en la fracción cultivable que en la rizósfera de la fracción total. Para determinar si dicha actividad es atribuible a Frankia se determinaron las unidades genómicas de este diazótrofo en la rizósfera y suelo mediante NMP-PCR.
Financiamiento: FONDECYT, Proyecto N°1040880

 

EL TIPO DE COMPARTIMENTO Y LOS NIVELES DE COBRE DETERMINAN LA ESTRUCTURA DE LAS COMUNIDADES EN EL INTERMAREAL ROCOSO EXPUESTO A DESCARGAS DE RELAVES DE LA MINERÍA DE COBRE). Type of compartment and levels of copper shift the structure of bacterial communities in intertidal rocky shores exposed to copper mine tailing discharges. Morán, A. C. 1, Hengst, M. B. 1, De la Iglesia, R. 1, Andrade, S. 2, Correa, J. A. 2 and González, B. 1 1Depto. de Genética Molecular y Microbiología, 2Depto. de Ecología, and Center for Advanced Studies in Ecology and Biodiversity. Facultad de Ciencias Biológicas. P. Universidad Católica de Chile. `amoran@bio. puc.cl

Bacterial communities of coastal rocky intertidal ecosystems impacted for more than 60 years by copper mine wastes were characterized by terminal restriction fragment length polymorphism (T-RFLP). Different compartments from control and impacted sites were studied: seawater, sediments, biofilms adhered to rocks, and surfaces of two algae, Lessonia nigrescens and Ulva compressa. The type of compartment, but not copper, significantly affect diversity. Sediment was the most diverse compartment and algal surfaces the less diverse system. Nevertheless, the structures of bacterial communities of different compartments were significantly affected by copper, being sediments the most affected compartment. Taxonomic profiles, constructed by assigning T-RFLP signals to bacterial groups, suggested that the difference among compartments was related to aggregate-attached vs. free-living life style of bacteria. That was mainly determined by the proportion of g-Proteobacteria. However, these profiles were not significantly affected by copper levels.
Financial support was from FONDAP 1501 0001/CASEB Program 7 and Marine Genomics-CONICYT, FUNDACION ANDES C-13851.

 

GENOMIC ANALYSIS OF THE AROMATIC CATABOLIC PATHWAYS FROM CUPRIAVIDUS NECATOR JMP134. (Análisis genómico de las vías de degradación de compuestos aromáticos en C. necator JMP134). Pérez-Pantoja, D. 1; De la Iglesia, R. 1; González-Pastor, J. E. 2; de Lorenzo, V. 2; González, B. 1 1Depto. Genética Molecular y Microbiología. P. Universidad Católica de Chile, CHILE; 2Centro de Astrobiología (CSIC-INTA), SPAIN. drperez@puc.cl

C. necator JMP134 is a well-known (halo)aromatic compounds degrading strain. The complete genome sequence of C. necator is now available. We performed the metabolic reconstruction of aromatic compounds degradation, correlating the catabolic abilities as determined in silico with a complete study of the range of compounds that support growth of this bacterium. Catabolic genes putatively encoding the degradation pathways for aromatics were identified by means of BLAST software using published gene sequences as in silico probes. We observed a strong correlation between the catabolic abilities found in silico with those determined in vivo. At least twelve central ring-cleavage pathways for aromatic compounds were detected. In order to confirm the functionality of these pathways we also performed a transcriptional analysis of these genes. A 50-mer oligonucleotide DNA microarray including 350 genes of C. necator was designed and used to conduct differential gene expression profiling during exponential growth on fructose with several aromatic compounds as inducers of the predicted ring-cleavage pathways. Functionality of most of the catabolic pathways predicted was verified. This work confirmed the potential of complete genome sequencing to predict the metabolic abilities of microorganisms and the utility of microarrays to confirm metabolic predictions.
Work supported by a FONDECYT grant (1030493), the MIFAB Millennium Institute, the DOE-JGI initiative and the ICA4-CT-2002-10011 (ACCESS) Contract of the European Union. D. Pérez-Pantoja is a UNESCO-IUMS-SGM short-term fellowship recipient.

MICROBIOLOGÍA GENERAL

ACTIVIDAD BIOCONTROL DE BACTERIAS DEL ECOSISTEMA NATURAL DE LAS VIDES (Biocontrol activity of bacteria from the natural grape ecosystem). Troncoso M., Rivas P., Figueroa A., Figueroa G.

Laboratorio de Microbiología, INTA, Universidad de Chile.

Las enfermedades de la vid constituyen un importante problema que afecta los procesos productivos y compromete las exportaciones de uva. Los tratamientos con antifúngicos o antibacterianos pueden generar residuos y no siempre son eficientes en el control de los patógenos. Los biocontroles, son una alternativa para el tratamiento químico de fitopatógenos que afectan a las plantas y frutos durante su producción ya que actúan directamente sobre patógenos que comparten su mismo nicho ecológico, regulando así la densidad de su población. Objetivo: Evaluar la capacidad antagónica de la bioflora natural de vides sobre bacterias indicadoras. Métodos. Se evaluó 187 cepas aisladas de uvas sanas, hojas o sarmientos de parronales de la IV, V, Metropolitana y VI región. La actividad antibacteriana se determinó mediante ensayos de spot con dos cepas blanco Bacillus subtilis BGA y E. coli ATCC 25922. Resultados. 50/187 (27%) cepas estudiadas poseían actividad antagónica, de ellas 42 (22%) solo frente a`Bacillus BGA, 2 (1%) contra E. coli ATCC 25922 y 6 (3 %)contra ambos indicadores. En un subgrupo de 27 cepas de Bacillus sp, 2 presentaron además efecto inhibitorio sobre`Salmonella sp, Shigella sonnei, E. coli 0157 y`S. aureus. Conclusión. Este estudio permitió seleccionar al menos 6 cepas con actividad antagónica que luego de evaluar su sobrevida "in vivo" podrían tener aplicación tecnológica como biocontroladores en el huerto. Proyecto DI MULT 04/05-2

 

TRICHODERMA VIRIDE 32, T. PILULIFERUM 33 Y T. POLYSPORUM 34: OBTENCIÓN Y SELECCIÓN DE MUTANTES (Trichoderma viride 32, T. piluliferum 33 Y T. polysporum 34: obtention and selection of mutants) Lespinasse, M., Jofré, M., Morales, E., Polanco, R., Pérez, L. M.
Laboratorio de Bioquímica, Departamento de Ciencias Biológicas, Facultad Ciencias de la Salud, Universidad Andrés Bello.

El tomate, una de las hortalizas de mayor importancia agronómica en Chile, es atacado por fitopatógenos del sistema radical, tales como Rhizoctonia solani, Pyrenochaeta lycopersici y Phytophthora parasitica. Su control se ha realizado mediante la rotación de cultivos y el uso de bromuro de metilo (MeBr). Este último contamina el medio ambiente y daña la capa de ozono. El uso de hongos del genero Trichoderma ha mostrado su efectividad en el antagonismo de numerosos patógenos vegetales, constituyendo una alternativa al uso de MeBr.
Los aislados T. viride (Tvir32), T. piluliferum (Tpil33) y T. polysporum (Tpol34), seleccionados previamente como eficientes bioantagonistas de los fitopatógenos antes mencionados, fueron sometidos a tratamiento con nitrosoguanidinio. Se seleccionaron mutantes de las tres especies de Trichoderma según su capacidad de desarrollo a diferentes temperaturas y secreción de enzimas hidrolíticas tales como quitinasas y proteasas, de entre un total de aprox. 80 mutantes obtenidas. Todas las mutantes seleccionadas mostraron características mejoradas en cuanto a mecanismos de biocontrol con relación a los aislados parentales, lo que se refleja en su capacidad para antagonizar a los patógenos mencionados.
Financiamiento: Proyecto FONDECYT 1040531-04, UNAB DI23-02.

 

EFECTO DE METABOLITOS SOBRE LA GERMINACIÓN Y EL CRECIMIENTO MICELIAL DE BOTRYTIS CINEREA (Effect of metabolites on germination and mycelial growth of Botrytis cinerea) *Cotoras, M., *Saavedra, A., *Rivera, A., #Araya-Maturana, R., *Mendoza, L.
*Facultad de Química y Biología Universidad de Santiago de Chile. #Facultad de Ciencias Químicas y Farmacéuticas, Universidad de Chile.

Botrytis cinerea es un hongo fitopatógeno facultativo, causante de la enfermedad denominada "pudrición gris". En Chile, el desarrollo de este hongo tiene una alta tasa de incidencia debido a las condiciones climáticas que favorecen su crecimiento. Para controlar la "pudrición gris", B. cinerea ha sido tratado tradicionalmente con fungicidas comerciales, del tipo dicarboximidas y benzimidazoles.
En nuestro laboratorio estamos interesados en la búsqueda de nuevos compuestos que presenten actividad contra B. cinerea. El diterpeno ácido 3 b-hidroxikaurenoico, obtenido de la planta Pseudognaphalium vira vira provoca en B. cinerea un retardo en la germinación de los conidios y en el crecimiento micelial, en medio de cultivo sólido. En cambio, el compuesto 4, 4 dimetil antraquinona-1(4H) ona inhibe la germinación en un 100%, durante 15 horas; sin embargo, solo inhibe parcialmente el crecimiento micelial.
Estudios del mecanismo de acción de estos compuestos han demostrado que ambos provocan lisis del micelio. El ácido 3 b-hidroxikaurenoico altera la membrana celular e inhibe parcialmente la cadena respiratoria durante la germinación. En cambio, el derivado de antraquinona inhibe totalmente el consumo de oxígeno en estas esporas.
Este trabajo fue financiado por los proyectos FONDECYT 1030916 y 1030466 e IFS F/3115-1 y C/ 2807-2.

ESTUDIO DEL GEN ast DE Xanthophyllomyces dendrorhous (Study of ast gene of Xanthophyllomyces dendrorhous). Carmona, M.; Alcaino, J.; Barahona, S.; Sepúlveda, D.; Wozniak, A.; Baeza, M. y Cifuentes, V. Laboratorio de Genética, Depto. Cs. Ecológicas, Facultad de Ciencias, Universidad de Chile.

Xanthophyllomyces dendrorhous es una levadura basidiomicete que produce astaxantina, carotenoide utilizado en acuicultura para la coloración de salmónidos. El paso de β-caroteno hasta astaxantina es controlado por el gen ast que codifica la enzima astaxantina sintetasa. Para clonar el gen ast, inicialmente se realizó un mapa genómico de restricción de la cepa silvestre de X. dendrorhous. Mediante hibridación se ubicó al gen en un fragmento PstI de 4, 0 Kb, lo que permitió la construcción de una genoteca parcial, con fragmentos entre 3. 5 a 4. 5 kb, en el sitio PstI del vector pBluescript. Paralelamente, se clonó el cDNA del gen ast mediante RT-PCR. El análisis de la secuencia del gen y su cDNA determinó que tiene un tamaño de 3. 995 pb y esta constituído por 18 exones y 17 intrones. Para determinar su localización en el genoma de esta levadura, se realizó un cariotipo electroforético. Para ello, DNA cromosómico intacto fue separado mediante electroforesis de campo pulsado y luego, por hibridación, se determino que el gen se encuentra en las bandas cromosómicas 1 y 2. Estos resultados nos han permitido avanzar en la ruta de biosíntesis de carotenoides de X. dendrorhous, desde una perspectiva génica y su proyección a nivel biotecnológico.
Agradecimientos: FONDECYT Nº 1040450 y Convenio U. de Chile - C. S. I. C. España.

 

CALCINEURINA DE TRYPANOSOMA CRUZI: CARACTERIZACIÓN MOLECULAR DE LA SUB UNIDAD CATALÍTICA CaNA. Orrego P1., Sossa P1., Rodríguez C.1, Neira I.1, Sagua H1., González J1., Araya JE1*.
1Unidad de Parasitología. Universidad de Antofagasata-Chile. *jearayar@uantof.cl

En nuestro laboratorio tenemos serias evidencias de que Calcineurina esta implicada en el proceso de invasión ya que inhibidores de ella, tales como Ciclosporina A y Cypermetrina, inhiben la penetración de tripomastigotes a las células huésped.
Calcineurina es una serina-treonina fosfatasa de proteína del tipo 2B (CaN), dependiente de Ca+2 and Calmodulina, constituida por una sub unidad catalítica (CaNA) y una sub unidad regulatoria (CaNB) esta se une al Ca+2 por sus dominios "EF hands". La existencia del gen que codifica para la sub unidad regulatoria de Calcineurina CaNB ha sido demostrada en nuestro laboratorio y su secuencia completa está depositada en el GeneBank con numero de acceso AY570505.
Con el propósito de clonar y caracterizar el gen que codifica para la sub unidad catalítica de Calcineurina de T. cruzi se sintetizaron partidores degenerados deducidos de la secuencia de amino ácidos obtenida por análisis de proteómica. El fragmento amplificado fue secuenciado y posteriormente empleado como sonda para tamizaje en genotecas de ADNc de tripomastigotes metaciclicos. Un clon denominado de CaNA. 1 fue aislado, secuenciado y caracterizado molecularmente.
El análisis de Northern blot reveló la existencia de un transcrito of 2, 3 kb, el cual está presente en todos los estadios evolutivos del parásito. El gen está presente en un bajo número de copias en el genoma de T. cruzi, tanto en la cepa CL como G. Los resultados del Southern blot fueron concordantes con los observados en el Cromo blot, encontrándose la presencia de secuencias homólogas al gen CaNA tan solo en dos bandas cromosomales. Nuestro resultados constituyen el primer reporte de la existencia de este gen en T. cruzi.
Financiamiento: FONDECYT 1051045, FUNDACIÓN ANDES

 

Identificación y caracterización de actividad ATPasa de NSP5 en Rotavirus (Identification and Characterization of the ATPase activity of NSP5 in Rotaviruses) Bar-Magen, T.1, 2, Ricardo, A.1, Spencer, E.1, Patton, J. 2
1
Laboratorio de Virología, Dep. de Ciencias Biológicas, Facultad de Química y Biología, Universidad de Santiago de Chile
2Laboratory of Infectious Diseases, NIAID, National Institutes of Health, Bethesda, MD

La replicación del genoma de rotavirus y el ensamble de las partículas virales ocurre en el citoplasma, en inclusiones llamadas viroplasmas. Las proteínas no estructurales NSP2 y NSP5 interactúan y forman estructuras tipo viroplasmas en la ausencia de otras proteínas virales. NSP5 también se caracteriza por su afinidad a ARN de simple hebra y ARN de doble hebra como también por sus varias modificaciones post traduccionales que incluyen la fosforilación, hiper-fosforilación y NAc-O-Glicosilación.
Por cromatografía de capa fina hemos determinado que NSP5 tiene una actividad ATPasa dependiente de Magnesio. La actividad no se ve afectada por la presencia de ARN o NSP2. Tampoco una mutación de la serina 67 tuvo algún efecto sobre la actividad ATPasa de NSP5. La fosforilación de la serina 67 es un evento que activa la hiper-fosforilación de NSP5 y se cree que es el primer evento de fosforilación llevado a cabo por la kinasa celular CKI. Por lo tanto, NSP5 posee una actividad ATPasa que no está relacionada con la serina 67 o con la fosforilación de la proteína.
Financiado por NIAID/NIH, Fulbright y Beca de Apoyo de Beca Doctoral-CONICYT a T. B. y proyecto FONDECYT 1050002 a E. S.

 

La expresión en trans de la proteína viral NSP5 dificulta el ciclo replicativo de rotavirus. (Trans-expression of viral protein NSP5 hinders the replicative cycle of Rotavirus). Sotelo, P.; Cifuentes, N.; Chnaiderman, J.

Programa de Virología, ICBM, Fac. Medicina, Universidad de Chile. Patrocinado por Dr. Héctor Toledo.
Rotavirus pertenece a la familia Reoviridae, su genoma consiste en 11 segmentos de RNA doble hebra y se replica en estructuras subcelulares denominadas viroplasmas las cuales están compuestas por la proteína NSP5 entre otras. Esta proteína presenta varias isoformas dependiendo del estado de fosforilación. La función de cada una de estas isoformas durante la infección es desconocida. Dado que no existe un sistema de genética reversa para este virus, una forma de estudiar el rol de proteínas virales es por medio de su expresión en trans. Estudios preliminares realizados en nuestro laboratorio y por otros grupos han demostrado que NSP5 suministrada en trans es capaz de ser incorporada a los viroplasmas.
En un intento por estudiar la proteína NSP5 hemos logrado, por medio del uso de un vector retroviral, expresarla en células MA104. Sorprendentemente al realizar titulaciones de virus producidos tanto en células que expresan NSP5 (NSP5+) como en células parentales, hemos observado una disminución en el título viral (cantidad de virus producido) en las células NSP5+ en comparación con las células control. Además, en estudios de colocalización, por medio de inmunofluorescencia, de NSP5 con la proteína VP6 (proveniente de la infección viral) en células NSP5+ hemos observado que la proteína NSP5 expresada en trans dificulta el ciclo replicativo de Rotavirus. El efecto de la dosis, además del estado de fosforilación de NSP5 suministrada en trans, sobre el ciclo replicativo son discutidos.
Proyecto Financiado por Fundación ANDES. P. S. es becario del DAAD.

 

DETECCIÓN DEL VIRUS DEL SÍNDROME RESPIRATORIO Y REPRODUCTIVO PORCINO (vPRRS) EN SUERO Y TEJIDOS DE CERDOS INOCULADOS (PRRSv detection from serum and tissues of experimentally inoculated pigs) Cerda L.1, García A.1, Lecocq C.1, Díaz N.1, Ruiz A.2, Quezada M.2 (1Departamento Laboratorio y Estaciones Cuarentenarias Agrícola y Pecuaria, Servicio Agrícola y Ganadero 2 Facultad de Medicina Veterinaria, Universidad de Concepción)

Con el fin de conocer la forma de transmisión del aislado nacional del vPRRS, se realizó una experiencia utilizando 30 cerdos divididos en 6 grupos (G1, G2, G3, G4, G5, G6) de 5 animales cada uno. El G1 fue inoculado con 2 mL in y 1 mL im del vPRRS (105. 7 TCID50/mL), siendo mantenidos por 35 días en observación, periodo en el cual fueron muestreados para ELISA, RT-PCR y aislamiento viral al igual que G6 que fue control. Otros 4 grupos (G2, G3, G4, G5) se utilizaron como susceptibles, y entraron en contacto con los cerdos inoculados en diferentes periodos entre 3 y 35 dpc. Al sacrificio de los cerdos, se tomó muestras de pulmón y tonsila para aislamiento viral en células Marc 145.
En G1, se detectó viremia entre los 3 y 23 dpi y se aisló virus desde pulmón y tonsila en un 40 y 60% respectivamente y la seroconversión ocurrió a los 15 dpi.
En los cerdos contacto se observó viremia en los diferentes dpc; sin embargo, la seroconversión fue escasa. Por otra parte, en el 80% de los animales de G2 se aisló virus de tonsilas y en un 60% de pulmón a partir de los 14 dpi, llegando a un 100% de aislamiento viral en ambos órganos en G5.
Financiado por el Proyecto FONDECYT 1040414

 

ECOLOGÍA ANIMAL

La Importancia de diferentes conductas de marcaje de territorio en machos de Octodon degus (Rodentia). (The importance of different scent mark Behavior in males of Octodon degus). Soto-Gamboa M., Villa C., Franco L. M. Instituto de Zoología, Universidad Austral de Chile.

En mamíferos, el uso de señales olfativas es uno de los mecanismos más frecuentes en el marcaje de territorio. Con éstas los animales entregan información respecto a jerarquía, sexo, familiaridad, etc. Se conocen tres formas básicas de señales olfativas: secreciones anales (fecas), urogenitales (orina) y sebáceas de la piel (revolcamientos). En roedores, existen especies que se han especializado en el marcaje con orina, mientras que otras en el marcaje con revolcamientos. En este trabajo ponemos a prueba la hipótesis de que el marcaje con revolcamientos estaría asociado a roedores que habitan ambientes áridos. Para ello utilizamos a Octodon degus, roedor caviomorfo diurno que habita en ambientes semi-áridos de Chile central. Evaluamos las conductas de marcaje/sobremarcaje de territorio y los niveles de respuesta de machos reproductivos frente al marcaje artificial de machos foráneos. Se consideraron cinco tipos de marcas: Arena limpia (control), orina, fecas, revolcamientos, y mezcla (todos los anteriores). Los resultados indican que los animales responden a la arena limpia marcando el territorio principalmente con revolcamientos. Al agregar las marcas foráneas no se observaron cambios significativos de marcaje entre tratamientos, y siempre fueron menores que las observadas en arena limpia. Finalmente, la conducta de olfateo presentó diferencias significativas entre tipos de marcas, siendo mayores sobre muestras de fecas y revolcamientos. Los datos obtenidos sugieren estos marcajes serían predominantes para machos de O. degus. Se discute la importancia de este tipo de marcaje y los compuestos liposolubles depositados en ambientes áridos.
MECESUP AUG-011

 

LIMITACIONES POBLACIONALES PARA APHRASTURA SPINICAUDA (FURNARIIDAE) EN UN PAISAJE MODIFICADO POR ACTIVIDADES HUMANAS: EFECTO DE FRAGMENTACIÓN O DETERIORO DE HÁBITAT? (Population limitations in Aphrastura spinicauda in a human modified landscape: fragmentation or habitat deterioration effects?) Cornelius, C., Univ. Missouri-St. Louis, Biology Department, MO63121-USA

Este estudio evaluó el efecto del deterioro y la fragmentación del hábitat sobre poblaciones de Aphrastura spinicauda que nidifican en cavidades en el bosque templado en Chiloé. Se replicaron tres tratamientos de hábitat con dos parcelas de 10-ha por hábitat: bosque primario, bosque talado selectivamente (ambos >500-ha) y fragmentos de bosque talados selectivamente (~12-ha). Se estimó la densidad de árboles, de aves y la sobrevivencia de nidos naturales en dos épocas reproductivas. Los bosques primarios tuvieron más sitios potenciales de nidificación, dados por un mayor número de árboles vivos (>40cm DAP). La densidad de A. spinicauda, estimada mediante funciones de detección hábitat-específicas, fue mayor en bosques primarios, pero no difirió entre bosques de gran tamaño talados y fragmentos talados. Los nidos se encontraron en árboles vivos (n=35) y muertos en pié (n=26). El número promedio de árboles vivos y muertos no predijo el número de A. spinicauda en bosques primarios pero sí en bosques talados. La sobrevivencia diaria de nidos, modelada utilizando un método de máxima verosimilitud (MARK), no difirió entre años ni hábitats. En este estudio, la fragmentación no tiene un efecto negativo adicional sobre el deterioro del hábitat y la disponibilidad de sitios de nidificación es el factor limitante más importante para esta especie.

BOSQUES CULTIVADOS DE PINO: HÁBITAT ALTERNATIVOS PARA FAUNA NATIVA (Cultivate pine forest: alternative habitat for native fauna) Murúa, R. Schlatter, R. Figueroa, R. Figueroa, R. Ruiz, J. Briones, M. Facultad de Ciencias, Universidad Austral de Chile FONDEF D02I1005, Forestal MININCO.

La sustitución de bosques nativos por plantaciones de pinos ha significado históricamente reducción de las poblaciones de fauna propias del bosque. Recientes modificaciones en el manejo silvicultural de estas plantaciones (baja densidad, persistencia de quebradas con vegetación nativa) permitirían su colonización por fauna nativa. Analizamos la presencia de mamíferos y aves en dos rodales de pinos. Instalamos 3 redes de 96 trampas Sherman cada una para colecta de micromamíferos. El esfuerzo de captura total fue 2647 trampas/noche entre octubre 2003 y marzo 2005. Se calculó un índice de captura por unidad de esfuerzo. Además, se dispusieron 27 estaciones de atracción olfativa para macromamíferos, completando 69 estaciones operativas totales. Se calculó su densidad relativa (Linhart y Knowlton 1975). Se instalaron 60 casas anideras y se realizaron censos estacionales nocturnos y diurnos para aves rapaces. El ensamble de micromamíferos fue dominado por Abrothrix longipilis, con la presencia de A. olivaceus, Oligoryzomys longicaudatus, Irenomys tarsalis, Pearsonomys annectens y R. norvegicus. Adicionalmente, Dromiciops gliroides colonizó casas anideras. Oncifelis guigna, Pudu pudu y aves rinocriptidas fueron detectadas en las estaciones de atracción olfativa y Strix rufipes, Glaucidium nanum y Falco sparverius en los censos. Se analiza la diversidad encontrada en relación a las características de los rodales y la presencia de especies asociadas al bosque nativo.

 

LAS HEMBRAS DE OCTODON DEGUS NO DISCRIMINAN ENTRE CRÍAS PROPIAS Y AJENAS durante la lactancia. (Females of Octodon degus do not discriminate between own and unrelated offspring during lactation). Valdivia, I., M. J. Hurtado & L. A. Ebensperger. Centro de Estudios Avanzados en Ecología & Biodiversidad y Departamento de Ecología, P. Universidad Católica de Chile. FONDECYT 1020861.

El objetivo del estudio fue determinar si degus hembras discriminan entre crías propias y ajenas en la asignación de cuidado parental en respuesta a dos factores: estado de lactancia de la hembra y diferencia de edad entre crías ajenas y propias. Para esto, se sometió a hembras en período de lactancia temprana (primeros 2-3 días post-parto) e intermedia (días 6-7) a la posibilidad de interactuar simultáneamente con una cría propia y una cría ajena, fuera de su nido. Simultáneamente, las hembras también fueron expuestas a crías de similar o distinta edad. En el 100% de los experimentos realizados, las hembras transportaron a ambas crías al nido que contenía el resto de su camada. El orden de transporte de ambas crías no fue afectado ni por el estado de lactancia de las madres ni por la edad relativa de las crías. Sin embargo, las hembras interactuaron más frecuentemente con ambas crías cuando su estado de lactancia es intermedio y cuando las crías tenían edad similar. Los resultados sugieren que las hembras de O. degus no discriminan su asignación de cuidado maternal, aunque no es posible establecer si estas son incapaces de reconocer a sus propias crías.

VARIACIÓN GEOGRÁFICA EN CONDUCTAS DE ALMACENAMIENTO DE ALIMENTO EN Octodon degus. (Geographic variation in food hoarding behavior in Octodon degus). Quispe, R. & Vásquez, R. A. Departamento de Ciencias Ecológicas, Facultad de Ciencias, Universidad de Chile.

En biología evolutiva se entiende por variación geográfica a la diferencia en los rasgos del fenotipo (incluyendo la conducta) entre dos o más poblaciones (o áreas distantes) de una misma especie. En este estudio, comparamos las conductas de almacenamiento de alimento de individuos provenientes de poblaciones contrastantes del roedor caviomorfo`Octodon degus. Una población correspondió a Bocatoma-Los Molles que habita a gran altitud (2. 500 m snm) en la IV región, de clima cordillerano con inviernos muy fríos, incluyendo varias semanas bajo nieve, en donde las actividades de superficie de los degus se ven restringidas. La otra población estudiada habita en el valle central de Chile (Rinconada de Maipú, R. M., 450 m snm). Se llevaron a cabo experimentos de laboratorio, y se cuantificó el consumo y almacenamiento de alimento realizado espontáneamente por los individuos. Se encontraron diferencias significativas en transporte y almacenamiento de alimento entre ambas poblaciones, tanto para individuos habituados como no-habituados a las condiciones de laboratorio. Los individuos de la población de mayor altitud concentraron su almacenamiento hacia la madriguera, a diferencia de los individuos de la población del valle central, quienes almacenaron alimento en diferentes puntos. Se discuten estos resultados a la luz de las diferencias climáticas y de acceso a alimento que experimentan ambas poblaciones.
(FONDECYT 1020550, P02-051-F ICM).

 

APRENDIZAJE ASOCIATIVO DE OLORES AFECTA EL COMPORTAMIENTO DE BÚSQUEDA DE PAREJA DEL PARASITOIDE APHIDIUS ERVI HALIDAY (HYMENOPTERA: BRACONIDAE). (Associative Odour Learning affects mating behaviour of Aphidius ervi males) Villagra C. A., Vásquez R. A. & Niemeyer H M.
Departamento de Ciencias Ecológicas, Facultad de Ciencias, Universidad de Chile, Santiago, Chile.

Existe muy poco conocimiento respecto al papel del aprendizaje en la búsqueda de pareja. En parasitoides la capacidad de aprendizaje olfativo ha sido caracterizada en hembras en la búsqueda de hospederos, conociéndose muy poco de las capacidades de aprendizaje del macho y su relevancia en la búsqueda de hembras.
En este trabajo se empleó el parasitoide Aphidius ervi desarrollado en el áfido hospedero`Acyrthosiphon pisum, para estudiar si las respuestas conductuales del macho hacia olores puede ser alterada por condicionamiento. Como estímulo no condicionado (ENC) se empleó la experiencia de cópula con la hembra y como estímulo condicionado (EC) se utilizó tanto los compuestos volátiles de la planta del hospedero como una esencia artificial de vainilla. Las respuestas fueron probadas en olfatómetro en Y, antes del entrenamiento y después de éste. El entrenamiento duró 10 minutos, donde los machos experimentaron ENC con o sin presencia de EC. Un tercer grupo solamente fue expuesto a EC.
Los resultados mostraron la capacidad de aprendizaje olfativo del macho de Aphidius ervi. El contexto de estímulos olfativos presentes durante apareamiento podría, mediante aprendizaje, convertirse en señales para posteriores búsquedas de pareja.
Palabras clave: Aprendizaje Sexual, Fidelidad al Hospedero, Aphidius ervi.
Agradecimientos: Beca Doctoral CONICYT, Beca Apoyo Tesis CONICYT AT-4040221.

 

COMPROMISOS ENTRE RASGOS FISIOLÓGICOS Y RASGOS DE HISTORIA DE VIDA: ¿AYUDAN A EXPLICAR LOS PATRONES DE VARIACIÓN GEOGRÁFICA? (Trade-offs between physiological and life-history traits: can help us to explain patterns of geographical variation?). Lardies M. A. Departamento de Ciencias Básicas, Universidad Santo Tomás, Santiago, Chile. mlardies@santotomas.cl

Los gradientes ambientales son comunes en la naturaleza y son considerados importantes por tener un claro efecto en patrones biogeográficos. Los compromisos entre rasgos han sido pensados como el resultado de la competencia entre diferentes funciones organísmicas por recursos internos limitados. ¿Están los rasgos de historia de vida ligados (arquitectura genética) a los rasgos fisiológicos en los organismos?. El objetivo de este estudio fue establecer la conexión de los rasgos de historia de vida con los costos de mantención a lo largo de un gradiente ambiental. Se utilizó como modelo de estudio el isópodo terrestre Porcellio laevis el cual se distribuye ampliamente en Chile. A individuos de tres poblaciones (Antofagasta, La Serena y Santiago) se le descompuso la variación de los rasgos de historia de vida y fisiológicos (tasa metabólica). Para esto, se utilizó un "animal model", tal que el fenotipo de un individuo fue escrito en términos de su varianza genética aditiva, la varianza debida a efectos ambientales generales y la correlación genética entre los distintos rasgos. Las heredabilidades son altas y significativas para el tamaño al nacer y el rendimiento reproductivo. La tasa metabólica presentó una baja heredabilidad, que solo fue significativa en Santiago. Sin embargo, lo anterior no quiere decir que no exista una unión funcional entre la tasa metabólica y los rasgos de historia de vida. Esta unión existe a manera de correlación fenotípica y de una débil correlación genética entre estos rasgos, para las poblaciones de latitudes mas bajas. Los resultados demuestran que las correlaciones entre rasgos varían entre ambientes y estás son más fuertes en ambientes heterogéneos (alta latitud) donde probablemente la acción de la selección natural es tamponeada por la presencia de plasticidad fenotípica.
FONDECYT 3040042

 

MICROBIOLOGÍA BÁSICA

Papel de la isla de patogenicidad SPI-8 de Salmonella enterica serovar Typhi en virulencia in vitro y resistencia a distintas condiciones de estrés (The Salmonella pathogenicity island SPI-8 of Salmonella enterica serovar typhi role in virulence in vitro and resistance to stress conditions) Castro, D.1, Fuentes, J.1, Retamal, P1. y Mora, G.2 1 Laboratorio de Microbiología, Facultad de Ciencias Biológicas, P. Universidad Católica de Chile2 Laboratorio de Microbiología, Facultad de Ciencias de la Salud, Universidad Andrés Bello

S. Typhi es el causante de la fiebre tifoidea en humanos, pero los factores causantes de la enfermedad no han sido completamente identificados. La secuenciación de su genoma ha permitido reconocer regiones genómicas que son exclusivas o de restringida distribución que podrían, al menos en parte, explicar la patogenicidad de S. Typhi. Una de estas regiones es la denominada SPI-8. Para determinar de qué manera SPI-8 participaría en la patogenicidad de S. Typhi, hemos generado mutantes de distintas segmentos de la isla, las cuales han sido evaluadas en distintas condiciones de estrés y en ensayos de invasión de células epiteliales. Hemos establecido que en comparación con la cepa STH2370 wt, mutantes con deleciones completas o parciales de SPI-8 son más sensibles a distintos inductores de daño oxidativo. En ensayos de invasión y proliferación en HEp-2, hemos determinado que la falta de SPI-8 completa o parcial no afecta en forma significativa la invasión, pero si se ve claramente afectada la proliferación y la inducción de muerte celular. Estos resultados nos permiten relacionar SPI-8 de S. Typhi con patogenicidad in vitro y determinar qué segmentos de la isla están involucrados en este fenómeno. FONDECYT 1020485. Castro, Fuentes y Retamal son becarios CONICYT

REGULACIÓN FASE-DEPENDIENTE DE LA PRODUCCIÓN DE ANTÍGENO O EN Salmonella enterica serovar Typhi y Shigella flexneri. (Phase-dependent regulation of O antigen production in Salmonella enterica serovar Typhi and Shigella flexneri). Carter, J., Blondel, C., Altamirano, F., Nieto, P., Salas, R., Álvarez, S., y Contreras, I. Facultad de Ciencias Químicas y Farmacéuticas, Universidad de Chile.

El antígeno O (AgO) es el componente estructural más externo del lipopolisacárido (LPS) de las bacterias Gram negativas. En este trabajo se analizó la producción de AgO durante el crecimiento bacteriano en Shigella flexneri, que presenta dos modas o largos preferentes de AgO (corta y larga) y se comparó con la de Salmonella Typhi, que posee una sola moda. Ambas especies mostraron una regulación fase-dependiente de la síntesis del AgO, que aumentó en fase estacionaria; sin embargo, en S. flexneri solo aumentó la moda larga. Esta modulación correlacionó con una mayor expresión del factor de elongación RfaH, que regula la transcripción de los genes para la síntesis de AgO (operón wba). Una mutante îrfaH de S. Typhi mostró un fenotipo de LPS rugoso (carente de AgO), en cambio una mutante îrfaH de S. flexneri no sintetizó AgO de moda larga y produjo menor cantidad de la moda corta. Los resultados sugieren que RfaH participa en la regulación fase-dependiente del AgO tanto en S. Typhi como en S. flexneri. El efecto diferencial de RfaH sobre la producción de AgO puede explicarse por las diferencias en la organización genética del operón wba en ambas especies.
Financiamineto: FONDECYT 1040562

 

CARACTERIZACIÓN GENÉTICO-FUNCIONAL DE PROTEÍNAS INVOLUCRADAS EN LA MADURACIÓN DE LA MICROCINA E492. (Genetic and functional characterization of proteins involved in maduration of microcin E492.) Estévez*, C.1; Tello, M. 1; Arbildúa, J. J.1; Monasterio, O. 1; Kolter, R.2 y Lagos, R. 1 Laboratorio de Biología Estructural y Molecular, Departamento de Biología, Facultad de Ciencias, Universidad de Chile1; Department of Microbiology and Molecular Genetics, Harvard Medical School2. clauaes@yahoo. es

La microcina E492 es un péptido antibiótico secretado por Klebsiella pneumoniae RYC492. Varios genes son necesarios para la producción de una microcina activa. Mutantes en los genes de maduración, mceC, mceI y mceJ, secretan una forma inactiva de microcina, la cual es capaz de formar fibras amiloide. En algunos sistemas bacterianos se ha descrito que la producción de fibras amiloides promueve la formación de biopelículas. El objetivo de este trabajo fue establecer mediante análisis bioinformático, mutagénesis y crecimiento sobre superficies inertes, la función que cumplen las proteínas MceC y MceI en la maduración de la microcina E492 y en la formación de biopelículas. Para caracterizar la proteína de maduración MceC, se realizó una mutagénesis al azar con hidroxilamina sobre el gen que codifica para esta proteína y se seleccionaron 4 mutantes incapaces de complementar una mutante en el mismo gen. Para comprender la falta de funcionalidad de estas proteínas mutantes se modeló por homología MceC y se mapearon las mutaciones en la estructura tridimensional, identificándose el posible sitio de unión a enteroquelina. También se modeló la estructura de MceI, un homólogo de una aciltransferasa. Por otro lado, los experimentos de formación de biopelículas con las cepas silvestre y mutante, indican que no existe relación entre la producción de microcina activa o inactiva con la formación de biopelículas.
Proyecto FONDECYT 1020757. *Becaria CONICYT.

 

ANÁLISIS DE LOS DOMINIOS PEPTIDASA Y ABC DEL TRANSPORTADOR DE MICROCINA E492. (Peptidase and ABC domains analysis of the microcin E492 exporter). Tello M., Arbildúa J. J. Monasterio O. y Lagos R. Laboratorio de Biología Estructural y Molecular, Departamento de Biología, Facultad de Ciencias, Universidad de Chile. mcg_tello@yahoo. com

La microcina E492 es un péptido antibiótico producido por Klebsiella pneumoniae RYC492. Esta bacteriocina es exportada al medio extracelular por un sistema de exportación de tipo I, que consiste un transportador ABC (MceG), una proteína accesoria (MceH) y la proteína de membrana externa TolC. El transportador MceG consta de los dominios peptidasa, transmembrana y ABC, los cuales son necesarios para el procesamiento y exportación de la microcina. A partir de un modelo 3D del transportador postulamos que los últimos cuatro aminoácidos de la región C-terminal son esenciales para energizar el transporte. Este modelo daría cuenta de la pérdida de actividad tanto de una mutante por deleción como de otra de reemplazo en estos aminoácidos. Para comprobar que el fenotipo de la mutante está dado por la pérdida de la estructura secundaria formada por estos aminoácidos y no por las interacciones específicas de estos residuos, se diseñó una mutante donde se reemplazaron los aminoácidos deletados por aminoácidos que forman la misma estructura secundaria. Mediante experimentos de western blot y complementación de actividad se comprobó que esta construcción transporta microcina, lo cual demuestra la hipótesis planteada. Adicionalmente el modelo mostró que en el dominio peptidasa se ubica un residuo aspártico en el sitio catalítico que no había sido previamente identificado en este tipo de peptidasa.
Proyecto FONDECYT 1020757.

 

REGULATION OF SIMAZINE DEGRADATION BY PSEUDOMONAS SP. P41 (Regulación de la degradación de simazina por Pseudomonas sp. P41). Villalobos, P.(1), García-González, V.(2), Govantes, F.(2), Santero, E.(2) and M. Seeger(1). (1)Laboratorio de Microbiología Molecular y Biotecnología Ambiental, Universidad Técnica Federico Santa María, Valparaíso, Chile. (2)Laboratorio de Microbiología, Universidad Pablo de Olavide, Sevilla, España.

Simazine is a member of s-triazine herbicides widely used in Chile to control broad-leaved weeds. Pseudomonas sp. P41 is a native bacterium able to degrade s-triazines isolated from Chilean agricultural soils. To understand the influence of nitrogen compounds on simazine metabolism of this strain, physiological and molecular analysis were performed. All catabolic atz genes of upper and lower atrazine pathways were detected by PCR. Additionally, regulator gene atzR of lower pathway was identified and sequenced. Uptake assays showed that degradation is regulated by rich nitrogen sources and by nitrogen starvation. Retrotranscription experiments showed that atz genes of upper pathway were constitutively expressed. However, expression of atzDEF operon is repressed by ammonia and induced during nitrogen starvation. Pseudomonas sp. P41 was shown to be amenable to genetic manipulation. Additionally, lac fusion assays confirm regulation of atzD gene expression. Induction of atzDEF operon by several nitrogenated compounds as simazine, nitrate and cyanuric acid, observed by diverse assays, suggest that the regulation in Pseudomonas sp. P41 differs from regulation in Pseudomonas sp. ADP. Studies of simazine degradation by Pseudomonas sp. P41 in nitrate-amended soil microcosms are in progress.
Acknowledgements: EU ICA4-CT-2002-10011, USM 130522 grants (MS), PhD fellowship MECESUP PUCV0206 (PV). +

 

RELACIÓN ENTRE ACTIVIDAD ANTIBACTERIANA Y LIPOFILIA DE DITERPENOS (The relation between antibacterial activity and lipophilia in diterpenes), 1Farías, L., 2Urzúa, A. y 1Wilkens, M. 1Departamento de Biología, 2Departamento de Ciencias del Ambiente, Facultad de Química y Biología, Universidad de Santiago de Chile. mwilkens@lauca. usach.cl

Los diterpenos son metabolitos secundarios de plantas que poseen actividad antibacteriana principalmente frente a bacterias Gram-positivas. El mecanismo de acción de los diterpenos ácido sálvico, ácido acetil-sálvico, ácido abiético, esclareol y 13-epi-esclareol es la inhibición del consumo de oxígeno, en cambio el`ácido kaurenoico actúa como desacoplador de la cadena respiratoria. El efecto de los diterpenos sobre bacterias en crecimiento es bacteriostático o bacteriolítico, por lo que también podrían provocar un daño en la membrana bacteriana. En este trabajo se analizó la relación entre el mecanismo antibacteriano de los diterpenos, el grado de lipofilia y el efecto en la membrana citoplasmática. Mediante el reactivo fluorescente SYTOX Green y microscopía confocal se demostró que solo el desacoplador de la cadena respiratoria, el ácido kaurenoico, dañó la membrana bacteriana de Bacillus cereus. Además, se determinó la lipofilia de trece diterpenos mediante el programa computacional HyperChem Release 7. 5 para Windows. Los compuestos que actúan como desacopladores de la cadena respiratoria presentaron los valores más altos de lipofilia, mientras que los que actúan interfiriendo el paso de los electrones inhibiendo el consumo de oxígeno presentaron valores intermedios de lipofilia. Los valores más bajos de lipofilia fueron para los diterpenos sin actividad antibacteriana.
Financiamiento: Proyecto FONDECYT 1030466.

 

ANÁLISIS MOLECULAR DE COMUNIDADES MICROBIANAS PRESENTES EN SEDIMENTOS RICOS EN ARSÉNICO. (Molecular study of bacterial community from arsenic rich sediment). 1Witzel, K-P., 2Campos, V., 3Yañez, J., 2Mondaca, M. A. Max-Planck Institut fur Limnologie, Plon, Alemania. Departamento de Microbiología. Facultad de Ciencias Biológicas. Departamento de Química Analítica, Facultad de Ciencias Químicas. Universidad de Concepción. mmondaca@udec.cl.

La presencia de contaminantes en el ambiente tiene un efecto sobre la abundancia y diversidad de las comunidades bacterianas. El objetivo del presente trabajo fue analizar la composición de las poblaciones bacterianas presentes en ambientes contaminados con arsénico. Se obtuvieron muestras de sedimentos de tres zonas diferentes del río Camarones (I región). A las muestras de sedimentos (I, II, III) se les determinó arsénico total. La estructura y diversidad bacteriana fue estudiada mediante la amplificación por PCR del rRNA 16s. Los productos de PCR fueron analizados por electroforesis en gel de gradiente denaturante (DGGE). Los sedimentos I, II, y III presentaron concentraciones de arsénico de 1, 3 mgL-1, 0. 75 mgL-1 y 0. 25 mgL-1 respectivamente. Los análisis de DGGE mostraron diferencias significativas en cada sedimento estudiado, mostrando que la comunidad bacteriana de sedimento III es menos diversa y restringida a unos pocos tipos dominantes. Se puede concluir que la diversidad microbiana cambia de acuerdo al gradiente de contaminación con un aparente aumento en la diversidad en los sitios con mayor contaminación.
Financiamiento Proyecto FONDECYT 1050088.

 

OBTENCIÓN Y CARACTERIZACIÓN DE BACTERIAS DEGRADADORAS DE POLICLOROBIFENILOS (PCBs) INCAPACES DE ACUMULAR POLIFOSFATOS INORGÁNICOS. (Development and characterization of PCB degrading bacteria unable to accumulate inorganic polyphosphate). Chávez, F. P., Gordillo, F. y Jerez, C. A. Laboratorio de Microbiología Molecular y Biotecnología, Departamento de Biología, Facultad de Ciencias, Universidad de Chile. cjerez@uchile.cl

Los polifosfatos inorgánicos (poliP) son biopolímeros que juegan un papel importante en la resistencia ante condiciones estresantes, la regulación de la motilidad, la formación de biopelículas y otros procesos importantes para la bioremediación bacteriana. Bacterias capaces de degradar PCBs, como la Pseudomonas sp. B4, acumulan altos niveles de poliP en forma de gránulos en presencia de bifenilo y clorobifenilos como únicas fuentes de carbono. Para estudiar el papel del poliP en Pseudomonas sp. B4, diseñamos una estrategia para obtener bacterias incapaces de acumular poliP (poliP-) mediante la sobreexpresión del gen de la exopolifosfatasa (PPX1) de Saccharomyces cerevisiae en vectores de expresión adecuados. La sobreexpresión del gen PPX1 fue altamante regulada por la fuente de carbono, reprimiéndose en presencia de glucosa e induciéndose en arabinosa. Mediante microscopía electrónica y ensayos enzimáticos demostramos que la sobreexpresión del gen PPX1 en Pseudomonas sp. B4 disminuyó casi totalmente su contenido de poliP, incluso en condiciones de gran acumulación de poliP, con cinéticas de desaparición dependentes del medio de crecimiento y la fuente de carbono utilizada. Finalmente, la Pseudomonas sp. B4 (poliP-) no presentó motilidad ni quimiotaxis hacia diferentes compuestos que le son atrayentes.
Financiamiento: Proyecto ICM P99-031-F, Becas Doctorales DAAD (FCh) y CONICYT (FG).

BIOTECNOLOGÍA - BIOLOGÍA CELULAR

EXPRESIÓN DIFERENCIAL DE SVCT1 Y SVCT2 DURANTE EL DESARROLLO EMBRIONARIO RENAL. (Differential expression of SVCT1 and SVCT2 during renal embryonic development). Castro T., Nualart F. Departamento de Biología Celular, Facultad de Ciencias Biológicas, Universidad de Concepción.

Durante la vida fetal el ácido ascórbico (AA) cumple funciones como antioxidante y es un cofactor enzimático. Se transfiere al feto vía materna, sin embargo, se desconoce su mecanismo de ingreso a las células en diferenciación. Hemos analizado la expresión de los transportadores de AA, SVCT1 y SVCT2, en riñón de ratón embrionario y su comportamiento cinético en células HEK293. Análisis de RT-PCR indican que SVCT2 es el principal transportador presente en los estadíos embrionarios estudiados. Los análisis inmunohistoquímicos confirman la expresión diferencial de ambos: SVCT1 se detecta débilmente desde el día embrionario 15 con una localización intracelular que cambia a apical a medida que avanza el desarrollo embrionario. SVCT2 se expresa fuertemente a partir del día embrionario 15, localizándose en la membrana apical y basolateral de las células de los futuros túbulos renales, su localización varía hacia la región intracelular al aumentar la edad gestacional. Estudios funcionales en células HEK293 muestran la presencia de un solo transportador de ascorbato, cuyos parámetros cinéticos coinciden con los descritos en literatura para SVCT2. La localización de SVCT2 en la membrana celular de los futuros túbulos renales, indica que sería este el principal transportador encargado de la captación de ácido ascórbico durante el desarrollo embrionario renal. FONDECYT 1010843, 1050095 y Beca de apoyo a Tesis Doctoral, CONICYT.

 

TNF-α AUMENTA LA MIGRACIÓN IN VITRO DE LAS CÉLULAS DE CARCINOMA CERVICO SW756 HPV18- POSITIVAS TNF-α in vitro migration of human HPV18-positive SW756 cervical carcinoma cells Hidalgo, K., Rojas, I. G., Penissi, A. B., Rudolph, M. I
Departamento de Farmacología. Facultad de Ciencias Biológicas. Universidad de Concepción.

Estudios, han señalado una relación causal entre eventos de inflamación y desarrollo de cáncer, favoreciendo la proliferación, migración celular y angiogénesis, entre otros. Siendo uno de los principales mediadores pro-inflamatorios el TNF-α, asociado a sobrevivencia y apoptosis.
Una de las neoplasias femeninas de mayor incidencia en Chile y cuya malignidad se asocia a infecciones por el virus del papiloma humano (HPV), es el carcinoma cérvico-uterino. Para evaluar la progresión del carcinoma cervical, se montó y estandarizó, como una aproximación experimental in vitro, un ensayo de cierre de herida, que permite analizar la participación de mediadores en la velocidad de migración celular, como la distancia entre los extremos de la herida, en el tiempo. Se utilizó como modelo de estudio las células SW-756, que corresponde a una línea de carcinoma escamoso epitelial cérvico-uterino humano HPV18 positivas. Los resultados muestran que las células SW756 poseen la habilidad de migrar, pero no de proliferar en respuesta a la herida en un medio libre de suero y suplementado con TNF-α. El cierre de la herida fue significativamente incrementado en presencia de TNF-α comparado con medio solo y en presencia del anticuerpo anti- TNF-α sugiriendo un nuevo e importante rol del TNF-α en la progresión de cáncer cervical.
Proyecto FONDECYT 1020458

Evaluación del rol de microtúbulos en la biogénesis de peroxisomas humanos (An evaluation of the role of microtubules in human peroxisome biogénesis). Toro A. y Santos M. J. Laboratorio de Bioquímica Celular y Genética, Facultad de Ciencias Biológicas, Pontifica Universidad Católica de Chile Financiamiento: FONDECYT 1040792

Los peroxisomas son organelos presentes en virtualmente todas las células eucariontes. Dentro de sus funciones, destacan la β-oxidación de ácidos grasos y la degradación de H2O2. En la actualidad, el modelo aceptado para la biogénesis peroxisomal (BP) establece el crecimiento y división de organelos preexistentes, excluyendo una síntesis de novo y una participación del retículo endoplásmico. En el presente trabajo reportamos que una mutación en el gen Pex3, causa una severa afección en la BP en fibroblastos provenientes de un paciente chileno. Estas células carecen de una membrana peroxisomal discernible, y sus proteínas se localizan mayoritariamente en las mitocondrias. La transfección del gen de la proteína de fusión Pex3wt-GFP (Green-Fluorescent-Protein), en estos fibroblastos, produce la aparición de peroxisomas normales. Estudios recientes han mostrado un papel importante de los microtúbulos en el inicio de la BP. Por ello, previo a la transfección, incubamos a las células defectuosas en Pex3 con Nocodazole (droga que desensambla los microtúbulos), tratamiento que no inhibió la formación de peroxisomas. Así mismo, la destinación peroxisomal de la proteína Pex3wt-GFP, transfectada en fibroblastos controles tratados igualmente, no fue afectada. Nuestros datos confirman un rol esencial de la proteína PEX3 en la BP, y descartarían una participación de los microtúbulos en su función.

 

GENÓMICA Y PROTEÓMICA EN MACROALGAS MARINAS: IDENTIFICACIÓN DE FACTORES INVOLUCRADOS EN MECANISMOS DE TOLERANCIA A COBRE (Genomics and proteomics in seaweeds: identification of factors involved in copper tolerante mechanisms). 1Contreras, L., 2Dennett, G., 2Moenne, A. y 1Correa, J. A. 1Departamento de Ecología & Center for Advanced Studies in Ecology and Biodiversity, PUC. 2Facultad de Química y Biología, USACH.

El estudio del ecosistema marino costero afectado por altos niveles de cobre en el norte de Chile (Chañaral, III Región) ha permitido identificar algunas especies de macroalgas altamente tolerantes a este metal entre las que se encuentra Scytosiphon lomentaria (Phaeophyceae). El estudio a nivel bioquímico en esta especie evidenció que S. lomentaria tolera altos niveles de cobre mediante la activación de diversas enzimas antioxidantes y el consumo de distintos compuestos antioxidantes hidrosolubles. Utilizando técnicas moleculares, se detectó un aumento en el nivel de los transcritos de una proteína que secuestra metales (metalotineina) y de la enzima antioxidante ascorbato peroxidasa. Esto indica que distintos tipos de proteínas participan en el mecanismo de tolerancia a cobre en S. lomentaria. Debido a que existe escasa información sobre otros mecanismos de tolerancia a metales pesados en macroalgas, el análisis de los factores involucrados en este fenómeno a nivel genómico y proteómico en S. lomentaria, nos permitirán conocer los mecanismos de respuesta global al estrés oxidativo generado por metales pesados.
Financiado por Programa Bicentenario-CONICYT a Red de Genómica Marina-Chile

CLONAMIENTO Y EXPRESIÓN DEL RECEPTOR DE PROLACTINA DE SALMÓN DEL ATLÁNTICO (Salmo salar). (Cloning and expresión of prolactin receptor from Atlantic salmon (Salmo salar). Paredes, M., Kausel, G. y Figueroa J. Instituto de Bioquímica, Facultad de Ciencias, Universidad Austral de Chile.

Existen datos que sugieren que prolactina (PRL) y su receptor (rPRL) estarían implicados en modulación inmunológica en peces. En trucha (Salmo trutta), PRL está relacionada con la activación de células asesinas naturales (natural killer cell), producción de anticuerpos, actividad sero-hemolítica e incremento del título plasmático de inmunoglubulina M. Adicionalmente, la expresión del receptor de prolactina en leucocitos circulantes de trucha arcoiris y tilapia sugiere el papel inmunorregulador de prolactina en teleósteos.
Una estrategia de amplificación por PCR ha permitido clonar gran parte del cDNA del rPRL en S. salar y establecer homologías y comparaciones filogenéticas con otros rPRL de peces.
Para establecer un posible rol inmunomodulador de PRL y su receptor en salmón, se evaluó la expresión del rPRL en diferentes tejidos linfoides del pez por medio de RT-PCR e Inmunohistoquímica. Para ello se comparó peces sanos con peces desafiados a patógenos bacterianos (Piscirickettsia salmonis y Vibrio ordalii). Resultados preliminares muestran expresión del rPRL en células intersticiales de riñón anterior, riñón medio, leucocitos periféricos, bazo y tejido linfoide asociado a intestino y branquias. Se detectó además expresión diferencial entre peces sometidos a desafió y peces no desafiados. Estos resultados sugieren una posible participación de PRL y su receptor en funciones inmunomoduladoras en salmón del Atlántico.
Proyecto FONDECYT 1040073.

 

PARÁMETROS CINÉTICOS DEL CULTIVO DE Serratia fonticola PARA EL CONTROL BIOLÓGICO DE Deroceras reticulatum. (Growth kinetics parameters of Serratia fonticola for the biological control of Deroceras reticulatum) Gajardo, S. 1, Oyarzún, P. 1, Reyes, M. 1, Zemelman, R. 1, Canales, C. Ñancucheo, I. 1, France A. 2 y Gerding, M. 2.
1Ingeniería en Biotecnología, Universidad San Sebastián, Concepción. 2Instituto de Investigaciones Agropecuarias, Centro Regional de Investigación Quilamapu, Chillán.

La participación de Serratia fonticola para controlar biológicamente poblaciones de babosa gris (Deroceras reticulatum), asociada al nematodo Qu-N12 (Raza Osorno), es conocida. En este trabajo se estudió la cinética de crecimiento del microorganismo a 3 temperaturas (30ºC, 35ºC y 37ºC), 3 velocidades de agitación (200 rpm, 250 rpm y 300 rpm), en un medio complejo (CASO) y en un medio definido, usando un diseño experimental factorial 32 en cultivo batch en shaker, esperando una biomasa estimada en 2 g/L. La biomasa bacteriana fue cuantificada por turbidimetría. En el medio complejo se obtuvo un óptimo de productividad volumétrica de biomasa de 0, 15 g/L·h a 30° C y 259 rpm. En el medio definido este óptimo fue de 0, 069 g/L·h a 30° C y 300 rpm. Además, se obtuvo un m óptimo de 0, 81 h-1 a 37° C y a 300 rpm en el medio complejo y de 0, 57 h-1 a 37 ° C y 286 rpm en el medio definido. Se concluye que, de los medios estudiados, el medio complejo ofrece mejores condiciones para el crecimiento de este microoganismo que el medio definido.
Proyecto INNOVA BIOBIO 03-B1-207-L1

 

RATAS BEBEDORAS TRATADAS CON UN VECTOR ADENOVIRAL QUE EXPRESA EL GEN ANTISENTIDO ANTI-DESHIDROGENASA ALDEHÍDICA DISMINUYEN SU CONSUMO DE ALCOHOL. (Rats bred as heavy alcohol drinkers reduce their consumption when treated with an adenoviral vector that expresses an anti-aldehyde dehydrogenase antisense gene). Ocaranza, P.1, 2, Quintanilla, M. E.3, Tampier, L. 3, Sapag, A.2, Karahanian, E.4, Israel Y2. 1Programa Doctorado en Bioquímica, 2Laboratorio de Farmacoterapia Génica, Facultad de Ciencias Químicas y Farmacéuticas, 3Laboratorio de Farmacogenética del Alcoholismo, Facultad de Medicina, Universidad de Chile y 4Facultad de Ciencias de la Salud, Universidad Diego Portales.

Una enzima crítica en el metabolismo del etanol es la deshidrogenasa aldehídica-2 (ALDH2). Los individuos con una mutación inactivante en este gen están protegidos contra el alcoholismo por un aumento en los niveles de acetaldehído circulante.
Una estrategia en estudio para tratar el alcoholismo es bajar la actividad de la ALDH2 por transducción hepática de un vector adenoviral portador de un gen antisentido de la ALDH2 (AdV-ALDH-AS). En estudios in vitro, la transducción de células de hepatoma de rata con AdV-ALDH-AS produce una marcada disminución en la actividad ALDH2 y un aumento significativo en los niveles de acetaldehído cuando están expuestas a etanol (ver Karahanian et al; este Congreso).
En estudios siguientes se prepararon en títulos altos AdV-ALDH-AS y AdV-control. Se administraron (1012 pfu/kg) por vía intravenosa a ratas UChB (ratas bebedoras desarrolladas en la Universidad de Chile). Las ratas que recibieron AdV-ALDH-AS disminuyeron su consumo de alcohol en 65%, consumo que se mantuvo a niveles bajos durante 20 o más días. La administración del AdV-control no afectó el consumo de alcohol de los animales.
FONDECYT 1040555, Iniciativa Científica Milenio P99-031F.

 

FISIOLOGÍA VEGETAL

LA DISPONIBILIDAD DE AGUA LIMITA LA TOLERANCIA AL DAÑO EN LA PLANTA Madia sativa (water availability limits tolerance to apical damage in the tarweed Madia sativa) Gonzáles W. L., Suárez L. H., Molina-Montenegro M. A., Gianoli E. Departamento de Botánica, Universidad de Concepción, Casilla 160-C, Concepción-Chile. wgonzales@udec.cl

La tolerancia es la habilidad de las plantas de reducir el impacto del daño sobre su adecuación biológica. Se ha investigado intensivamente el efecto de los nutrientes sobre la tolerancia; sin embargo, las consecuencias de la disponibilidad hídrica han recibido menos atención. Evaluamos en la planta Madia sativa (Asteraceae) el efecto de la disponibilidad hídrica (alta y baja) sobre la tolerancia al daño apical (simulando manualmente el ataque de sus insectos herbívoros). Medimos el número de cabezuelas con semillas y el total de cabezuelas como medidas de adecuación biológica, y la tasa fotosintética, número de ramas, la razón biomasa radicular/aérea como posibles mecanismos de tolerancia. Encontramos que en alta disponibilidad hídrica, hay tolerancia al daño, y las plantas dañadas mostraron mayor producción de ramas, incremento en la tasa fotosintética, aunque se mantuvo la razón biomasa aérea/radicular en relación a las plantas sanas. En baja disponibilidad hídrica, las plantas dañadas redujeron aproximadamente 43% ambos componentes de adecuación biológica, se incrementó la producción de ramas, la tasa fotosintética se mantuvo constante, y la razón biomasa aérea/radicular disminuyó en relación a las plantas sanas. Mostramos evidencia que la disponibilidad hídrica limitó la tolerancia al daño y afectó diferencialmente los mecanismos de tolerancia en M. sativa.
Proyecto-postdoctoral FONDECYT-3040036

Ambientes lumÍnicos ocupados por árboles juveniles en dos sitios de precipitaciones estivales contrastantes (Light environment occupied by tree sapling in two sites with contrasting summer precipitation) Atala, C* & Lusk, C+
* Becario CONICYT. Depto. botánica, UDEC.
+ Macquarie University, Australia.

Se ha postulado que existe un compromiso entre la tolerancia a la sombra y la tolerancia a la sequía en las plantas. Este compromiso se basa principalmente en la incompatibilidad en la asignación de recursos sobre y bajo el suelo y a requerimientos fotosintéticos en cada caso. Si esto es cierto, las plantas de sitios húmedos deberían tolerar más sombra que plantas de sitios con algún grado de sequía. En presente estudio, se midieron los ambientes lumínicos ocupados por plántulas de tres especies leñosas: Aextoxicon punctatum, Aristotelia chilensis y Luma apiculata, que co-ocurren en sitios de la VII y X región. Dichos sitios difieren ampliamente en régimen de precipitación estival. Se determinó el ambiente lumínico al que crecen plantas midiendo el % de luz difusa sobre la planta. La tolerancia a la sombra fue evaluada como el percentil 5 del total de ambientes lumínicos ocupados (límite inferior). Los resultados indican que en el sitio de la X R, de mayor precipitación estival, las plántulas crecen en sitios más oscuros que en la VII R. Este resultado apoya la teoría del compromiso entre sombra y sequía.
Agradecimientos: FONDECYT 1980084, Millenium Nucleus for Advanced Studies in Ecology and Biodiversity.

 

PROCESOS FISIOLÓGICOS AFECTADOS POR LA INFECCIÓN VIRAL EN Vitis vinifera (Physiological processes affected by viral infection in Vitis vinifera) Vega, A., Espinoza C., Medina C. y Arce, P. Facultad de Ciencias Biológicas. Pontificia Universidad Católica de Chile.

Uno de los principales problemas que afectan a las vides son las infecciones virales, las cuales causan enfermedades crónicas sin que se hayan descrito reacciones de resistencia. Esta infección genera cambios fisiológicos en la planta, que se traducen en una disminución en el crecimiento, alteraciones en la maduración y calidad de los frutos, entre otros. Los síntomas que causan los virus han sido previamente descritos pero se desconocen los procesos fisiológicos involucrados en la infección. El objetivo de este trabajo es estudiar en forma global los cambios moleculares que ocurren en las vides durante las infecciones virales. Se utilizaron plantas de dos cultivares de Vitis vinifera (Cabernet sauvignon y Carmenere) y el Virus del Enrollamiento de la Hoja de la Vid 3 (GLRaV3). Se realizó análisis de la expresión génica en hojas provenientes de plantas sanas e infectadas. Se hibridó cRNA en el microarreglo GeneChip de Affymetrix que contiene 14000 unigenes de V. vinifera, realizando tres replicas biológicas para cada condición. Se identificaron 692 genes en cv Cabernet Sauvignon y 341 genes en cv Carmenere con expresión diferencial entre las plantas infectadas y las plantas sanas. El análisis funcional de estos genes indica que diversos procesos metabólicos, como también la síntesis de proteínas, la transducción de señales y la respuesta de defensa se encuentran afectados por la infección viral.
Proyecto FONDEF G02S1001

CAMBIOS VEGETACIONALES, DURANTE LOS ÚLTIMOS 77 AÑOS EN LA CUENCA DEL LAGO LAJA (VIII REGIÓN, CHILE), INFERIDOS DESDE EL REGISTRO POLÍNICO LACUSTRE: ¿IMPACTO HUMANO O CAUSAS NATURALES?. (Vegetation changes, during the last 77 years in the Laja lake basin (VIII region, Chile), inferred from lacustrine pollen record. Human impact or natural cause?) Torres L1, Urrutia R2, Parra O2, Araneda A2, Cruces F1 & L Chirinos2
1
Departamento de Botánica, Universidad de Concepción. 2Centro EULA-Chile, Universidad de Concepción.

Se presentan los cambios vegetacionales durante los últimos 77 años en la cuenca del lago Laja (36° 54´S; 71º 05´O). Para esto, se analizaron los ensambles polínicos de una columna sedimentaria que fue datada con 210Pb y 137Cs.
Los resultados muestran que la comunidad vegetal entre 1928 y 1935 estuvo dominada por el género Nothofagus y Austrocedrus chilensis. Con menor porcentaje se encontraron Ephedra chilensis y la familia Poaceae. Desde 1935 y hasta 1961 el componente no arbóreo domina la comunidad vegetal. Posterior al año 1961 y hasta la actualidad nuevamente los taxa arbóreos predominan en la cuenca. Desde el año 1948 aparecen en el registro taxa indicadoras de intervención antrópica como Pinus radiata y Plantago lanceolata. Durante los 77 años de estudio el influjo o tasa de acumulación de polen (granos de polen/cm2*año) experimentó cada cierto tiempo aumentos importantes en sus valores. Se concluye que los cambios estarían relacionados a factores naturales, específicamente variaciones en los niveles de precipitación, y antrópicas.
Agradecimientos: CONICYT, DIUC N° 203. 310. 35-1.

 

DISTRIBUCIÓN, ABUNDANCIA Y VEGETACIÓN ACOMPAÑANTE DE CUATRO ESPECIES NATIVAS ARBUSTIVAS PROMISORIAS (Abundance, distribution and associated vegetation for four native promissory species) San Martín, J1., H. Vogel2 & B. González2. 1 Instituto de Biología Vegetal y Biotecnología y Escuela de Agronomía, Facultad de Ciencias Agrarias, Universidad de Talca, Casilla 747 Talca.

La distribución espacial de las especies vegetales es modelada, entre otros factores, por la topografía, naturaleza del sustrato, clima, recursos, etc. Por otro lado, la abundancia es también controlada por la competencia, enemigos naturales y la depredación. Esta interacción es relevante cuando opera de modo silencioso y sostenido en el tiempo. La consecuencia es un impacto modificatorio en la abundancia y distribución horizontal.
Para cuatro especies arbustivas promisorias nativas del género Haplopappus, Asteraceae, se estudió su distribución y abundancia con registros de la vegetación acompañante. El objetivo es ampliar la información corológica y cuantitativa a causa de su interés comercial y el desconocimiento de su estado en el ambiente natural. Como hipótesis se plantea que la depredación por colecta afecta la configuración espacial de las poblaciones así como la potencialidad de la regeneración y recuperación la biomasa.
En las regiones III, V y VII por la ladera occidental del cordón cordillerano andino se estudiaron las poblaciones de cuatros especies de Haplopappus de crecimiento arbustivo y xeromorfos.
Se encontró que las especies y poblaciones se distribuyen en altitudes de 800 a 3. 800 msnm con altas temperaturas estivales y influencia permanente de viento. En 135 parcelas con una superficie total de 13. 500 m2 se encontraron 3. 477 plantas. La cobertura oscila entre un 10 y 80 % encontrándose, aproximadamente, 1 individuo cada 4 metros. La diversidad varía en dirección altitudinal y latitudinal con incremento de ella y tamaño de los individuos en las especies acompañantes hacia posiciones meridionales. Si bien la topografía contribuye a una oferta de habitats de refugio, las poblaciones son igualmente buscadas, colectadas y en algunos casos ramoneadas por animales. El 80, 4 % de las plantas se encontró en estado reproductivo, pero la regeneración por semillas y el reclutamiento de individuos es prácticamente nulo.
Se concluye que la actividad de colecta es el principal factor de cambio en la abundancia y posición espacial de las poblaciones. Supuestamente los factores físicos del medio limitan la regeneración natural dado que en condiciones in situ se obtuvo germinación y sobrevivencia de las plántulas. Se sugiere intensificar los muestreos para completar el diagnóstico del estado de las poblaciones y estudiar el status de conservación de las especies.
Agradecimientos: Manfred Hermesen Stiftung y Universidad de Talca

 

LENTO TRÁNSITO A LA HOMOGENEIZACIÓN FLORÍSTICA EN LAS ISLAS OCEÁNICAS DEL PACÍFICO SUR ORIENTAL (Slow transit toward floristic homogenization on oceanic islands of the southeastern Pacific) Castro S.A. & Jaksic F.M. Pontificia Universidad Católica de Chile. E-mail: scastro@bio.puc.cl.

Las islas oceánicas son ecosistemas de importancia global debido a que contienen biotas con altos niveles de endemismo. Sin embargo, la influencia humana ha modificado profundamente su composición. En este artículo evaluamos si seis islas oceánicas del Pacífico Sur Oriental se encuentran en proceso de homogeneización. Para ello, reconstituimos la composición específica de la flora original (pre-colonización europea) y actual (post-colonización europea); esta última incorporó a las especies naturalizadas y excluyó a las extintas. En ambos casos, calculamos la similitud florística utilizando el índice de Jaccard. Los resultados indican que actualmente existe un mayor número de especies compartidas entre las islas, además de un incremento en la similitud florística que en promedio fue de un 2%. Considerando la baja tasa de naturalización de plantas vasculares comparada con otras áreas continentales, así como lo reducido del incremento en similitud comparado con otros estudios, sugerimos que la velocidad relativa de este proceso es más lenta que la documentada para otros sistemas ecológicos.
Agradecimientos: SC agradece a DIPUC y fundación FUFAJA.

MICROBIOLOGÍA MÉDICA

LA HEMOLISINA/CITOLISINA HlyE DE Salmonella Typhi FAVORECE LA INVASIÓN A CÉLULAS EPITELIALES HUMANAS HEp-2 (The Salmonella Typhi Cytolysin/Hemolysin HlyE Promotes Invasion of Human Epithelial Cells HEp-2). Fuentes, J. 1, Castro, D. 1, Retamal, P. 1, Castillo, M. 1 y Mora, G. 2. 1Laboratorio de Microbiología, Facultad de Ciencias Biológicas, Pontificia Universidad Católica de Chile. 2Laboratorio de Microbiología, Facultad de Ciencias de la Salud, Universidad Andrés Bello.

Salmonella Typhi es el agente etiológico de la fiebre tifoidea en humanos, su único hospedero conocido. HlyE, el homólogo (>90% identidad) de la hemolisina/citolisina ClyA descrita por primera vez en E. coli K12, es el determinante genético del fenotipo de hemólisis observado en la cepa vacuna S. Typhi Ty21a. Aunque se sabe que HlyE es funcional en Ty21a, nunca se había visto que cepas clínicas de S. Typhi presentaran hemólisis. Recientemente, nuestro laboratorio reportó que efectivamente es posible ver este fenómeno en distintas cepas clínicas y en la cepa de referencia Ty2 al desestabilizar la membrana bacteriana mediante distintos métodos. Actualmente, no se conoce cuál es el papel que desempeña HlyE en la patogenicidad de S. Typhi. Mediante ensayos de protección a gentamicina se comparó la invasión de la cepa silvestre y de mutantes hlyE en células epiteliales HEp-2. Se encontró que las mutantes presentan defectos de invasión con respecto a la cepa parental. Estos datos indican que HlyE participa en la invasión de células epiteliales humanas y puede representar un nuevo factor de virulencia en Salmonella Typhi aún no explorado. Financiamiento: FONDECYT 1020485. J. F., D. C. y P. R. son becarios CONICYT.

 

POLIMORFISMO EN GENES ASOCIADOS A FACTOES DE VIRULENCIA EN CEPAS DE Actinobacillus actinomycetemcomitans AISLADAS DESDE PACIENTES CHILENOS CON ENFERMEDAD PERIODONTAL (Polymorphism in genes associated to virulence factors in strains of Actinobacillus actinomycetemcomitans isolated from chilean patients with periodontal diseases) León, R. 1, Díaz, MC. 1, Maturana, C. 1, Gamonal J. 2, Hidrobo, R. 1 y Vernal, R. 2 1Laboratorio de Bioquímica y Biología Oral. 2Laboratorio de Biología Periodontal, Facultad de Odontología, Universidad de Chile.

Actinobacillus actinomycetemcomitans es una bacteria Gram negativa, que ha sido implicada en el desarrollo de la enfermedad periodontal. No obstante, este microorganismo también ha sido asociado a una variedad de enfermedades sistémicas humanas como endocarditis, meningitis y osteomielitis.
Se han descrito diferentes factores de virulencia para A. actinomycetemcomitans, entre ellos se encuentran dos toxinas de origen proteico, Leucotoxina (LKT) y CDT (Cytolethal Distending Toxin). LKT lisa leucocitos polimorfonucleares y se ha determinado que CDT actúa sobre fibroblastos gingivales, linfocitos T y otros tipos celulares.
En este estudio se ha determinado mediante PCR-RFLP al menos 4 patrones de restricción, al digerir con HindIII el operon que codifica la toxina CDT.
Por otra parte, hemos encontrado tres cepas clínicas que presentan una deleción en la región promotora del gen que codifica LKT. Lo que se describe como una mutación que provoca sobre-expresión del gen con asociación a un tipo de enfermedad periodontal más agresiva.
El presente trabajo corresponde al primer reporte donde se analiza a nivel molecular algunos de los factores de virulencia de esta bacteria en aislados clínicos provenientes desde pacientes chilenos.
Financiamiento: Proyecto FONDECYT 1050518.

 

ACTIVIDAD ANTIBACTERIANA DE NUEVOS COMPUESTOS POLINUCLEARES DE COBRE Y COBALTO (The antibacterial activity of new copper and cobalt polynuclear compounds) Corsini, G.,1 Cortés, P.2 y Atria, A. M.2 1Facultad. Ciencias de la Salud, Universidad Diego Portales, 2Facultad Ciencias Químicas y Farmacéuticas, Universidad de Chile.

En búsqueda de nuevos sistemas polinucleares de metales de transición se sintetizaron tres nuevos compuestos tetranuclerares de cobre (II) y un compuesto de cobalto (II), los cuales han sido caracterizados estructuralmente por técnicas de difracción de rayos X de monocristal.
Se ha determinado que los compuestos de cobre son de fórmula general [Cu4OCl6L4] (L=2-metil-imidazol, piridina-N-óxido, 4-fenil-imidazol, donde los átomos de cobre se encuentran en un arreglo tetraédrico dispuesto en torno a un átomo de oxígeno m4-oxo central. El compuesto de cobalto (II) sintetizado es una especie aniónica dimérica de fórmula [Co2(OH)2(Ac)3(Bipy) 2]·K·2(H2O) (Ac: acetato, Bipy: 2, 2`-bipiridina), en la cual los átomos metálicos están conectados por dos puentes m2-hidroxo y por ligantes acetatos. Los átomos de cobalto se encuentran una geometría octaédrica distorsionada.
Se probó el efecto antibacteriano in vitro de estos compuestos, empleando el método de difusión en agar con discos de papel. Los complejos de cobre con 2-metil-imidazol y piridina-N-óxido presentan actividad solo sobre bacterias Gram negativas, en cambio el complejo con 4-fenil-imidazol posee actividad tanto sobre bacterias Gram positivas como sobre Gram negativas. El complejo de Co también posee actividad antimicrobiana sobre bacterias Gram positivas y negativas con una MIC de 500 mg/mL para Staphylococcus aureus y Escherichia coli, y de 375 mg/mL para Pseudomonas aeruginosa.

 

LA DISTRIBUCIÓN MODAL DEL ANTÍGENO O AFECTA LA RESISTENCIA AL SUERO EN ENTEROBACTERIAS. (Modal distribution of the O antigen affects serum resistance in enterobacteria). Bravo, D., Hoare, A., Carter, J., Zamorano, A., Álvarez, S., Zaldívar, M. y Contreras, I. Facultad de Ciencias Químicas y Farmacéuticas, Universidad de Chile.

El lipopolisacárido (LPS) es el componente mayoritario de la membrana externa y constituye un importante factor de virulencia en bacterias Gram negativas. Está formado por tres dominios unidos covalentemente: lípido A, "core" y antígeno O (AgO). Se ha reportado que en bacterias Gram-negativas, las moléculas de AgO de alto peso molecular protegen contra el sistema del complemento. En este trabajo analizamos el efecto del largo preferente de cadena (distribución modal) del AgO sobre la resistencia al suero en tres enterobacterias: Salmonella enterica sv. Typhi, Salmonella enterica sv. Typhimurium y Shigella flexneri. S. Typhi, que presenta un largo preferente de 30 unidades repetidas, resultó más sensible al suero que las otras especies, que tienen una distribución bimodal del AgO con largos preferentes de 17 y 90 unidades (S. flexneri) y 30 y 100 unidades (S. Typhimurium). Las tres especies mostraron una regulación de la producción de AgO dependiente de la fase de crecimiento. Sin embargo, esta modulación afectó en forma diferencial la distribución modal, lo que afectó la sensibilidad de las bacterias a la acción lítica del suero. En conjunto, nuestros resultados apoyan la idea que la presencia de AgO de alto peso molecular dificulta la acción lítica del complemento.
Financiamiento: FONDECYT 1040562

 

Estudio comparativo de la virulencia de dos aislados chilenos de vibrio ordalii (Comparative study on the virulence of two Chilean isolates of Vibrio ordalii) Miquel A., Peralta G., Valenzuela P. D. T., Burzio L. O. BiosChile I. G. S. A., Fundación Ciencia para la Vida y MIFAB, Zañartu 1482, Santiago.

A mediados del año 2003, resurgió con inesperada virulencia un patógeno causante de vibriosis. La especie más afectada corresponde a salmón del Atlántico (S. salar) con registros de mortalidad acumulada entre un 8% a un 15% por centro de engorda en la isla de Chiloé. La bacteria asociada a vibriosis del salmón atlántico en Chile, es un bacilo Gram negativo, con un flagelo polar y altamente polimórfico.
El análisis filogenético por secuenciación del ARN 16S de dos aislados obtenidos de dos centros independientes, presentó un 99% de homología con V. ordalii, sin embargo, de acuerdo a los ensayos bioquímicos, no codifican para las especies de vibrio conocidas, lo que ha llevado a clasificar esta especie como un V. ordalii atípico, diferente al V. ordalii clásico que se presenta en el hemisferio norte. Ambos aislados presentan ciertas diferencias morfológicas las que son visibles a través de microscopía electrónica de transmisión. Mediante un estudio de dosis letal 50% (LD50) en salmón atlántico, se pudo establecer que uno de los aislados es altamente virulento.
En este trabajo hemos aislado, clonado y expresado los genes de flagelina (flaA), porina (OmpU) y metaloproteasa (empA) del aislado chileno virulento de V. ordalii. (FONDEF AQ04I1010 and DI 22-04, U. Andrés Bello).

 

PRESENCIA DE INTEGRONES EN BACILOS GRAM NEGATIVOS RESISTENTES A ANTIMICROBIANOS AISLADOS EN EL HOSPITAL TORRES GALDAMES DE IQUIQUE Moraga M. R., Edgardo Santander P., Teresa Arias C. y *Fermín Méndez A.
Lab. Microbiología, Dpto. Cs. del Mar. U. Arturo Prat. *Lab.clínico Hospital Torres Galdames e-mail: rmoraga@unap.cl Financiamiento DI-04/2004

Miembros de la familia Enterobacteriaceae y algunos bacilos gram negativos no fermentadores han adquirido gran importancia como patógenos en las últimas décadas. Estos han sido identificados como agentes causantes de infecciones en ambientes nosocomiales y de la comunidad. Por otra parte el mal uso de los antibióticos ha posibilitado la selección de cepas que presentan una elevada resistencia a los agentes antimicrobianos, esto conjugado con la existencia de elementos genéticos móviles, potencian la diseminación de esta resistencia.
En este estudio se analizaron aislados clínicos provenientes de distintos servicios del Hospital Torres Galdames, en los cuales se estudio la presencia de integrones y su asociación con el fenotipo de resistencia.
Se analizaron 88 cepas provenientes de muestras de secreciones y orina de pacientes ingresados al Hospital Regional de Iquique, durante el periodo junio-diciembre del 2004. Estas fueron identificadas por sus propiedades bioquímicas. Se determino la susceptibilidad a los agentes antibacterianos mediante el método de difusión en agar, según lo indicado por la NCCLS (2004). La presencia del gen de la integrasa (clase 1, 2 y 3) se analizo mediante PCR. Se realizo un análisis de cluster para evaluar la relación entre la presencia de integrones y el fenotipo de resistencia.
De las cepas aislados el 18% correspondieron a P. mirabilis, el 17% a E. coli, y un 14 % a BGN NF. Un gran porcentaje de las cepas presento una elevada resistencia a los antimicrobianos ensayados. El 83% de las cepas fue resistente a Ampicilina, el 85% a Cefolotina, un 82% fue resistente para Ciprofloxacino, 81% a Gentamicina y el 82% fue resistente a sulfametoxazol.
De las 88 cepas el 75% de estas presentaron integrones, siendo el más frecuente el de clase 2. Al realizar un análisis de clasificación no se pudo determinar una clara relación entre los fenotipos de resistencia y la presencia de integrones.

 

COLONIZACIÓN DE UNA CEPA DE Lactobacillus acidophilus LVP31 POTENCIALMENTE PROBIÓTICA, EN UN MODELO VAGINAL MURINO (Colonization of probiotic L. acidophilus strain, in a vaginal murine model). Castro, E1-2., Pérez, L2., Sánchez, M2., Oñate, A3., Ferrer, J2-4., Montecinos, H5., Bórquez2-4, R. Depto. Obstetricia y Puericultura1, Lab. Bacterias Lácticas2, Depto. Microbiología3, Depto. Ingeniería Química 4, Depto. Histología 5. U. Concepción.

El género Lactobacillus se emplea cada día más para restaurar o mantener una microbiota urogenital normal. Se evaluó la capacidad de adherencia, permanencia y reacción en la mucosa vaginal de ratones BALB/c, de una cepa de L. acidophilus (LVP31) potencialmente probiótica. Se consideró una cohorte previamente estrogenizada, donde un grupo recibió placebo y otros, 50ml de la cepa LVP31 cada 12 y 24 horas durante dos días, a una concentración de 107 UFC/50ml. Se realizaron lavados vaginales los días 1, 3, 5, 8 y 14 días post inoculación, para realizar cultivos en los medios para Lactobacillus spp., evaluando las propiedades de hidrofobicidad y producción de peróxido de hidrógeno de las cepas obtenidas. También se realizaron sacrificios para estudio histológico. Los resultados fueron promisorios, ya que la cepa en estudio fue capaz de adherirse y permanecer en la mucosa vaginal hasta 8 días post inoculación, conservando sus propiedades originales. En los cortes histológicos de los ratones inoculados con la cepa, se observó una respuesta inmune, sin observar ningún efecto colateral. Se dispone de una cepa de Lactobacillus para ser ensayada en humanos como potencial probiótico vaginal.
Investigación desarrollada con aportes del Proyecto FONDEF N°DO1I1121.

 

COMPARACIÓN DE LA ACTIVIDAD DE LA PROTEASA, HEMOLISINA Y PRODUCCIÓN DE BACTERICOCINAS EN CEPAS EN ENTEROCOCCUS AISLADAS EN HUMANOS, POLLOS Y AGUAS SERVIDAS. (Comparison of the activity of protease, hemolysin and production of bacteriocins in strains of Enterococcus isolated in humans, chickens and sewage samples. Silva J1, Rodriguez Y1, Araya J1, Baquero F2 y del Campo R2. 1Depto Tecnología Médica-INDES, Universidad de Antofagasta. E-mail: jsilva@uantof.cl. 2Departamento de Microbiología, Hospital Ramón y Cajal, Madrid, España.

Enterococcus han sido generalmente considerados como bacterias de virulencia limitada, sin embargo hoy en día, son una de las mayores causas de infecciones nosocomiales. Varios factores de virulencia han sido reconocidos en los Enterococcus, especialmente en E. faecalis. En Chile, existe escasa información acerca de los factores de virulencia presentes en Enterococcus. El objetivo de este estudio fue comparar las diferencias de la actividad de algunos factores de virulencia en cepas de Enterococcus aisladas en Antofagasta. Un total de 114 cepas de E. faecalis fueron seleccionadas; 52 cepas de origen clínico, 28 de pollos y 34 de aguas servidas. La actividad de la proteasa fue determinada en agar tripticasa con 1,5% de leche descremada, hemolisina en agar tripticasa con 5% de sangre de cordero y bacteriocinas por medio de 22 cepas indicadoras diferentes. El mayor factor de virulencia correspondió a la producción de bacteriocinas 52,6%, seguidas de la actividad proteasa 47,4% y menor proporción la hemolítica 24,6%. En las cepas de E. faecalis de origen clínico se encontraron valores más altos para bacteriocinas 69,2%, en las cepas de pollos fueron las proteasas 71,4% y en las cepas de aguas servidas se detectaron hemolisinas 35,3 %. Los 3 factores de virulencia juntos; bacteriocinas, hemolisinas y proteasas fueron encontrados solamente en cepas clínicas de E. faecalis. Se concluyen que cepas de E. faecalis en el norte de Chile presentan factores de virulencia que contribuyen a su patogenicidad.
Financiamiento: Proy. PROIM1357, DINV, Univ. De Antofagasta y Fundación Andes C-.

 

ECOLOGÍA VEGETAL

LOS EFECTOS DE ARBUSTOS, HERBIVORÍA Y LLUVIA EN LA ESTRUCTURA Y DINÁMICA DE PLANTAS EFÍMERAS EN UN ECOSISTEMA COSTERO SEMIÁRIDO DEL NORTE-CENTRO DE CHILE. (The effects of shrubs, herbivory and rainfall on the structure and dynamics of ephemeral plants in a coastal semiarid ecosystem of north-central Chile). Gutiérrez, J. R.1, 2, Squeo, F. A.1, 2, Aguilera, L. E.1, Meserve, P. L.3 & Kelt, D. A.4. 1Universidad de La Serena, 2Centro de Estudios Avanzados en Zonas Áridas, 3Northern Illinois University, USA, 4University of California, Davis, USA.

Analizamos los efectos simples y combinados de arbustos, herbivoría y lluvia en la estructura y dinámica de plantas efímeras (i. e., anuales y geofitas) en el Parque Nacional Bosque Fray Jorge, IV Región, Chile por dos años (2003-2004). Este parque está protegido de pastoreo desde 1941. La cobertura arbustiva en el sitio de estudio es de 60%. Las especies arbustivas dominantes son: Porlieria chilensis, Adesmia bedwellii y Proustia pungens. Ellas difieren en forma, densidad foliar, cobertura del follaje y sistemas radiculares. Este parque tiene también un ensamble diverso de micromamíferos mayoritariamente herbívoros. Mostramos que los efectos simples y combinados de arbustos, herbivoría por micromamíferos y la variación temporal de las lluvias dan cuenta de la alta diversidad de especies de plantas efímeras en este sistema. Evaluamos la importancia relativa de estos tres factores usando un diseño factorial y una aproximación experimental. Diferentes especies arbustivas generan parches de diferente calidad ambiental (e. g., microclima, nutrientes y humedad de suelo), proveyendo sitios adecuados para diferentes ensambles de plantas efímeras. La lluvia anual da cuenta de la variación temporal de los ensambles de plantas efímeras, pero la variación espacial de estos ensambles de plantas está determinado por la presencia de diferentes especies de arbustos. Las respuestas de las plantas efímeras a las lluvias dependen de la abundancia de herbívoros.
Financiado por Proyecto FONDECYT 1030225

 

IMPACTO DE PLANTAS INVASORAS EN LA CORDILLERA DE LOS ANDES: ¿ESTARÁN ALTERANDO EL SERVICIO DE POLINIZACIÓN PARA PLANTAS NATIVAS? (Impacts of invasive plants in the Andes: could they be altering pollinator service to native plants?). Muñoz, A. A. ECOBIOSIS, Departamento de Botánica, Universidad de Concepción, Concepción, Chile.

Invasiones biológicas son componentes claves de cambio global, potencialmente amenazando la biodiversidad. Por ende, resulta crucial entender sus efectos sobre comunidades nativas. Estoy evaluando los impactos de Taraxacum officinale (Asteraceae), planta introducida con capítulos florales vistosos, sobre la visita de polinizadores y producción de semillas en especies nativas en los Andes de Chile central. Basado en 510 observaciones de 15min y experimentos manipulativos en Valle Nevado a 2800 m. s. n. m. (verano 2004-2005), aquí reporto sobre el grado de sobreposición de polinizadores entre Taraxacum y 5 especies nativas co-ocurrentes con capítulos florales comparables (2 Hypochaeris, Haplopappus antilloides, Perezia carthamoides, Senecio bustillosianus), comparo sus tasas de visita sobre Taraxacum vs. nativas, y determino si las nativas dependen de la visita de polinizadores para producir semillas. Hubo moderada/alta similitud en la diversidad de polinizadores (30-60%) entre nativas y Taraxacum, incluyendo abejas (Andrenidae, Megachilidae) y moscas (Syrphidae, Tachinidae, Bombyllidae). La tasa promedio de visitas sobre Taraxacum fue de 0, 94 individuos/15min, siendo similar a aquellas sobre las nativas. La producción de semillas dependió de la visita de polinizadores, siendo en ausencia experimental de polinizadores <1, 3% comparado con 19-55% en plantas control. Taraxacum probablemente está afectando la polinización y reproducción de plantas nativas aledañas, ha evaluarse experimentalmente prontamente.
Agradecimientos: FONDECYT N°3050054

 

HÁBITO TREPADOR COMO ESTRATEGIA DE ESCAPE A LA HERBIVORÍA EN CONVOLVULUS CHILENSIS (CONVOLVULACEAE). (Climbing habit as an escape strategy to herbivory in Convolvulus chilensis (Convolvulacaea). González-Teuber, M., Suárez, L. H., Cavieres, L. A., Gianoli, E. ECOBIOSIS, Departamento de Botánica, Universidad de Concepción, Casilla 160-C, Concepción, Chile.

Las plantas pueden presentar patrones de crecimiento que minimicen el impacto de la herbivoría. Se ha sugerido que un crecimiento erecto podría disminuir el daño por herbívoros, y por lo tanto sería más beneficioso que un crecimiento postrado. Convolvulus chilensis es una especie que crece tanto en forma rastrera como trepadora, y que sufre altos niveles de herbivoría en condiciones naturales. Se evaluó el efecto del daño simulado sobre atributos morfológicos y reproductivos en individuos creciendo en dos ambientes lumínicos. Adicionalmente, se evaluó el efecto del daño y de la luz sobre la capacidad de enredo de los individuos. Se encontró que C. chilensis fue tolerante al daño en términos de supervivencia y reproducción. Por otra parte, el daño solo afectó la probabilidad de enredo de los rebrotes de los individuos, mientras que la sombra, en forma independiente, promovió el enredo de los tallos principales. Las plantas trepadoras presentaron mayor adecuación biológica que las plantas rastreras. Se concluye que el daño aumenta las probabilidades de que una planta de C. chilensis se enrede, considerándose esto como una estrategia de escape al daño, y que a la vez es beneficioso para la planta en términos de adecuación biológica.
Fondecyt 1030702 y CMEB P02-051-F ICM.

 

MANEJO DE BOSQUE NATIVO EN LA ISLA DE CHILOÉ: EFECTO SOBRE LA MINERALIZACIÓN DE NITRÓGENO Y NITRIFICACIÓN EN EL SUELO. (Native forest management in Chiloé island: effect on soil nitrogen mineralization) Tejo, C. F., Pérez, C. A., Armesto, J. J., Sagredo, V. & Carmona, M. R. Center for Advanced Studies in Ecology and Biodiversity. P. Universidad Católica de Chile; Fundación "Senda Darwin".
Patrocinio: Dr. Juan J. Armesto

Actualmente, los bosques templados de la Isla de Chiloé están siendo alterados a través del manejo forestal reduciendo la cobertura del dosel y extrayendo ciertas especies de valor maderero. Nuestro objetivo es evaluar los efectos de éstas prácticas sobre la circulación de nitrógeno, particularmente la mineralización, nitrificación y disponibilidad de N en suelos forestales. Este estudio fue realizado en la localidad de Melleico, al oeste de Chonchi, en una cuenca con bosques tipo Valdiviano. Se realizaron ensayos en dos niveles de profundidad del suelo, en bosques manejados e intactos, en cuencas adyacentes. Además evaluamos la importancia relativa de la nitrificación auto y heterotrófica en bosques manejados y control mediante ensayos de laboratorio. Resultados preliminares indican que no hay diferencias significativas en los niveles de N inorgánico disponible en suelo entre bosques en ninguno de los horizontes (t= 0, 029, P= 0, 978: suelo superficial; t= 0, 883, P= 0, 441: suelo profundo). Esto sugiere que la corta selectiva no tendría efecto sobre la disponibilidad de N en el suelo, aunque se requiere documentar los efectos a más largo plazo.
Fondecyt - Fondap 1501-0001 e Iniciativa Milenio (CMEB).

 

VARIABILIDAD ESPACIO-TEMPORAL EN LA COMPOSICIÓN ELEMENTAL DE Tillandsia landbeckii EN UN GRADIENTE COSTERO (Spatio-temporal variability of elemental composition of T. landbeckii in a coastal gradient). González, A., Marquet, P., Fariña, J. M.1, Pinto, R., Armesto, J. & Pérez, C1. CASEB, Depto. Ecología, PUC, Santiago. `algonzag@bio. puc.cl. Equipo de Estudios de Ecosistemas de Niebla. Iquique.
Patrocinio: Dr. Pablo Marquet

La limitación de nutrientes, principalmente nitrógeno parece ser el factor determinante de la productividad en ecosistemas terrestres. Se ha planteado que la composición elemental y C: N: P de la vegetación puede ser un indicador del tipo de nutriente limitante para el crecimiento de las plantas en distintos ecosistemas.
Nuestro objetivo en este trabajo fue determinar la composición elemental de un organismo en función de la disponibilidad de nutrientes a lo largo de un gradiente. Para esto, estudiamos distintas formaciones de Tillandsia landbeckii, a lo largo de un gradiente de neblina y nutrientes, ya que T. landbeckii carece de raíces y obtiene toda la humedad y nutrientes de la neblina costera. Esta especie forma comunidades denominadas "Tillandsiales", las cuales se orientan de acuerdo a la penetración de la niebla.
T. landbeckii presenta diferencias significativas para N, Ca y K entre sitios, mostrando mayores concentraciones de nutrientes en sitios más cercanos a la entrada de neblina. La C: N y N: P fluctúa alrededor de 140 y 150, respectivamente. Aunque solo se observan diferencias significativas para C: N, se sugiere que tanto N como P son limitantes para su crecimiento. Debido a su dependencia de la neblina, T. landbeckii podría usarse como bioindicador de cambios en los aportes atmosféricos de agua y elementos como nitrógeno, y por ello un modelo apropiado para estudiar las interacciones océano-atmósfera- tierra.
Agradecimientos: FONDAP 1501-0001, CONICYT 24050045.

 

RESPUESTA DE LA REGENERACIÓN ARBÓREA EN CLAROS LUEGO DE 10 AÑOS DESDE LA FLORACIÓN Y MUERTE DE CHUSQUEA QUILA (Tree regeneration responses in gaps after 10 years since the flowering and death of Chusquea quila) Muñoz, A. y González, M. E. Facultad de Ciencias Forestales, Universidad Austral de Chile, Valdivia, Chile.

En bosques remanentes originales ubicados a bajas elevaciones en la zona centro-sur de Chile, Chusquea quila es considerada una especie clave para la regeneración de las especies arbóreas. Su floración y muerte masiva ocurren después de un extenso periodo vegetativo, constituyendo una alteración endógena de gran escala. El principal objetivo de este estudio fue determinar la influencia de la muerte del bambú en la dinámica regenerativa en claros luego de ocurrido el evento. Para esto se seleccionaron seis claros densamente cubiertos por bambú. En cada uno se identificó la regeneración arbórea establecida antes y después de su floración, monitoreando los cambios demográficos y de crecimiento en altura durante las siguientes estaciones de crecimiento. La regeneración avanzada se compuso principalmente de especies tolerantes como Aextoxicon punctatum, Laureliopsis philippiana y Amomyrtus luma. Los individuos originados de raíz de L. philippiana, Eucryphia cordifolia y A. luma mostraron las mayores tasas de crecimiento y una menor mortalidad. Por su parte, la respuesta de los nuevos reclutamientos estuvo dominada por individuos originados de raíz de las especies E. cordifolia, y L. philippiana, las que presentaron una mayor sobrevivencia y crecimiento en altura. Inicialmente, Nothofagus obliqua se estableció abundantemente en los claros, sin embargo, ningún individuo fue capaz de sobrevivir a la competencia de la nueva cohorte de bambú.
Agradecimientos: IFS (D/3124-2)

 

¿EXISTE ZONACIÓN EN LA DISTRIBUCIÓN ESPACIAL DE HIERBAS NATIVAS Y EXÓTICAS EN EL MATORRAL DE CHILE CENTRAL? (Does spacial zonation between native and alien herbs in the matorral of central Chile exist?). Guzman, D., Villavicencio, N., Castro, S. A., Jaksic, F. M. Pontificia Universidad Catolica de Chile. E-mail: dguzman2@puc.cl

El matorral de Chile central está formado por un conjunto de hierbas exóticas y nativas. Aunque existen escasos estudios acerca de la ecología de este sistema, se acepta la existencia de un patrón de zonación microambiental, en el cual las especies nativas crecen principalmente bajo el dosel arbustivo, mientras que las hierbas exóticas lo hacen en espacios abiertos. En este trabajo evaluamos esta hipótesis mediante el estudio de la distribución espacial de hierbas en una comunidad de Chile central (Estación de Investigaciones Ecológicas Mediterráneas, EDIEM). Este estudio se inserta en una iniciativa más extensa, en que esperamos analizar el ciclo estacional completo de la distribución espacial de especies de hierbas en Chile central. Un número de 40 cuadrantes fueron distribuidos equitativamente en condiciones de bajo y entre arbusto. Al interior de cada cuadrante se determinó el número y cobertura relativa de las especies presentes. Utilizando una tabla de contingencia analizamos la asociación entre el origen geográfico (exótico o nativo) y su distribución espacial (entre o bajo arbusto). Los análisis muestran que la distribución de hierbas, aunque responde a patrones de zonación, no está asociada a su origen biogeográfico. Sugerimos en cambio que estos patrones serían resultados de las características de cada especie.

 

FLUJO DE NITRÓGENO EN UN ECOSISTEMA NATURAL (Nothofagus obliqua) Y UN ECOSISTEMA ARTIFICIAL (Pinus radiata) EN LA DEPRESIÓN INTERMEDIA DEL CENTRO SUR DE CHILE (Nitrogen fluxes in a natural-ecosystem (Nothofagus obliqua) and artificial-ecosystem (Pinus radiata) in the central valley of southern Chile) Pröschle, J. C.(1), Oyarzún, C.(2) y Godoy, R.(3) Instituto de Geociencias, Facultad de Ciencias, Universidad Austral de Chile, Independencia 641, Valdivia. (juanproschle@uach.cl(1); coyarzun@uach.cl(2)Instituto de Botánica, Facultad de Ciencias, Universidad Austral de Chile. rgodoy@uach.cl, socio·Soc·Bio. (3)Patrocinio FONDECYT Nº1030344

Se realizaron mediciones en dos parcelas experimentales ubicadas en Paillaco, (40°07'S-72°51`O): un bosque de Nothofagus obliqua y una plantación de Pinus radiata. Se midieron concentraciones (ºg·L-1) de NH4-N, NO3-N y N-orgánico, en muestras de agua (junio-2003·febrero-2004) de precipitación, precipitación directa, escurrimiento fustal, infiltración y percolación. Con los volúmenes (L·m-2), se establecieron los flujos de nitrógeno (kg·ha-1).
Las precipitaciones aportaron valores normales (kg·ha-1) para zonas no contaminadas del mundo (1. 2NInorg y 0. 6Norg). En ambos ecosistemas los flujos de NO3-N aumentaron significativamente en la precipitación directa, por efectos antrópicos expresados en la depositación atmosférica.
En la parcela de P. radiata aumentó el N-Inorgánico infiltrado, confirmando la mayor circulacion de Ninorg en ecosistemas alterados, por la interrupción de acumulación de materia orgánica (largo-plazo) y procesos de humificación. A 80cm de profundidad las salidas de nitrógeno son cercanas a cero. El balance hídrico unido a las propiedades físicas del suelo detectaron una fracción de escurrimiento superficial (266mm), en donde se producen las mayores pérdidas del sistema, estimadas en 3. 2kg·Ninorg·ha-1, y 1. 6kg·Norg·ha-1

 

NEUROBIOLOGÍA

EFECTOS DE SEROTONINA Y DOPAMINA SOBRE NEURONAS AISLADAS DEL GANGLIO PETROSO DE CONEJO (Effects of serotonin and dopamine on isolated rabbit petrosal ganglion neurons). Valdes, V., Vargas, R. V., Alcayaga, J. Lab. Fisiología Celular, Fac. Ciencias, Universidad de Chile.

El ganglio petroso (GP) posee los somas de las neuronas que inervan el cuerpo carotídeo (CC), a través del nervio carotídeo. La actividad quimiosensorial es desencadenada por transmisores liberados desde las células receptoras del CC, como resultado de la transducción. Tanto dopamina como serotonina han sido propuestos como posibles neurotransmisores, pero su papel en la generación de la actividad aferente es aún controversial. Por estas razones, caracterizamos las respuestas inducidas por dopamina y serotonina en neuronas del GP.
Los GPs se extrajeron de conejos anestesiados, se disociaron enzimáticamente y se cultivaron por 3-16 días. Registramos, utilizando la técnica "patch-clamp" en modalidad de célula completa, las corrientes evocadas por dopamina y serotonina, y su bloqueo por antagonistas específicos.
Tanto dopamina como serotonina evocaron corrientes de entrada, dosis-dependiente, en ª 70% de las neuronas estudiadas. Ambas corrientes fueron bloqueadas por tropisetrón (10 nM), un antagonista de receptores serotoninérgicos del tipo 5-HT3. Sin embargo, la aplicación de domperidona (10 nM), un antagonista de receptores dopaminérgicos del tipo D2, no modificó las corrientes evocadas por dopamina.
Estos resultados sugieren que tanto dopamina como serotonina actuarían sobre receptores del tipo 5-HT3 en neuronas aisladas de ganglio petroso de conejo.
Financiamiento: FONDECYT 1040638.

 

SOBRE-EXPRESIÓN DE RECEPTORES ADRENÉRGICOS α2C Y DÉFICIT DE POTENCIACIÓN DE LARGO PLAZO NEOCORTICAL INDUCIDOS POR "MALNUTRICIÓN OCULTA" PRENATAL2C adrenoceptor overexpression and deficits of neocortical long-term potentiation induced by prenatal hidden malnutrition). Mondaca, M.1, Valladares, L.1, Sierralta, W.1, Hernández, A.2, Pérez, H.1, Soto-Moyano, R. 1 1INTA, Universidad de Chile, 2Fac. Quím. Biol., USACH.

La malnutrición proteica suave (malnutrición oculta) durante la gestación es capaz de inducir sobre-expresión del adrenoreceptor α2C en la neocorteza de las crías, como también deficits en la capacidad de las neuronas corticales para generar y mantener potenciación de largo plazo (LTP). Se investigó en ratas adultas sometidas a esta forma de malnutrición prenatal: (i) el efecto de la administración i. p. del antagonista selectivo α2C atipamezole en la LTP neocortical inducida in vivo mediante shocks tetanizantes; y (ii) el efecto de la administración crónica intracortical de un oligonucleótido antisentido contra el RNAm que codifica para el adrenoreceptor α2C, tanto en la densidad del receptor determinada mediante técnicas de radioligando (3H-rauwolscina) como en la LTP neocortical. Los resultados muestran que (1) atipamezole (1. 2 mg/kg i. p.) restauró la capacidad de las neuronas corticales para inducir y mantener LTP; (2) la administración intracortical del oligonucleótido disminuyó en alrededor de 50% la densidad de adrenoreceptores α2C y al mismo tiempo restauró la LTP neocortical. Se sugiere que la sobre-expresión neocortical de receptores a α2C y los deficits de LTP asociados que presentan los animales malnutridos, pueden estar en la base de los trastornos cognitivos que acompañan a esta forma de malnutrición.
FONDECYT 1030729

Ácido Deshidroascórbico previene la muerte celular en neuronas inmortalizadas (Dehydroascorbic acid prevents cellular death in immortalized neurons). Astuya A., García M. los A., Nualart. F. Departamento de Biología Celular, Universidad de Concepción.

Se ha postulado que la forma oxidada de la vitamina C, el ácido deshidroascórbico (DHA), presenta un efecto protector frente a la muerte celular inducida por ROS en diferentes líneas celulares. Sin embargo, este efecto no ha sido evaluado en líneas neuronales inmortalizadas, que sobreexpresan transportadores de glucosa involucrados en la incorporación de DHA. Evaluamos la expresión y función de GLUT1 y la correlacionamos con el efecto de DHA en la muerte celular inducida por H2O2 en cultivos primarios de neuronas de ratón, neuronas transformadas HN33. 11 y células de neuroblastoma N2a. Los análisis inmunocitoquímicos y funcionales confirman un incremento significativo de la expresión de GLUT1 y de la incorporación de DHA en neuronas transformadas en relación a las normales. Además, `las neuronas mostraron un mayor daño al tratamiento con H2O2, comparado con las células inmortalizadas. La preincubación con DHA, no tuvo un efecto significativo en la muerte celular inducida por H2O2, sin embargo se observó protección al realizar cotratamientos y postratamientos con DHA. Estos resultados sugieren que la sobreexpresión de GLUT1 y aumento de la incorporación de DHA en neuronas inmortalizadas y de neuroblastoma, previenen la muerte por daño oxidativo.
Proyecto FONDECYT 1050095, CONICYT tesis doctoral.

 

ACCIÓN DE LA VITAMINA C Y EXPRESIÓN DEL TRANSPORTADOR SVCT2 EN CÉLULAS TRONCALES DEL SNC (Vitamin C action and SVCT2 expression in CNS stem cells) Silva-Alvarez C., Nualart F. Departamento de Biología Celular, Facultad de Ciencias Biológicas, Universidad de Concepción.

La glia radial es una célula fundamental para el desarrollo del sistema nervioso central por su participación como guía para la migración neuronal y como precursor de astrocitos y neuronas. Esta célula se caracteriza por su morfología bipolar que toma contacto con la superficie ventricular y la región submeníngea. Actualmente, se desconocen los factores que promueven la diferenciación radial, no obstante, diferentes antecedentes sugieren la participación de moléculas provenientes de las meninges y/o factores solubles presentes en el LCR, como la vitamina C. No existen estudios que permitan definir el mecanismo por el cual la glia adquiere la vitamina C. Tampoco se conoce si los transportadores involucrados se localizan en la región ventricular o meníngea. Ensayos de inmunolocalización en ratones de E11-E18 días de gestación con anticuerpos específicos para la glia radial y para el transportador de vitamina C SVCT2, demuestran que este transportador se expresa preferentemente en la región ventricular de la corteza cerebral. Mediante hibridización in situ en cerebro de ratones E15, se confirmó la expresión del mRNA para SVCT2 en la glia radial. Para analizar la diferenciación radial in vitro, se caracterizaron cultivos primarios corticales incubados con vitamina C y/o cocultivados con meninges. La vitamina C y las células de las meninges promovieron la diferenciación radial.
Proyecto FONDECYT 1050095.

Productos secretados desde células infectadas con HTLV-I producen acortamiento de neuritas de cultivos neuronales de rata. (Secreted products from HTVL-I infected cells produce neurite shortening of rat neuronal cultures). Cruz1, C. F., Ramirez2, E., Caviedes3, P., García1, A., Valenzuela1, M. A. 1Departamento Bioquímica-Biología Molecular, Fac Ciencias Químicas-Farmacéuticas, Universidad de Chile. 2Instituto de Salud Pública. `3ICBM, Fac Medicina, Universidad de Chile.

El retrovirus humano HTLV-I ocasiona una enfermedad neurodegenerativa llamada Paraparesia Espástica Tropical, que se caracteriza por un deterioro de los axones de la vía piramidal, produciendo pérdida de movilidad en las extremidades inferiores de las personas afectadas. El mecanismo patogénico no ha sido dilucidado completamente.
En nuestro laboratorio se ha propuesto utilizar como modelo de estudio una línea celular de médula espinal de rata (M4b). Se estudió la capacidad de una línea celular linfocitaria infectada con el retrovirus (MT2) de producir cambios en la morfología de la línea neuronal M4b.
Al hacer cococultivos se permitió el contacto entre ambas líneas celulares y se encontró un acortamiento de las neuritas de las células M4b, lo que fue dependiente del tiempo del estímulo. Al realizar cocultivos sin contacto (separando ambas líneas celulares con una membrana semipermeable), o adicionar el medio condicionado de las células MT2 sobre el cultivo de M4b, se observó también acortamiento neurítico, aunque en una menor población de células. Esto permite inferir que los linfocitos infectados secretan factores que pueden tener relevancia en el mecanismo patogénico de la enfermedad.
Financiamiento: Proyecto Fondecyt 105-0784

 

EFECTO DE INTERLEUCINA 1b EN LA TRANSMISIÓN NOCICEPTIVA ESPINAL DE RATAS INTACTAS Y TRATADAS CON PROPENTOFILINA (Effect of interleukin 1b on spinal nociceptive transmission of intact and propentofylline-treated rats). Hernández, A., Arriagada, O., Constandil, L., Laurido, C. Laboratorio de Neurobiología, Departamento de Biología, Facultad de Química y Biología, Universidad de Santiago de Chile.

Las citoquinas espinales están involucradas en los mecanismos de mantención y exageración del dolor crónico. Se estudió el efecto de la administración intratecal de interleucina 1b (IL-1b) en ratas intactas o tratadas con el neurotóxico glial propentofilina (10 mg/10 ml i. t., una vez al día durante 10 días) sobre el "wind-up" espinal evaluado mediante el paradigma del reflejo nociceptivo C. Los resultados mostraron que la administración i. t. de 2 ng de IL-1b no produjo cambios significativos en el reflejo C en ratas intactas o tratadas con propentofilina, mientras que esta misma dosis produjo un incremento de 80% de la actividad wind-up en ratas intactas y una disminución de 30% en el wind-up de las ratas tratadas con propentofilina. Se concluye que: (i) los receptores IL-1 relevantes a la nocicepción estarían localizados en la glía; y (ii) los mediadores gliales jugarían un rol en los mecanismos neurobiológicos de generación y/o mantención del wind-up espinal en la rata normal.
DICYT 020343HK

Ensamblaje de Complejos Macromoleculares de la zona activa durante la sinaptogenesis (Assembly of a Macromolecular Active Zone Complex During Synaptogenesis). Torres V. I. *, Galaz J, Leal S y Garner CC. Facultad Ciencias de la Salud, Universidad de Antofagasta* y Psychiatry and Behavioral Sciencies, Stanford University, California.

La formación de sinapsis durante el desarrollo del cerebro es vital para el funcionamiento normal del sistema nervioso central. La zona activa (ZA) presináptica está formada por varios complejos proteicos, sin embargo, se desconoce dónde estos se forman. Existen dos posibilidades: a) las proteínas podrían ser depositadas una por una a la zona activa o b) podrían ser depositadas como complejos pre-ensamblados en sinapsis inmaduras. En este trabajo hemos estudiado la distribución subcelular de cuatro proteínas de la ZA que se encuentran en un complejo en ZA maduras: Piccolo, Bassoon, RIM y ERC. Para entender cuando y donde estas proteínas establecen contacto utilizamos una combinación de estrategias bioquímicas y moleculares. Por medio de fraccionamiento subcelular estudiamos la distribución de las proteínas durante el desarrollo cerebral. Encontramos que ellas cambian su distribución durante el desarrollo. Inicialmente se asocian a membranas de densidad ligera e intermedia y luego en cerebros maduros se asocian a membranas de mayor densidad. Sorprendentemente, la asociación a la membrana ligera desaparece durante el desarrollo y esta ausente en cerebros adultos. Estudios de inmunoprecipitación con anticuerpos para Piccolo, desde la membrana ligera co-inmunoprecipitó a Bassoon, RIM y ERC, indicando asociación de estas proteínas antes de la formación de las sinapsis. Por medio de estudios de inmunofluorescencia en neuronas hipocampales en cultivo hemos determinado la distribución espacial de estas proteínas en diferentes estadios de maduración neuronal. Los resultados sugieren que las proteínas establecerían contacto a nivel del Golgi y de conos de crecimiento axonal. La expresión de unas de estas proteínas en neuronas por un sistema lentiviral arrojó resultados similares. Resumiendo, la zona activa presináptica parece ser pre-ensamblada en estructuras que difieren de uniones sinápticas maduras.

 

DECONSTRUYENDO LA SINAPSIS A TRAVÉS DE RNA INTERFERENCIA (RNAi) MEDIADO POR VECTORES LENTIVIRALES. Deconstructing synapses by RNA interference (RNAi) mediated by lentiviral vectors. Leal S1, Torres V.2, Garner C1, Zamorano P.2. 1Pritzker Laboratory, Dept. Psychiatry, Fac. Medicine. Stanford University, CA, USA. 2Dpto. Biomédico, Fac. Ciencias de la Salud, Universidad de Antofagasta, Antofagasta, Chile.

La sinapsis químicas del sistema nervioso central son especializaciones de membranas involucradas en la transmisión de información intercelular. Trabajos llevados a cabo durante la última década revelan que la estructura molecular de estas especializaciones están formadas por cientos de proteínas, sin embargo, la función específica de muchas de estas proteínas y su rol en la sinapsis es aún desconocida. En este trabajo presentamos el desarrollo de vectores lentivirales para la expresión de shRNAs (short hairpins RNAs) con el propósito de inhibir la expresión de proteínas presinápticas por RNAi. Como modelo de prueba hemos considerado la proteína de andamio presináptica Piccolo, con el fin de determinar su rol en el reclutamiento de otras proteínas a la sinapsis y en la formación de la zonas activas. Inhibición de la expresión de Piccolo por RNAi resulta en una marcada disminución en el reclutamiento de otras proteínas a la zona activa determinado por inmunofluorescencia. Estos estudios sugieren que RNAi mediado por vectores lentivirales es una buena aproximación para el estudio de la función de diferentes proteínas en la sinapsis. Además, estos estudios sugieren que Piccolo juega un rol importante en la formación de las zonas activas.

MICROBIOLOGÍA
AMBIENTAL II

CARACTERIZACIÓN DE VIBRIO PARAHAEMOLYTICUS EN MUESTRAS CLÍNICAS Y DE MARISCOS DURANTE LOS DOS GRANDES BROTES DE DIARREA OBSERVADOS LOS DOS ÚLTIMOS VERANOS EN CHILE (Vibrio parahaemolyticus in clinical and shellfish samples obtained at the midst of the two large outbreaks observed in Chile, 2004 and 2005). Toro1 J., Hernández2 C., Fuenzalida1 L., Rioseco3 M. L., Romero1 J., and Espejo1 R T. jessica. toro@gmail. com. (Instituto de Nutrición y Tecnología de los Alimentos, Universidad de Chile, Santiago1. Laboratorio del Ambiente Llanquihue, Secretaría Regional Ministerial de Salud, Puerto Montt2. Hospital Regional de Puerto Montt, Puerto Montt3, Chile.)

Hasta hace poco las diarreas causadas por V. parahaemolyticus eran poco frecuentes y solo se observaban esporádicamente en el norte de Chile durante el verano. La baja frecuencia de infección en el Sur de Chile se asociaba a las bajas temperaturas del agua costera. Sin embargo, en los dos últimos años se observaron grandes brotes de diarrea asociados al consumo de mariscos en la X Región. Se encontraron aproximadamente 1500 casos clínicos durante el año 2004 y 3600 casos en el año 2005 solo en esta región. Para estudiar esta nueva situación, analizamos las composiciones de la población de V. parahaemolyticus en muestras clínicas y de mariscos obtenidas durante los brotes. Anteriormente habíamos demostrado que el brote ocurrido el 2004 había sido causado por una cepa particular de V. parahaemolyticus, conformada por un clon serotipo O3: K6, que emergió en el Sudeste Asiático en 1996. El análisis de las muestras clínicas del 2005 mostró que como el 2004, el brote había sido causado por la cepa del Sudeste asiático.
El análisis de las muestras de mariscos indicó que, a pesar de las usualmente frías costas de la región, el 55% de las muestras obtenidas durante el apogeo de los brotes contenía V. parahaemolyticus. Sin embargo, la concentración encontrada de estas bacterias en los mariscos fue 10 a 100 veces más baja (3 a 93g-1) a la descrita en regiones más cálidas del mundo. El análisis de la composición de la población mediante DGREA (Ver póster Fuenzalida L., et al) indicó que estaba constituida por al menos 16 clones (11 el año 2004 y 10 el año 2005). Solo se encontraron 5 de los 16 grupos en ambos veranos. Sorprendentemente encontramos que solo 4 de 51 muestras positivas para V. parahaemolyticus contenían el clon pandémico, que estaba causando las epidemias. Todos los clones no pandémicos carecían de los genes tdh y trh, asociados con patogenicidad.
En resumen, nuestras observaciones indican que incluso durante el apogeo de las epidemias, la población de V. parahaemolyticus en mariscos fue baja y muy diversa y que el agente causante fue un miembro minoritario de esta población.

 

ANÁLISIS MOLECULAR DE LA COMUNIDAD BACTERIANA PRESENTE EN EL TRACTO DIGESTIVO DE SALMÓN DEL ATLÁNTICO. (Molecular analysis of bacterial community in digestive tract of Atlantic salmon). Navarrete, P., Opazo, R., Romero, J. Laboratorio Biotecnología, INTA, Universidad de Chile. Patrocinio: Espejo R.

La mayoría de las bacterias presentes en el tracto digestivo de peces ha sido identificada mediante cultivos tradicionales. Sin embargo, estos métodos, generalmente muestran una visión incompleta de la diversidad bacteriana presente. En este estudio, se utilizaron métodos moleculares para monitorear la diversidad bacteriana presente en los compartimentos del tracto digestivo de salmón. La microbiota presente en estómago, ciegos pilóricos e intestino de 10 peces de 30g fue analizada amplificando las regiones variables V3 a V5 del 16S rDNA y posterior separación de los amplicones por electroforesis en gradiente de temperatura (TTGE). Paralelamente, la diversidad bacteriana fue analizada mediante amplificación de la región intergénica 16S-23S rDNA. Ambos métodos revelaron que los diferentes compartimentos presentaban una comunidad similar y de estructura simple. La escisión y secuenciación de las bandas dominantes reveló que en los perfiles de TTGE, la banda dominante correspondió a Pseudomonas fluorescens (99% identidad), mientras el espaciador dominante correspondió a Pseudomonas fluorescens (99% identidad). Por otro lado, la comparación del perfil de la región espaciadora con espaciadores obtenidos de cepas aisladas del tracto digestivo, sugiere que la comunidad de los compartimentos está compuesta principalmente por Pseudomonas, Microbacterium y Shewanella. Los resultados muestran a P. fluorescens como especie dominante en salmones juveniles.
Proyecto INC I03/07-2 de DID/U. de Chile. Beca CONICYT P. Navarrete.

 

COMPORTAMIENTO Y GRUPOS MICROBIANOS DE UNA BIOPELÍCULA ANAEROBIA EXPUESTA A DIFERENTES PRECURSORES DE METILAMINAS (Behavior and microbial groups of an anaerobic biofilm perturbed by different methylamine precursors) Ruiz-Tagle, N1. Ramirez, C1. Aspe, E2 y Urrutia, H1
1
Departamento de Microbiología, Facultad de Ciencias Biológicas, Universidad de Concepción. Casilla 160-C, Concepción, Chile.
2Departamento de Ingeniería Química, Facultad de Ingeniería, Universidad de Concepción. Casilla 160-C, Concepción, Chile.

Ambientes anaerobios ricos en sulfato favorecen el crecimiento de bacterias reductoras de sulfato (BRS), cuyo producto metabólico, H2S inhibe a arqueas metanogénicas (APM). Investigaciones demuestran que las metilaminas (MA) aumentan el desarrollo de APM metilaminotróficas (APMm), aun en presencia de BRS. Existen diversos precursores de MA, colina (CHO), betaína (GBT), glicina (GLY) y trimetilaminas (TMA), como bacterias capaces de metabolizarlos. En comunidades anaerobias complejas se observa la degradación de CHO, GBT, TMA y MA a metano, pero solo TMA y MA son consumidas por APMm. El objetivo de esta investigación fue determinar la influencia de precursores de MA en el consumo de carbono orgánico total (COT), producción de metano (CG) y composición comunitaria en biopelículas anaerobias (hibridación de ARNr16S y DGGE). Resultados muestran mayor consumo de COT en sistemas alimentados con proteínas y CHO, y que proteínas y GBT en el medio favorecen el desarrollo de Methanococcaceae y producción de metano, pero no de BRS. Estos experimentos permiten demostrar si precursores de MA aumentan la eficiencia de la degradación anaerobia en ambientes ricos en sulfato y cómo estos pueden perturbar la composición comunitaria.

 

SELECCIÓN DE CEPAS BACTERIANAS PARA INCREMENTAR EL ENRAIZAMIENTO DE ESTACAS EN _Eucalyptus_ spp. (Bacterial isolates screening to increased rooting cuttings on Eucalyptus spp. Díaz, K.1; Gacitúa, S.1; Valiente, C.1; Martínez, M.2; Castillo, M.3 & Sanfuentes, E1. (1)Laboratorio de Fitopatología, Facultad de Ciencias Forestales. Universidad de Concepción. Casilla 160-C. Correo 3. Concepción. Chile. e-mail: esanfuen@udec.cl.2Laboratorio de Microbiología, Facultad de Ciencias Biológicas. Universidad de Concepción. Concepción. Chile. 3Forestal Mininco S. A., Los Canelos 79, San Pedro de la Paz.

El beneficio de las plantaciones clonales, en programas de establecimiento con Pinus radiata y Eucalyptus spp, ha sido reconocido en nuestro país. Sin embargo, factores endógenos y exógenos pueden determinar un pobre enraizamiento de estacas en algunas especies. E. globulus, E. nitens y sus híbridos, presentan variabilidad en su capacidad para enraizar, incluso a nivel de clones. Diversos estudios han demostrado que algunas bacterias promueven el crecimiento de las plantas (PGPR) e incluso, incrementan el enraizamiento de estacas.
Por estos antecedentes, el objetivo de este estudio fue seleccionar cepas bacterianas para aumentar y mejorar el enraizamiento en eucalipto.
Fue evaluado a los 60 y 75 días, el enraizamiento de un clon de E. globulus. Fueron ensayadas 99 cepas bacterianas, aisladas desde la rizósfera de cuatro clones de E. globulus y E. nitens. Suspensiones bacterianas fueron incorporadas al substrato mediante riegos, al momento del estaquiamiento y otro a los 45 días.
De las cepas ensayadas, 20 incrementaron significativamente el enraizamiento de las estacas, veces respecto al control. Además, algunas cepas fueron capaces de mejorar la calidad de las raíces, estimulando el desarrollo de raíces finas. Estos resultados, sugieren el potencial de estas bacterias en los programas de producción clonal en eucalipto.
Agradecimientos: CMPC Forestal

 

PATRONES DE PRODUCTIVIDAD EN COMUNIDADES DE PLANTAS Y MICROORGANISMOS DEL SUELO EN UN AMBIENTE ÁRIDO CHILENO (Patterns of productivity in plant and soil microbial communities in an arid environmental of Chile) Aguilera L. E., Gutiérrez J. R., . Vásquez S. P & Alejandra A. Rojas
Departamento de Biología, Facultad de Ciencias, Universidad de La Serena
Centro de Estudios Avanzados en Zonas Áridas

La relación entre la diversidad de plantas y productividad ha recibido bastante atención en ecología, pero la relación entre estos factores con las comunidades de microorganismos del suelo ha sido poco explorada. En los ambientes áridos los nutrientes que sustentan a los microorganismos derivan principalmente de las plantas, de tal manera que las comunidades de microorganismos deberían responder a cambios en la diversidad o productividad vegetal, particularmente si la comunidad vegetal afecta la calidad o cantidad de nutrientes disponibles. Por esto nosotros investigamos la relación entre diversas especies vegetales y su productividad sobre la abundancia y actividad de la microbiota edáfica en un ambiente árido del Centro-Norte de Chile. La productividad vegetal se correlacionó positivamente con la abundancia de bacterias aeróbicas mesófilas (r2=0, 68; P<0, 05), hongos saprófitos (r2=0, 52; P<0, 05) y con la respiración del suelo (r2=0, 70; P<0, 05), y se correlacionó negativamente con el porcentaje de infección de raíces por micorrizas arbusculares (r2=-0, 55; P<0, 05). La relación entre los patrones de productividad vegetal y la abundancia y actividad de microorganismos no simbióticos sugiere que la productividad vegetal determina la productividad microbiana o está limitando los recursos para que estos dos componentes bióticos del ecosistema co-varíen.
Financiamiento: Fondecyt 1030225

 

AISLAMIENTO, CARACTERIZACIÓN DE MICROORGANISMOS QUE UTILIZAN COMPUESTOS ORGANOSULFURADOS COMO FUENTE DE CARBONO Y ENERGÍA. Arancibia A. *, Aroca G.*, Urrutia H.**, Valdebenito E.**

*Escuela de Ingeniería Bioquímica, Facultad de Ingeniería, P. Universidad Católica de Valparaíso, General Cruz Nº 34, Valparaíso, Chile.
**Departamento de Microbiologia, Facultad de Ciencias Biológicas, Universidad de Concepción, alejandra. arancibia. d@mail. ucv.cl, garoca@ucv.cl, hurrutia@udec.cl

Los compuestos sulfurado reducidos volátiles (gases TRS) se originan en fuentes biogénicas y antropogénicas, poseen un limite de detección olfativo extremadamente bajo y en elevadas concentraciones son neurotóxicos.. En la actualidad las emisiones antropogénicas de gases TRS provienen principalmente de fábricas de celulosa y refinerías de petróleo, generando un impacto ambiental importante en grandes áreas debido a los olores que generan por la presencia principalmente de estos compuestos Se ha propuesto el uso de sistemas de biofiltración de gases para tratar estas emisiones de gran volumen y baja concentración. El presente trabajo reporta el aislamiento y caracterización, microscópica y molecular, de cepas degradadoras de gases TRS y sus capacidades de adhesión a superficies. Esta información servirá para estudiar el desarrollo de biopelículas, con base en estos microorganismos, para la biooxidación de compuestos sulfurados reducidos presentes en emisiones gaseosas industriales. Se realizó un muestreo en la sección de fraccionamiento en ENAP Biobío (Talcahuano VIII Región), a partir del cual se realizaron cultivos por lotes con medio definido para el enriquecimiento microbiano, de estos cultivos se efectuaron siembras por agotamiento en estría en placas de petri. Las colonias aisladas se caracterizaron mediante microscopía, y análisis de RNA ribosomal 16S a través de hibridación por membrana con sondas específicas (Dot-Blot). Posteriormente a cada una de las cepas aisladas se evaluaron en su capacidad de adhesión a superficies sólidas, contactando una suspensión celular con anillos de polietileno. Después de un periodo de tiempo, se procedió a desprender las células adsorbidas en el soporte utilizando sonicación y se cuantifico su masa. Se aislaron cinco microorganismos Gram negativos, dos formas bacilares que difieren en tamaño y pigmentación, una bacteria con prosteca, y dos formas cocáceas que se agrupan en tétradas. Los cinco microorganismos mostraron distintas capacidades de adsorción a los anillos de polietileno. Esta información es relevante para la investigación sobre procesos de biofiltración de emisiones gaseosas contaminantes que contienen compuestos sulfurados reducidos.
Financiamiento: Dirección de Investigación, Pontificia Universidad Católica de Valparaíso, Proyecto FONDECYT 1050318.

 

BIODEGRADACIÓN DE SIMAZINA EN SUELOS BAJO CONDICIONES NATURALES POR ADICIÓN DE UNA BACTERIA NATIVA DEGRADADORA DE s-TRIAZINAS. (Biodegradation of simazine in soils under natural conditions by addition of a native s-triazine degrading bacteria). Morgante V.1, Flores C.1, González M.1, Vásquez M.2 and Seeger M.1 1Laboratorio de Microbiología Molecular y Biotecnología Ambiental, Universidad Técnica Federico Santa María, Valparaíso. 2Laboratorio de Biotecnología, INTA, Universidad de Chile, Santiago. veronica. morgante@alumnos. utfsm.cl.

The biodegradation of s-triazine herbicides was analysed in agricultural soil microcosms to study the influence of native microbiota, plants and bioaugmentation strategies. For bioaugmentation Pseudomonas sp. strain P41 was added to soil as sodium alginate-immobilized cells. Maize plants were used to simulated field conditions. For enumeration of total heterotrophic bacteria (THC) serial dilutions were used. Most probable number procedure was used to estimate simazine catabolic activities (SCA) in soil samples. Simazine in soil was quantified by HPLC. Addition of bacteria and plants do not affect THC. Inoculation with Pseudomonas sp. strain P41 and maize plants increase significantly SCA in soil (p<0, 001). Agricultural soils have a native simazine degrading microbiota (simazine half-life time 11 days). However, bioaugmentation with Pseudomonas sp. strain P41 increase herbicide degradation, reducing the simazine half-life time to 3 days (p= 0, 001). Plants have less influence than strain P41 in simazine attenuation. Microbial community analysis will be performed to determine the role of native microbiota, plants and addition of strain P41 on simazine biodegradation in soil under natural conditions.
ACKNOWLEDGEMENTS. EU-ICA4-CT-2002-10011, Perkin Elmer, USM 130522, MECESUP PUCV-0206 and Fundación Andes.

 

DEGRADACIÓN DE BROMOFENOLES POR BACTERIAS AISLADAS DESDE AMBIENTES ACUÁTICOS NO CONTAMINADOS. (Bromophenol degradation by bacteria isolated from a non contaminated aquatic environment). Tobella L. y Martínez M. Universidad de Concepción, Facultad de Ciencias Biológicas, Departamento de Microbiología, Casilla 160-C Concepción. e-mail mimartín@udec.cl

La presencia de compuestos tóxicos como los halofenoles en el ambiente se ha relacionado con la actividad industrial. Sin embargo, éstos pueden ser sintetizados por hongos, poliquetos o bacterias. Por ello, bacterias no expuestas a halofenoles de origen industrial también podrían tener potencial para degradarlo. Se estudió la capacidad de bacterias de ambientes acuáticos para degradar 2, 4, 6-tribromofenol (2, 4, 6-TBR). Para ello, 90 ml de caldo R2A1/4 se adicionó con 10ml de una muestra de agua y 2, 4, 6-TBR (50µg/mL), Las muestras fueron incubadas a 30ºC con agitación (115 r. p. m) y la degradación del 2, 4, 6-TBR fue seguida diariamente por espectroscopía UV (200-350nm). Después de 7 días de incubación, se observo disminución de la concentración de 2, 4, 6-TBR. Se aislaron tres cepas de bacilos Gram negativos, a las cuales se les investigó su capacidad parar degradar 2, 4, 6-TBR como única fuente de carbono y energía y en caldo R2A1/4. Las cepas fueron capaces de degradar 246-TBR pero ninguna de ellas utilizó 2, 4, 6-TBR como única fuente de carbono y energía. Los resultados indican que en ambientes no expuestos a contaminantes industriales es posible la selección de bacterias que degradan bromofenoles cuya capacidad podría estar relacionada con el origen biológico de estos compuestos.
Financiado: Universidad de Concepción DIUC.

 

PANELES I

BIOQUÍMICA

1. GENÓMICA DEL DINOFLAGELADO TÓXICO ALEXANDRIUM CATENELLA: PREPARACIÓN Y CARACTERIZACIÓN DE GENOTECAS DE cDNA. (Genomics of the toxic dinoflagellate Alexandrium catenella: Production and characterization of a cDNA library). Fuentes, D., Uribe, P., Fuentes, V., Valdés, J., Shmaryahu, A., Holmes, D y Valenzuela, P.D.T. Fundación Ciencia para la Vida, Universidad Andrés Bello e Instituto MIFAB.

El veneno paralizante de mariscos (VPM) es una de las cuatro toxinas presentes en las Floraciones Algales Nocivas o "Mareas Rojas", fenómenos que ocurren en Chile y el mundo, generando gran impacto social, económico y de salud pública debido al carácter letal del VPM. En Chile, la especie productora de VPM es el dinoflagelado Alexandrium catenella, presente en las Regiones X, XI y XII. Se construyeron genotecas unidireccionales de cDNA a partir de ARN poliA+ obtenidos de cultivos de A. catenella sometidos a tratamientos consecutivos de lavado y aplicación de antibióticos con el fin de eliminar sus bacterias asociadas. Se obtuvieron 11.030 secuencias y 4.190 fueron agrupadas en 982 contigs. El 44% de éstas presentó una similitud aceptable (E<10-5) con proteínas conocidas del GenBank. Taxonómicamente, la mayoría de ellas correspondía a dinoflagelados (35.1%), plantas (13.7%), bacterias (11.4%), hongos (6.9%), protozoos (8.8%) y apicomplexas (4.2%). Según los grupos funcionales de proteínas, las secuencias se agruparon en: luminiscencia (12.3%), metabolismo de carbohidratos (12.3%), metabolismo de aminoácidos (8.4%), energía (8.1%), modificación de proteínas (7.7%), traducción (6.2%), transporte (4.9%), fotosíntesis (4.8%), metabolismo de nucleótidos (2.8%), proteínas estructurales (4%), transducción de señales (3.7%), metabolismo de ácidos grasos (1.6%) y transcripción (1.2%). CONICYT-FONDEF MRO2I1003.

2. CIRUGÍA génica en células humanas mediada por elementos virales (Gene correction in human cells mediated by viral elements)
1,2Ezquer, F.,1Sapag, A., 2Núñez, MT., 1Israel, Y. 1Laboratorio de Farmacoterapia Génica. Facultad de Ciencias Químicas y Farmacéuticas y 2Facultad de Ciencias, Universidad de Chile.

La capacidad de corregir mutaciones que generan enfermedades ha sido considerada como el máximo objetivo de la terapia génica. Sin embargo, los sistemas de corrección actuales son costosos y poco eficientes. En este trabajo reportamos un nuevo sistema de corrección basado en la producción intracelular de moléculas de DNA de cadena simple que en su posición central llevan la base (o secuencia) correctora capaz de efectuar la corrección génica.
Para evaluar la eficiencia del nuevo sistema utilizamos como reportero el gen eGFPm: gen eGFP al que se le introdujo una mutación inactivante que de ser revertida restaura la fluorescencia normal de la proteína codificada. En células humanas HEK-293 portadoras del gen eGFPm episomal o integrado al genoma, la transfección de componentes virales (AAV y AdV) responsables de producir segmentos correctores de DNA de cadena simple generó, respectivamente, correcciones de 1,1 a 1,5% en el eGFPm integrado o episomal. Estos valores exceden la eficiencia de corrección (10-6) que llevó a la generación de animales transgénicos y pueden aumentarse por amplificación de células seleccionadas por citometría de flujo o resistencia a antibióticos. En ciertas enfermedades una corrección genotípica de 1% es suficiente para corregir el fenotipo anormal (ej. hemofilia). Adicionalmente, esta nueva estrategia permitirá la producción de nuevos modelos experimentales.
Financiamiento: Universidad de Chile PG-08/04; Iniciativa Científica Milenio P99-031F.
Trabajo realizado en colaboración con Gabriel Cortínez.

 

3. MODIFICACIONES DEL SISTEMA RADICULAR POR ESTRÉS ABIÓTICO. (Root System Modifications by Abiotic stresses). Zurita-Silva, R.A.1, López, X.1, David-Contard, P.2, Nussaume, L.2, Herrera-Estrella, L.3 y Squeo, F.A.1,4
1Centro de Estudios Avanzados en Zonas Áridas (CEAZA), La Serena, Chile. 2CEA-Cadarache, St Paul lez Durance, France. 3CINVESTAV-IPN Irapuato, México. 4Departamento de Biología, Universidad de La Serena.

En regiones áridas, los cambios ambientales inducen a que las plantas desarrollen mecanismos tanto morfológicos, fisiológicos y moleculares para sobrevivir. Tales cambios se encuentran modulados en la rizósfera por condiciones como sequía y disponibilidad de nutrientes, que modifican la productividad vegetal. El estudio tuvo por objeto identificar si existía control génico en los cambios radiculares utilizando líneas mutantes de Arabidopsis thaliana como respuesta al estrés nutricional por fósforo y estudiar cambios en especies herbáceas en condiciones de campo como respuesta a la sequía a nivel radicular.
Se aislaron líneas mutantes que presentaron arquitectura radicular contrastante a la disponibilidad de fosfato, o que presentaron insensibilidad a la ausencia de éste. En tanto en condiciones naturales, la eficiencia de uso del agua fue correlacionada con una arquitectura más orientada ala formación de raíces laterales, sugiriendo que la modulación del crecimiento por la sequía es crucial en el establecimiento de especies dependientes de una baja disponibilidad de agua y que dichos cambios son similares a otros procesos de estrés, debido al patrón de desarrollo modular exhibido por las raíces. El desarrollo radicular y la comprensión de su modulación otorgará nuevas herramientas para el mejoramiento de especies cultivadas

4. CAPACIDAD DE SPHINGOPYXIS Alaskensis Y Sphingopyxis Chilensis PARA SOBREVIVIR A CONDICIONES DE ESTRÉS (Abilty of Sphingopyxis alaskensis and Sphingopyxis chilensis to survive under stress condition). Pavez P. y Martínez M. Departamento de Microbiología Facultad de Ciencias Biológicas, Universidad de Concepción, Casilla 160-C; Concepción. pampavez@udec.cl

Sphingopyxis alaskensis es una ultramicrobacteria capaz de sobrevivir en ambientes extremos. Sphingopyxis alaskensis y Sphingopyxis chilensis están estrechamente relacionadas (98.8% de similitud ADNr 16S), aun cuando se han aislado desde lugares geográficamente distantes (S. alaskensis H.N; S. chilensis H.S, río Biobío). En este estudio se comparó las capacidades de ambas especies bacterianas para sobrevivir a estrés por congelamiento, deshidratación con etanol y exposición a peróxido de hidrógeno y se relacionó con el contenido intracitoplasmático de poli-b-hidroxialcanoatos. Las cepas se cultivaron en caldo R2A por 48 h, se resuspendieron en solución salina (1.0x107 UFC/mL) y se sometieron a estrés por frío por 24 o 48h (-20ºC; 4ºC). Posteriormente se expusieron a etanol (20%) o peróxido de hidrógeno (25mM) por 15, 30 o 45 min. Los resultados demostraron que la sobrevivencia de S. alaskensis fue de 27%; en cambio S. chilensis no superó el 4,3% por exposición a _20ºC durante 48h y no se detectaron células viables de S. chilensis después de la adición de etanol. Sin embargo, ambas bacterias sobrevivieron a la exposición al peroxido de hidrógeno, después del tratamiento a _20ºC. Los resultados en su conjunto sugieren que S. alaskensis resistiría mejor a condiciones de estrés que S. chilensis.
Financiamiento: Proyecto Patagonia DIUC.

 

5. LAS ALTAS CONCENTRACIONES DE GLUCOSA TIENEN UN EFECTO SINÉRGICO SOBRE EL ESTRÉS OXIDATIVO PROVOCADO POR LIPOPROTEÍNAS OXIDADAS SOBRE CÉLULAS MONONUCLEARES DE PACIENTES DIABÉTICOS TIPO II. 1Bustamante, M, 1Muñoz, M, 1Díaz, F, 1Llancaqueo, A, 1Nuñez, L, 1Campos, L, 2Rivas, C, 2Vera, JC, 3Gross, H-J & 3Bachem, M.
1Facultad de Medicina, Universidad Católica de la Santísima Concepción, Concepción, 2Dpto de Fisiopatología, Facultad de Ciencias Biológicas, Universidad de Concepción, Concepción, Chile, 3Dpto de Química Clínica, Facultad de Medicina, Universidad de Ulm, Ulm, Alemania.

La diabetes mellitus tipo 2 es un factor de riesgo independiente en el desarrollo de la aterosclerosis, cuyas manifestaciones clínicas (cardiopatía coronaria, accidente vascular cerebral y enfermedad oclusiva arterial periférica) constituyen la primera causa de morbilidad y mortalidad en el mundo occidental. El proceso fisiopatológico de la asociación de diabetes con aterosclerosis aún no se conoce del todo, pero se considera que en la génesis del proceso ateromatoso del paciente diabético estarían involucrados múltiples factores, entre los cuales podrían estar la modificación oxidativa de las lipoproteínas de baja densidad (LDL) y las altas concentraciones de glucosa circulante que se encuentran en la sangre de estos pacientes.
Utilizando citometría de flujo, inmunofluorescencia y western blot hemos investigado el efecto de varias concentraciones de glucosa sobre células mononucleares de sujetos normales y de pacientes diabéticos sometidas a estrés oxidativo representado por lipoproteínas oxidadas.
Bajas concentraciones de lipoproteínas oxidadas (menores de 25 µg/ml) estimulan las células mononucleares a proliferar y altas concentraciones (mayores de 50 µg/ml) inducen apoptosis, pero cuando las células además son cultivadas en presencia de altas concentraciones (10-15 mM) de glucosa se produce un efecto sinérgico respecto de la muerte celular, la cual se produce por apoptosis, pero también por necrosis. Esto último podría explicar los fenómenos inflamatorios que se observan en los pacientes diabéticos. Los ensayos de western blot permiten sugerir que en el proceso apoptótico están involucradas las MAP quinasas y que los efectos se pueden revertir usando un antioxidante como desferal.
Estos resultados sugieren que el control de la glicemia en pacientes diabéticos tipo II es probablemente fundamental para evitar las complicaciones ateroscleróticas, las cuales son típicas en estos pacientes y constituyen su principal causa de morbi-mortalidad.
Financiado por Proyecto FONDECYT 1040977

 

EL GALACTANO SULFATADO DEL ALGA Schyzimenia binderi (RODOPHYTA) DEPOLIMERIZADO ACTIVA LA VÍA FENILPROPANOIDE EN TABACO Y PROTEGE CONTRA LA INFECCIÓN POR TMV. (Depolymerized sulphated galactan from Schyzimenia binderi acivates the phenylpropanoid pathway in tobacco and protects against TMV infection). 1Vera J., 2Zúñiga 2E. Matsuhiro B. y 1Moenne A. 1Laboratorio de Biología Molecular de Algas y 2Laboratorio de Hidratos de Carbono, Facultad de Química y Biología; Universidad de Santiago de Chile.

Se purificó el galactano sulfatado del alga marina Schyzimenia binderi, se depolimerizó vía radicales libres y se obtuvo una fracción homogénea de aproximadamente 20 unidades de galactosa sulfatada (Poli-Ga). Una solución acuosa de Poli-Ga fue asperjada sobre plantas de tabaco Xhanti NN (n=6) utilizándose distintas concentraciones (de 100 a 700 µg/mL), aplicando un distinto número de veces (1 a 4 veces) una solución de 500 µg/mL y aplicando dos veces una solución de 500 µg/ml con cultivo por tiempos variables post-tratamiento (de 5 a 60 días). En cada ensayo se determinó la actividad de la enzima de defensa fenilalanina amonio liasa (PAL) y el porcentaje de protección frente a la infección por Virus del Mosaico del Tabaco (TMV). Se observó un aumento de la actividad PAL con el aumento de la concentración de Poli-Ga, con el aumento en el número de veces de tratamiento y con el aumento del tiempo post-tratamiento. Soprendentemente, se obtuvo una protección casi total contra TMV (98%) después de 60 días post-tratamiento. A continuación, se determinó la cantidad de la fitoalexina escopoletina y de ácido salicílico por fluorescencia observándose que el nivel de estos compuestos aumenta con la activación de la PAL y se correlaciona con el aumento del porcentaje de protección contra TMV. Estos resultados indican que el tratamiento con Poli-Ga activa de manera crónica la vía fenilpropanoide produciendo una acumulación de escopoletina y otros compuestos fenólicos y protege contra la infección por TMV.
Financiado por proyecto FONDECYT 1010594.

 

7. RNAI, INTERFERENCIA POR RNA, EN LA EXPRESIÓN DEL GEN DE LA DESHIDROGENASA ALDEHÍDICA DE RATA: PRUEBA DEL PRINCIPIO (RNAi in the rat aldehyde dehydrogenase gene: Proof of principle) Cortínez, G., Sapag, A., Israel Y. Programa de Doctorado en Bioquímica y Laboratorio de Farmacoterapia Génica, Departamento de Química Farmacológica y Toxicológica, Facultad de Ciencias Químicas y Farmacéuticas e Instituto Milenio CBB, Universidad de Chile.

En humanos, una baja actividad de la deshidrogenasa aldehídica (ALDH2) produce una disminución en el consumo voluntario de alcohol. El disulfiramo, en uso en el tratamiento del alcoholismo, es un inhibidor inespecífico de la ALDH2 que requiere administraciones diarias. Para desarrollar un fármaco específico y de acción prolongada hemos construído un gen que produce una horquilla de RNA interferente contra la ALDH2 humana y de rata.
El efecto del gen de la horquilla interferente se estudió en células HEK 293, fácilmente lipofectables y carentes del actividad de la ALDH2. Lipofectándolas simultáneamente con un plasmidio que codifica la ALDH2 y con otro que codifica la horquilla interferente se disminuyó 50 % la actividad de la ALDH2, demostrando un efecto farmacológico por RNAi.
Como prueba del principio, estos estudios demuestran que es posible evaluar el efecto de RNAs interferentes en células HEK 293, transfectadas simultáneamente con el gen blanco y el gen de una horquilla interferente. Los resultados justifican construir un vector adenoviral para entregar eficientemente el gen de la horquilla interferente a células hepáticas.
Beca CONICYT AT-403111, Beca Universidad de Chile PG/105/02, FONDECYT 1040555, Iniciativa Científica Milenio P99 031F.

8. RNAs quiméricos mitocondriales: Transcritos con sorprendentes características. (Mitochondrial chimeric RNAs: Non-coding transcripts with surprising characteristics) Villegas, J., Burzio, V., Villota, C., Restovic, F., Landerer, E., Martínez, R., Zepeda, P.,Vidaurre, S y Burzio, L.O. MIFAB, Fundación Ciencia para la Vida y BiosChile I.G. Av. Zañartu 1482, Santiago.

Nuestro laboratorio ha descubierto una familia de transcritos mitocondriales, que se caracterizan por poseer un largo repetido invertido (RI), covalentemente unido al extremo 5' del rRNA 16S mitocondrial. Parte de la estructura de estos RNAs son resistentes a RNAsaA, son altamente expresados en células normales en proliferación y tumorales, no así en células en reposo. Subcelularmente se localizan en compartimentos extramitocondriales constituyendo un hallazgo inesperado. Sorprendente fue encontrar que la célula también sintetiza una familia de RNAs antisentido, los cuales son diferencialmente expresados, dependiendo del tipo celular. Tanto en células tumorales como en normales los RNAs antisentido son fuertemente reprimidos, pero no en normales en proliferación. Ambos tipos de RNAs están constituidos por al menos tres variantes, que se diferencian en el tamaño del RI que poseen y lo más interesante en el tipo celular que se expresan. Es así como hemos determinado que en células neoplásicas se expresa un tipo de RNA quimérico sentido (tipo 1), situación que no sucede en células infectadas con virus oncogénicos, como HPV -16 ó 18, en donde aparece otro tipo de RNA (tipo 2). Se discutirá su relación con diagnostico y terapia de cáncer. Proyectos P04-071-F, MIFAB, DI-26-04, DI-57-04 y DI 32-03 U. Andrés Bello)

 

9. ACTIVIDAD SUPERÓXIDO DISMUTASA EM PLASMA SEMINAL DE EQUINOS (Superoxide Dismutase Activity in Equine Seminal Plasma) Domingos, T.F.S.; López, ML; Retamal, CA
Universidade Estadual do Norte Fluminense, Campos-RJ, Brasil (Apoyo:FAPERJ, CNPq, TECNORTE)

Los espermatozoides poseen una baja resistencia a estrés oxidativo, siendo altamente dependientes del microambiente en el cual están inmersos. Enzimas antioxidantes como catalasa, superóxido dismutasa y glutatión oxidasa han sido detectadas en el tracto reproductor de algunas especies. Es nuestro objetivo verificar la presencia de actividad superóxido dismutasa (SOD) en plasma seminal de equinos. Las muestras de plasma seminal se obtuvieron por centrifugación (17000xg - 4ºC - 20min) de semen de animales fértiles. La determinación de SOD se realizó en geles de poliacrilamida en condiciones nativas e denaturantes; bidimensionales nativo/nativo, nativo/denaturante, denaturante/denaturante, con y sin βmercaptoetanol. Los geles bidimensionales nativos e denaturantes se incubaron en una solución con NBT, EDTA e riboflavina. Para determinar masa molecular nativa se realizaron geles de poro transverso (Retamal & Babul, 1988). Para el análisis densitométrico de las bandas se utilizó el programa gel-perfect (Bozzo & Retamal, 1991). De nuestros resultados cabe destacar que SOD fue detectada tanto en condiciones nativas como denaturantes, en las proteínas de 176, 143, 107 y 62 kDa. En presencia de bmercaptoetanol se activaron proteínas de mayor movilidad electroforética. Este comportamiento sugiere la existencia de agregados posiblemente ligados por enlaces S-S en la estructura de esta proteína. SOD de plasma seminal esta siendo purificada para una posterior caracterización.

 

10. CARACTERIZACIÓN FUNCIONAL DE MONOOXIGENASAS DE GIBERELINAS EN FUSARIUM PROLIFERATUM (Functional characterization of gibberellin monooxygenases in Fusarium proliferatum). Troncoso, C., Cárcamo, J., Bocca, J.P., Rojas, M.C. Departamento de Química, Facultad de Ciencias, Universidad de Chile.

Gibberella fujikuroi es un complejo de especies formado por lo menos por nueve especies biológicas que producen variados metabolitos secundarios entre ellos, giberelinas (fitohormonas diterpénicas). A pesar que todas las especies contienen los genes de la biosíntesis de giberelinas, solo Fusarium fujikuroi las produce. Fusarium proliferatum es un patógeno del maíz perteneciente al complejo. En este trabajo analizamos la funcionalidad de los productos de expresión de los genes de giberelinas en esta especie biológica, para determinar las causas de esta carencia biosintética. Utilizamos transformantes conteniendo genes únicos de F. proliferatum así como mutantes de disrupción de F. proliferatum en genes específicos. Encontramos que la ent-kaureno oxidasa, que cataliza una de las primeras etapas de la secuencia metabólica, está inactiva, dando cuenta en parte del bloqueo de la biosíntesis de giberelinas. La GA14 sintetasa en cambio es activa en F. proliferatum aunque presenta actividad reducida. La oxidasa del carbono 20 que forma la función lactona de las giberelinas también es activa transformando eficientemente los sustratos no hidroxilado (14C-GA12) y 3b-hidroxilado (14C-GA14). Finalmente, la desaturasa 1, 2, presenta una muy baja actividad explicando la formación de productos diferentes con respecto a F. fujikuroi en experimentos de metabolización. El análisis de giberelinas endógenas por GC/MS demostró que F. proliferatum no produce ent-kaurenoides lo que sugiere bloqueos adicionales.
Financiado por FONDECYT 1020140.

11. DETERMINACIÓN DE LA ACTIVIDAD DE LA GLICÓGENO SINTASA POR ELECTROFORESIS CAPILAR (Glycogen synthase activity determination by capillary electrophoresis). Wilson1,2, C.A.M., Díaz1,2, A.E., Preller1, A., Valenzuela2, M.A., y Ureta1, T. 1Facultad de Ciencias y 2Facultad de Ciencias Químicas y Farmacéuticas, Universidad de Chile.

La glicógeno sintasa (EC 2.4.1.11) incorpora un residuo glucosilo proveniente de UDP-glucosa a residuos terminales no reductores de glicógeno. Actualmente su actividad se mide utilizando un método espectrofotométrico o bien un radioensayo. El primero presenta algunas dificultades por las enzimas (piruvato quinasa y lactato deshidrogenasa) que se acoplan al ensayo. El segundo es un método discontinuo, engorroso, pues implica la purificación del glicógeno formado, y es además caro debido al uso de UDP[14C]- glucosa. En este trabajo presentamos un método rápido, sensible y reproducible, que utiliza la técnica de electroforesis capilar. Es posible medir en el tiempo la disminución del sustrato UDP-glucosa y la aparición del producto UDP. Las corridas se realizaron en un capilar no protegido de 60 cm de longitud y 50 µm de diámetro, a un voltaje de 22 kV. La señal del nucleótido se determinó a 254 nm. Las curvas de absorbancia versus concentración fueron lineales para ambos nucleótidos. Cuando se aplicó el método para medir la actividad de la glicógeno sintasa en extractos crudos provenientes de oocitos de la rana chilena Caudiverbera caudiverbera, se obtuvo una curva de tiempo lineal durante un tiempo experimental apropiado. Este método puede ser usado para medir la actividad de varias enzimas que utilizan nucleótidos.
Proyecto FONDECYT 1040886

 

12. MUTACIONES MÚLTIPLES Y DELECIONES EN EL SITIO ACTIVO DE LA ARGINASA HUMANA TIPO I: CAMBIOS EN LA ESPECIFICIDAD DE SUSTRATO (Multiple mutations and deletions in the active site of human arginase type I: Changes in substrate spectificity). Neira, B., Orellana, M.S., Alarcón, R., Uribe, E., García, J.R., Carvajal, N. Departamento de Bioquímica y Biología Molecular, Facultad de Ciencias Biológicas, Universidad de Concepción.

La arginasa y la agmatinasa hidrolizan sustratos estructuralmente relacionados, comparten importantes homologías de secuencias, conservan residuos catalíticamente esenciales y sus actividades dependen estrictamente de Mn2+. Sin embargo, el sustrato de una (arginina o agmatina) no es sustrato de la otra. Empleando modelaje molecular por homología y mutaciones puntuales, hemos sugerido que sus especificidades están determinadas por la extensión y composición de un loop ubicado en la entrada del respectivo sitio activo. Para corroborarlo, hemos realizado mutaciones simples, mutaciones múltiples y deleciones en el loop de la arginasa humana I. En este trabajo mostramos los resultados obtenidos con la mutante que contiene las mutaciones I129!íT, N130!íY y T131!íA y carece de los residuos 132-134. La mutante, expresada en Escherichia coli, solo presentó actividad con agmatina (a.e = 0,15 ºmol urea min-1mg prot-1; Km = 6 ± 1 mM), siendo inhibida por arginina. Una eventual interferencia por la agmatinasa endógena de la bacteria fue descartada por el comportamiento cromatográfico en DEAE-celulosa, el tamaño molecular y la reactividad inmunológica de la mutante. Los resultados obtenidos confirman la importancia del loop analizado en la especificidad de sustrato de la arginasa.
Fondecyt 1030038

 

13. RESIDUOS CONSERVADOS EN LA SUPERFICIE DE INTERACCIÓN SON RESPONSABLES DE LA ESTRUCTURA CUATERNARIA EN FICOBILIPROTEÍNAS DE Gracilaria chilensis. (Conserved residues in the interaction surface are responsible of the quaternary structure of phycobiliproteins in Gracilaria chilensis) Sepúlveda, J., Cabrera, JR.,Burgos, F., Figueroa, M., Bunster, M. Martinez-Oyanedel, J. Laboratorio Biofísica Molecular. Departamento de Bioquímica y Biología Molecular, Facultad de Ciencias Biológicas, Universidad de Concepción.

Los ficobilisomas son complejos proteicos encargados de la captación y conducción de la luz en algas rojas y cianobacterias. En Gracilaria chilensis estos ficobilisomas están formados por tres tipos de proteínas: Ficoeritrina, Ficocianina y Aloficocianina cuya unidad básica es un heterodímero. Las secuencias y las estructuras terciarias de ambas subunidades en las tres proteínas son muy semejantes, como hemos demostrado al resolver las estructuras tridimensionales de Ficoeritrina y Ficocianina por difracción de rayos-X (1eyx, 2bv8). La unidad funcional para Ficoeritrina y Ficocianina corresponde a un hexámero del heterodímero, en todas las estructuras cristalinas resueltas, sin embargo Aloficocianina se presenta solo como un trímero del heterodímero.
En el presente mediante herramientas bioinformáticas y análisis estructural, se estudiaron las diferencias de secuencias y estructurales de los residuos involucrados en las superficies de interacción en Ficocianina y Ficoeritrina, con el objeto de encontrar los patrones conservados. La comparación de estos patrones por superposición de las estructuras de hexámeros y trímeros nos permitieron encontrar las diferencias que causarían la diferencia en el estado de oligomerización entre las ficobiliproteinas.
Estas diferencias están siendo analizadas por estudios de docking molecular para tratar de inducir la hexamerización de la Aloficocianina.
Financiamiento Proyecto DIUC 205.037.002-1

 

14. CARACTERIZACIÓN DE LA INTERACCIÓN DE LAS PROTEÍNAS DE E. COLI FtsZ Y ZipA UNIDA A LIPOSOMAS. (Characterization of the interaction between E. coli FtsZ and ZipA bound to liposomes). Ordenes, A., Brunet, J., Lagos, R. y Monasterio, O. Departamento de Biología, Facultad de Ciencias, Universidad de Chile.

La división celular bacteriana requiere de la interacción secuencial de al menos 12 proteínas que originan el Divisoma. El primer evento de la división de E. coli es la polimerización de EcFtsZ (Filamentous thermo sensitive Z) para formar el anillo Z en la mitad longitudinal de la cara interna de la membrana plasmática. Se ha postulado que ZipA o FtsA estabilizan la unión del anillo a la membrana. ZipA (36,4 kDa) se une a la membrana por una hélice hidrófoba contigua a un tallo rico en prolinas y glutaminas que une un extenso dominio carboxilo terminal responsable de la unión de FtsZ. ZipA-His6 se purificó y marcó covalentemente con TAMRA (carboxitetrametil-rodamina) y se insertó en liposomas formados a partir de un extracto de lípidos totales de membranas de E. coli. La unión de EcFtsZ a ZipA libre y unida a liposomas se siguió por anisotropía de fluorescencia de la sonda. Se encontraron dos constantes de unión aparente para ZipA libre, Kd1 = 1,7 ± 0,1 ºM y Kd2 = 14,3 ± 0,1 ºM y una para ZipA unida, Kd = 8,7 ± 0,2 ºM. La orientación de ZipA en los proteoliposomas se determinó por su susceptibilidad a proteólisis controlada con tripsina. Se concluye que EcFtsZ se une a ZipA unida a membrana y apoya el modelo propuesto para la estabilización del anillo Z.
Proyecto FONDECYT 1050677.

 

15. EXPRESIÓN, PURIFICACIÓN Y CARACTERIZACIÓN DE LOS DOMINIOS AMINO Y CARBOXILO TERMINAL DE FTSZ DE E. COLI (Expression, purification and characterization of FtsZ amino and carboxy terminal domains from E.coli). Montecinos, F. Lagos, R. Monasterio, O. Departamento de Biología, Facultad de Ciencias, Universidad de Chile.

FtsZ es una GTPasa que participa en la división celular de E.coli (EcFtsZ) a través de la formación del anillo Z y polimeriza tanto in vitro como in vivo. A partir de la estructura cristalina de FtsZ de Methanococcus jannaschii se modeló la estructura tridimensional de EcFtsZ y se identificaron dos dominios, uno amino de unión a nucleótido y otro carboxilo que participa en las interacciones longitudinales de los protofilamentos. El plegamiento de EcFtsZ es reversible y el cambio en estructura secundaria asociado a la liberación del nucleótido sugiere la presencia de un intermediario termodinámico. Estudios de desplegamiento al equilibrio sugieren que la interacción entre ambos dominios confiere estabilidad a la proteína nativa. Para comprobar esta hipótesis, a partir del modelo de EcFtsZ, se determinó el sitio de corte mas apropiado para no alterar la estructura secundaria de ambos dominios y se diseñó su secuencia nucleotídica la cual fue subclonada en pT7-7 introduciendo colas de histidina en el aminoácido carboxilo terminal de cada fragmento. El dominio amino se expresó como cuerpos de inclusión en BL21(DE3) y el carboxilo en forma soluble en BL21(DE3)plysS. El dominio amino se purificó desde los cuerpos de inclusión mediante cromatografía de afinidad en condiciones desnaturantes. El dominio carboxilo se purificó en condiciones nativas mediante cromatografía de afinidad y filtración molecular. Se caracterizó el estado de agregación, el contenido de estructura secundaria, la estabilidad y funcionalidad de los dominios por separado y juntos.
Proyecto FONDECYT 1050677.

16. REGIONES DE LA ESTRUCTURA 3D DE FtsZ ESENCIALES PARA LA ESTABILIDAD Y LA FUNCIÓN. (Essential structural regions for stability and function of FtsZ). Arbildua, J., Garcés, A., Díaz, R., Lagos, R. y Monasterio, O. Departamento de Biología, Facultad de Ciencias, Universidad de Chile.

La FtsZ de E. coli, una proteína esencial para la división bacteriana, esta compuesta por un dominio amino de unión a nucleótido y otro carboxilo, ambos involucrados en interacciones proteína-proteína en el ensamblaje de protofilamentos. La unión de GTP induce su polimerización y la hidrólisis desestabiliza los protofilamentos. Con el objeto de caracterizar los cambios conformacionales asociados a la hidrólisis de GTP se analizaron las posiciones relativas de los C-a de las estructuras cristalográficas de FtsZ en estado GTP y GDP y los movimientos correlacionados por simulaciones de dinámica molecular. Se observó una correspondencia entre los residuos involucrados en la hidrólisis de GTP mayor al 60% y una transmisión de los cambios conformacionales del dominio amino al dominio carboxilo terminal, lo que sugiere una acción concertada de ambos dominios. Se determinó que la interfase entre los dominios amino y carboxilo, en especial la hélice H7, tiene un papel fundamental en la estabilidad de la proteína. Estos resultados se confirmaron por el efecto de las mutaciones sitio dirigido, F135W y F40W en el dominio amino e I294W en el dominio carboxilo, sobre la actividad GTPásica y la polimerización de EcFtsZ. Proyecto FONDECYT 1050677.

BIOLOGÍA MOLECULAR

17. ANÁLISIS GENÓMICO DE AISLADOS CHILENOS DE VIRUS DE VIDES Y DESARROLLO DE SISTEMAS DE INMUNODETECCIÓN (Genomic analysis of Chilean isolates of grapevine viruses and development of immunodetection systems). Arredondo, V., González, A., Girardi, C., Engel, E., Bruno, C., Escobar, P., Krämer, M., Krawczyk, P. y Valenzuela, P.D.T. Fundación Ciencia para la Vida e Instituto MIFAB. Av. Zañartu 1482, Santiago - Chile.

La viticultura en Chile se ha convertido en los últimos años en una de las bases más importantes de nuestra economía. Con el fin de mantener un alto nivel de calidad y producción de vides chilenas, nacen en nuestro país estudios de las condiciones fitosanitarias de éstas, considerando la virosis como uno de los factores negativos en la producción de los cultivos, calidad de los frutos y sus derivados. Entre las regiones IV y VII, los virus que afectan mayormente a las vides chilenas son: Grapevine fleck virus (GFkV), Grapevine fanleaf virus (GFLV), Grapevine leafroll associated virus 1, 2 y 3 (GLRaV-1, 2 y 3), Grapevine virus A (GVA) y Grapevine rupestris stem pitting associated-virus (GRSPaV).
En el presente trabajo caracterizamos aislados virales locales obtenidos de vides infectadas con los virus: GFLV, GFkV, GLRaV-1 y 3, lo cual nos permitió realizar estudios de variabilidad genómica. Basándonos en las secuencias obtenidas, expresamos las proteínas de cubierta viral recombinantes en sistemas bacterianos y desarrollamos anticuerpos monoclonales y policlonales para su utilización en sistemas de inmunodiagnóstico específico basados en ELISA e inmunocaptura viral (IC-RT-PCR). Financiado parcialmente por el Proyecto Genoma Chile G02S1001.

 

18. ZINC MODULA LA UNIÓN DE FACTORES HIPOFISIARIOS A UN ELEMENTO RESPUESTA A METAL (MRE) EN LA REGIÓN REGULATORIA DE UN GEN PIT-1 DE CARPA, Cyprinus carpio. Muñoz, A.1, Castro, L.1, Salazar, M.1, Grothusen, H., Muller, M.2, Figueroa, J.1, Kausel, G.1
1
Laboratorio de Biología Molecular de Peces, Instituto de Bioquímica, Universidad Austral de Chile, Valdivia, Decima Región Chile, 2Laboratoire de Biologie Moleculaire et de Genie Genetique, Institut de Chimie, Universite de Liege, Liege. E-mail: gkausel@uach.cl

Con el objetivo de desarrollar genes de factores de transcripcion como bioindicadores de respuesta temprana a cambios nefastos del medio ambiente acuático caracterizamos regiones regulatorios de factores hipofisiarios de C. carpio. El factor de transcripción Pit-1 constituye un nodo importante en la red de regulación transcripcional de los factores de la glándula pituitaria, donde regula la expresión entre otros de prolactina, hormona de crecimiento y su propio gen. Por primera vez se ha identificado un elemento respuesta a metal (MRE) en uno de los genes duplicados Pit-1 de carpa. Ensayos de unión (EMSA) con un extracto nuclear de hipófisis de carpa y de células GH3B6 muestran interacción especifica. El aumento de la unión en presencia de 60uM Zn sugiere que se trata del metal transcription factor 1 (MTF-1). El elemento MRE ubicado como un modulo exclusivo en la región 5'-rio arriba de la secuencia codificante de Pit-1 gen-I y ausente en el gen-II sugiere una regulación diferencial de los dos genes en este pez.
DID-UACh-2004-57, AGCI/CGRI-DRI-10/01068-3.4, FNC1040073.

19. IDENTIFICACIÓN DE ELEMENTOS CIS-REGULATORIOS EN LOS GENES PIT-1 DE Cyprinus carpio. Vera, T.1, Castro, L.1, Salazar, M.1, Muller, M.2, Figueroa, J.1, Kausel, G.1
1
Laboratorio de Biología Molecular de Peces, Instituto de Bioquímica, Universidad Austral de Chile, Valdivia, Decima Región Chile, 2Laboratoire de Biologie Moleculaire et de Genie Genetique, Institut de Chimie, Universite de Liege, Liege. E-mail: gkausel@uach.cl

El factor de transcription Pit-1 esta involucrado en la regulación transcripcional de una red de factores hipotálamo-hipofiseales que incluyen prolactina, hormona de crecimiento y su propio gen. De acuerdo con la hipótesis de trabajo, Pit-1 juega un rol importante en la regulación de la respuesta adaptativa a cambios del medio ambiente en el teleósteo ectotermo Cyprinus carpio, un vertebrado tetraploide, que se encuentra funcionalmente diploidizado. En el genoma duplicado de la carpa existen dos genes Pit-1 y se detectaron transcritos de los dos genes por RT-PCR. Mayotariamente se observaron transcritos del gen-I por hibridación in situ en cortes de la glándula pituitaria de carpas aclimatizadas a invierno, en los cuales la expresión total de Pit-1 es baja, en comparación a los de verano. El análisis por EMSA confirma la unión especifica de factores hipofisiarios o de células CH3B6 a los sitios AP1, CRE y Pit1 (ccP3), que están presentes en los dos genes. También se confirman los sitios distales de Pit-1 del gen-I (ccP4, ccP5, ccP6), pero no los del gen-II (ccP1, ccP2). La identificación de elementos cis-regulatorios permitirá comprender mejor como se transmite y procesa la información sobre cambios ambientales en este pez.
DID-UACh-2004-57, AGCI/CGRI-DRI-10/01068-3.4, FNC1040073.

 

20. BÚSQUEDA DE FACTORES GENÉTICOS MITOCONDRIALES QUE DETERMINAN AVERSIÓN AL ALCOHOL: DIFERENCIAS ENTRE RATAS UChA Y UChB (Search for mitochondrial genetic factors that determine aversion to ethanol: differences between UChA and UChB rats) González-Martínez1, G., Sapag1, A., Quintanilla2, M.E., Tampier2, L., Israel1, Y. (1) Laboratorio de Farmacoterapia Génica, Facultad de Ciencias Químicas y Farmacéuticas y (2) Laboratorio de Farmacogenética del Alcoholismo, Facultad de Medicina, Universidad de Chile.

En ratas no bebedoras de alcohol UChA el complejo I mitocondrial, que oxida NADH mitocondrial a NAD+, tiene una capacidad menor de oxidar el NADH que el de ratas bebedoras UChB. Así, la menor disponibilidad de NAD+ en ratas UChA contribuye a su menor preferencia por beber alcohol dado que la deshidrogenasa alcohólica y, principalmente la deshidrogenasa aldehídica, utilizan NAD+ mitocondrial como cofactor para metabolizar el etanol.
En este trabajo se buscaron diferencias entre linajes bebedores y no bebedores de ratas en el gen mitocondrial mt-Nd1 que codifica una subunidad del complejo I. Se amplificó el gen mediante PCR de DNA genómico de cinco ratas UChA y cinco ratas UChB. La secuenciación de los amplicones reveló dos nuevos alelos.
El gen mt-Nd1 de ratas UChA se distingue del de ratas UChB por siete transiciones pirimidínicas. Aunque estas variaciones no conducen a cambios aminoacídicos, podrían afectar la eficiencia de la traducción de genes mitocondriales o la estabilidad del transcrito, incidiendo en la abundancia relativa de componentes del complejo I, en su actividad y constituyendo un factor materno en la aversión al etanol.
FONDECYT 1050480.

21. LAS PORINAS HopA y HopW DE Helicobacter pylori CHCTX-1 ESTÁN BAJO CONTROL DE EXPRESIÓN ON/OFF POR DESPLAZAMIENTO DE HEBRA. (Porins HopA and HopW from Helicobacter pylori CHCTX-1 are under on/off expression control by slipped-strand displacement) Morales, J.P., Lienlaf M., Diaz, M.I. y Venegas A. Pontificia Universidad Católica de Chile.

Objetivo: La secuenciación de los genomas de H. pylori 26695 y J99 revelaron la presencia de una familia de proteínas (Hop) con función de porinas y adhesinas. Algunas están bajo control de expresión on/off por mutagénesis causada por desplazamiento de hebra durante replicación. El objetivo fue evaluar la integridad de genes de porinas de H. pylori mediante clonamiento, secuenciación parcial y expresión. Métodos: Los genes hopA, HopE, HopV y HopW de la cepa CHCTX-1 se amplificaron por PCR, se clonaron en pGEM-T y se transfirieron a un vector de expresión (pET21a, pET21d) y los insertos se secuenciaron parcialmente desde el extremo 5´ del gen. Resultados: La secuenciación desde el extremo 5´ mostró integridad del marco de lectura para hopE y hopV, confirmado por expresión en E. coli AD494(DE3). Las secuencias de los genes hopA y hopW mostraron mutaciones "non-sense" localizadas al comienzo de la región codogénica las que impiden su correcta expresión. Conclusiones: Los genes de las porinas HopE y HopV de H. pylori CHCTX-1 se expresan normalmente en E. coli y la cepa original, en cambio hopA y hopW estarían bajo control de expresión on/off generando variación antigénica y facilitando persistencia del patógeno en el hospedero.
Financiamiento: FONDECYT 1030894.

 

22. EXPRESIÓN DE ARN QUIMÉRICO MITOCONDRIAL DURANTE PROLIFERACIÓN Y DIFERENCIACIÓN DE MIOBLASTOS DE RATÓN. (Mitochondrial chimeric RNA expression during proliferation and differentiation of mouse myoblasts). Restovic F., Burzio, V., Villegas, J. and Burzio. L.O. BiosChile I.G.S.A., Instituto Milenio MIFAB, Fundación Ciencia Para La Vida y Universidad Andrés Bello. Av. Zañartu 1482, Santiago, Chile.

Los ARN quiméricos (ARNq) constituyen una familia de nuevos transcritos mitocondriales en los cuales el ARN mitocondrial 16S sentido o antisentido están unidos a fragmentos del ARN complementario o repetidos invertidos. En consecuencia, estos transcritos tienen horquillas de diferente tamaño en pb y asas de longitud variable. Estos transcritos requieren de transcripción mitocondrial para su síntesis, pero no están codificados directamente en el mtDNA. Hemos sugerido que la síntesis de los ARNq es una reacción post-transcripcional.
Células humanas en proliferación expresan tanto el RNAq sentido como los ARNq antisentido. En contraste, las células tumorales expresan el ARNq sentido y reprimen la expresión del ARNq antisentido. Por lo tanto un cambio drástico que ocurre durante transformación y diferenciación neoplásica es la represión de los ARNq antisentido. Para determinar la expresión de estos transcritos durante la diferenciación de una célula normal, se utilizó como modelo la diferenciación de mioblastos (C2C12) a miotúbulos in vitro. Previamente se determinó la estructura de los transcritos sentido y antisentido del ratón. Las células C2C12 expresan tanto el ARNq sentido como el antisentido. Al diferenciarse, en la gran mayoría de miotúbulos se observa represión de ambos transcritos.

23. CARACTERIZACIÓN FENOTÍPICA Y MOLECULAR EN INDIVIDUOS FUERA DE TIPO DE ARROZ EN CHILE (Phenotypic and molecular characterizacion in off type individuals of rice in Chile) Vita, JM., Bustamante, K., Gebauer, M.
Departamento de Ciencias Vegetales, Facultad de Agronomía e Ingeniería Forestal Pontificia Universidad Católica de Chile

El objetivo de este estudio fue caracterizar morfológica y molecularmente plantas de arroz (Oryza sativa L.) fuera de tipo colectadas en Chile, evaluándose 35 individuos y cuatro variedades (Ambar, Brillante, Diamante y Oro) mediante 12 descriptores morfológicos y 21 marcadores moleculares de microsatélites. Los datos obtenidos fueron analizados mediante componentes principales (CP) y análisis de cluster. El análisis fenotípico mostró que cinco componentes explican el 91% de la variación, siendo las características del grano paddy, las más importantes en el componente uno. El análisis de cluster identificó tres grupos, considerándose el 60% de los individuos en el cluster II, incluyendo Diamante y Brillante. Durante el análisis molecular, los 21 partidores ensayados en marcadores de SSR, generaron 11 bandas de ADN polimórficos. Solo el partidor RM249 pudo discriminar entre Diamante y Brillante. El análisis de CP mostró que el 91% de la variabilidad se puede explicar mediante seis componentes. El análisis de cluster, generó cuatro grupos, agrupando el cluster I el 49% de los individuos, siendo nueve de ellos molecularmente idénticos a Brillante y uno a Diamante. Los resultados obtenidos a nivel fenotípico y molecular son coincidentes y con baja dispersión de datos, esto indicaría poca variabilidad dentro del material de arroz colectado.

 

24. EFECTOS DEL COACTIVADOR POSITIVO (PC4) DE S. POMBE SOBRE LA TRANSCRIPCIÓN BASAL (S. Pombe pc4 affects basal transcription). Contreras J., Tamayo E., Urbina F. y Maldonado E., Facultad de Medicina, ICBM, Programa de Biologia Celular y Molecular, Universidad de Chile, Santiago, Chile

La activacion de la transcripcion llevada a cabo por RNA polimerasa II es un proceso complejo que involucra multiples factores. Nosotros hemos clonado de S. pombe el coactivador positivo PC4 y demostramos que es capaz de estimular la transcripcion basal en extractos celulares de S. pombe. El paso de la transcripcion que estimula PC4 es la iniciacion de la transcripcion. Por cromatografia de afinidad hemos detectado que PC4 es capaz de interactuar con multiples proteinas en extractos celulares de S. pombe. Tambien PC4 puede ser fosforilado por la quinasa CK2 y esa fosforilacion es llevada a cabo por la subunidad alpha, mientras que la subunidad beta es capaz de inhibir la fosforilacion. PC4 fosforilado por CK2 es inactivo, mientras que la proteina no fosforilada es activa en la estimulacion de la transcripcion. S. pombe PC4 es capaz de interactuar con varios factores de transcripcion y con el Mediador. Nuestros proximos experimentos estan diseñados para conocer las proteinas que interactuan con PC4 y el efecto de este factor en un ensayo reconstituido.
Fondecyt 1050475

25. ESTRATEGIA PARA EL DISEÑO DE PARTIDORES DE METALOTIONEÍNAS EN UNA GRAMÍNEA NATIVA TOLERANTE A COBRE (Primers design strategy for metallothioneins in a copper tolerant native gramineae) Barindelli E. y Ortiz C.
Departamento de Biología, Facultad de Química y Biología, Universidad de Santiago de Chile cortiz@lauca.usach.cl

Las metalotioneínas (MTs) son proteínas de bajo peso molecular, ricas en cisteína y con la capacidad de unir metales pesados. Estas proteínas son sintetizadas frente a estímulos como senescencia, heridas, hormonas vegetales y presencia de metales pesados como cobre, sugiriendo una función en la homeostasis metálica. Polypogon sp. es una gramínea nativa de Chile que acumula cobre tanto in vivo como en condiciones de laboratorio. Poblaciones de la gramínea han sido encontradas en un tranque de relaves mineros en Copiapó, y han demostrado ser altamente tolerantes a cobre. Se ha propuesto una relación entre la tolerancia a cobre y la presencia de MTs, para lo que se determinará la presencia de genes que codifican para estas proteínas mediante PCR de DNA genómico.
Debido a la ausencia de información genómica de esta especie, se buscó secuencias de MTs de otras especies vegetales, encontrándose una identidad adecuada entre las secuencias de genes de MTs de la familia Poaceae, a la cual pertenece el género Polypogon.
Mediante el uso de las herramientas bioinformáticas Clustal-X, BlockMaker, FAST-PCR y Blastn se diseñaron dos pares de partidores heterólogos que presentaron una alta homología con los extremos 5' y 3' del gen. Estas regiones codifican para los extremos amino y carboxilo terminal, donde se encuentran sitios ultraconservados y "clusters" de cisteína, claves en el rol de las MTs.

 

26. ANÁLISIS GENÉTICO DE CEPAS DE DEKKERA BRUXELLENSIS DE DISTINTO ORIGEN GEOGRÁFICO (Genetic analysis of Dekkera bruxellensis strains of distinct geographical origin) Garrido, D.2,3, González, R.2,3, Véliz, G. y Martínez, C.1,2.
1Departamento de Ciencia y Tecnología de Alimentos y 2Centro de Estudios en Ciencia y Tecnología de los Alimentos, Universidad de Santiago de Chile, y 3Roche Applied Science, Santiago, Chile. E-mail: cmartinez@usach.cl. Patrocinado por: Dr. Antonio Castillo.

El género Dekkera/Brettanomyces ha sido descrito como uno de los principales responsables de contaminación en vinos, y las pérdidas económicas derivadas son cuantiosas. Estas levaduras se caracterizan por producir fenoles volátiles, principalmente 4-etilfenol, los que producen aromas indeseados en el vino, descritos como sudor de caballo o témpera. La presencia de estas levaduras ha sido reportada en casi todas las zonas vitivinícolas en el mundo. El objetivo de este trabajo fue caracterizar mediante técnicas moleculares el genoma de cepas de esta levadura de distinto origen geográfico, y realizar análisis de similitud genética. Doce cepas de Brettanomyces bruxellensis fueron sometidas a RAPD-PCR, y además caracterizadas por su patrón de restricción del DNA mitocondrial. El análisis por RAPD-PCR permitió diferenciar las doce cepas, observándose un nivel de variabilidad mucho mayor que el aportado por el RFLP del mtDNA, donde solo encontramos dos tipos de perfiles. En general observamos que cepas que poseen un mismo origen geográfico poseen mayor similitud genética, determinada por el dendrograma generado por RAPD, y además pertenecen a uno de los dos perfiles descritos para el RFLP del mtDNA.
PROYECTO FONTEC 204-4042

27. CARACTERIZACIÓN DE DOS MARCADORES MOLECULARES CODOMINATES ASOCIADOS CON FECHA DE DESOVE EN SALMÓN COHO (Oncorhynchus kisutch). Characterization of two co-dominant molecular markers associated with spawning date in coho salmon (Oncorhynchus kisutch). Araneda C., Gómez G., Pérez C., Díaz N. Departamento de Producción Animal, Facultad de Ciencias Agronómicas, Universidad de Chile. Casilla 1004, Santiago, Chile. Patrocinio Iturra Patricia.

En los salmones la fecha de desove es un importante rasgo productivo y de historia de vida, que determina la época de fertilización, eclosión de la progenie, afecta la tasa de crecimiento y la probabilidad de sobrevivir de los alevines. Este rasgo esta bajo control poligénico (0.53 £ h2 £ 0.65), y se han identificado varios QTLs afectando su expresión. En un screening con 400 partidores RAPD entre "pooles" de ADN provenientes de hembras de dos poblaciones de salmón coho que difieren en la fecha de desove, se han identificado tres polimorfismos RAPD asociados con el rasgo (partidores UBC-075, UBC-229 y UBC-249). Dos de estos polimorfismos fueron convertidos en marcadores codominantes de locus simple: Oki075 (AY926350) y OkiCAT229UCH (AY926352), que presentan asociación con fecha de desove. Dentro del marcador Oki075 se identificó un motivo repetido tipo minisatélite de ~52 pb, OkiCAT229UCH fue convertido en un marcador microsatélite dada la presencia de un dinucleótido (TG/AC) repetido en tandem. Búsqueda de similitudes con Blast-n muestran que Oki075 comparte homología con el gen de la sub-unidad beta de la hormona estimulante folicular (FSHbeta) de salmón chinook (Score = 182, E value = 9e-43).
Proyecto FIA-BIOT-01-AC-21

 

28. DESARROLLO DE UNA VACUNA DE ADN CONTRA EL VIRUS DE INFLUENZA EQUINA. (Development of a DNA vaccine for equine influenza virus). Müller, I. y Valenzuela, P.D.T. Bios Chile I.G.S.A., Instituto MIFAB y Fundación Ciencia para la Vida, Zañartu 1482, Santiago.

La influenza equina es una enfermedad causada por los virus subtipos A/Equi-1 (H7N7) y A/Equi-2 (H3N8). Hasta el momento no ha sido posible prevenir la enfermedad mediante vacunas tradicionales del tipo bacterinas. El objetivo de este trabajo es desarrollar una vacuna que mejore la protección contra esta enfermedad en caballos.
Este virus es esférico, de 80-120 nm de diámetro. La envoltura es una membrana lipídica que contiene las glicoproteínas hemaglutinina (HA), y en menor cantidad neuraminidasa (NA). Dentro de las proteínas internas destaca la nucleoproteína (NP) por su abundancia y por ser altamente conservada dentro del tipo viral influenza A. Por estas razones hemos concentrado nuestros esfuerzos en desarrollar una vacuna genética basada en los genes de estas tres proteínas.
La vacuna, constituída por plasmidios de expresión para estas tres proteínas, fue ensayada en ratones, cuyos sueros fueron cuantificados por ELISA. Utilizando el virus completo como antígeno se obtuvo títulos de 1/1024 para el virus A/Equi-1 y de 1/512 para A/Equi-2. Para determinar que proteínas estaban produciendo respuesta se hicieron ensayos de ELISA utilizando las proteínas recombinantes pegadas a las placas, obteniendo títulos de 1/64 para HA y de 1/32 para NA y NP. Finalmente, se hicieron ensayos de neutralización de la infección en huevos embrionados de pollo, utilizando la técnica de inhibición de la hemoaglutinación como parámetro de neutralización. Los sueros fueron capaces de neutralizar 106,5 virus/ml.

 

29. UTILIZACIÓN DE CÉLULAS DE PIEL DE RATA ENCAPSULADAS EN FIBRINA PARA IMPLANTE AUTÓLOGO (Use of fibrin encapsulated rat skin cells for autolog implant). 1Ferrada, R., 2Brown, D., 3Morales, P., 4Acevedo, C., 1Aceituno, A., 4Albornoz, F.,1Luna, L.,2Henríquez-Roldán, C., 5Maclean, C.,6Tapia, S., 1Weinstein-Oppenheimer, C., 4Young, M.1 Facultad de Farmacia, Universidad de Valparaíso 2Facultad de Ciencias, Universidad de Valparaíso 3Clínica Veterinaria "La protectora""4Centro de Biotecnología Universidad Técnica Federico Santa María 5Instituto de Seguridad del Trabajo, 6 Facultad de Ciencias, Universidad de Playa Ancha de Ciencias de la Educación.

Una de las aplicaciones biotecnológicas del cultivo celular es la búsqueda de sistemas para reparar piel dañada. En esta investigación se ha planteado como hipótesis que células de piel de rata pueden proliferar en cápsulas de fibrina y ser implantadas a la misma rata con un sistema adecuado, sin causar reacciones adversas.
Para validar esto se cultivó células de piel de rata. Estas células fueron posteriormente encapsuladas en fibrina y cultivadas. Mediante el ensayo MTT y por evaluación histológica se demostró proliferación al interior de las cápsulas.
Se realizó un implante autólogo consistente en cápsulas de fibrina con un sistema fisiológicamente aceptable para el organismo. Biopsias realizadas a los 14 días de realizado el implante indicaron ausencia de signos de rechazo sin reepitelización. Biopsias tomadas a los 40 días demostraron la presencia de epidermis en el sitio de la lesión.
Se concluye que el sistema de implante desarrollado no produce consecuencias deletéreas al proceso normal de cicatrización en ratas de laboratorio.
Agradecimientos: FONDEF 02I1009, Beca Doctorado CONICYT D-21050588.

30. GLICOPROTEÍNA Gc DE VIRUS HANTA: EVIDENCIA PARA UNA PROTEÍNA DE FUSIÓN CLASE II (Hantavirus Gc glycoprotein: evidence for a class II fusion protein). Tischler, N.D., González, A., Pérez-Acle, T., Rosemblatt, M. y Valenzuela, P.D.T. Fundación Ciencia para la Vida, Instituto Milenio MIFAB, Centro de Genómica y Bioinformática, Pontificia Universidad Católica y Universidad Andrés Bello, Zañartu 1482, Santiago.

Los virus hanta entran a la célula por medio de la unión a la célula y la posterior fusión de su membrana con la de la célula. Aún no se ha definido el rol de las dos glicoproteínas virales de la envoltura, Gn y Gc, en la unión al receptor y en la fusión con membranas celulares. En este trabajo se ha identificado una secuencia en la glicoproteína Gc de los virus hanta que posee las características de péptidos de fusión clase II de las proteínas E1 de los virus alpha y E de los flavivirus. Se propone un modelo molecular comparativo para la proteína Gc del virus Andes (virus hanta) basado en datos cristalográficos de la proteína E del virus tick-borne, el cual confirma la posible existencia de un plegamiento de acuerdo a una proteína de fusión clase II. Se entrega evidencia experimental in vitro para la unión a membranas artificiales del candidato péptido fusión del virus Andes mediante en ensayos de anisotropía. En resumen, nuestros resultados apoyan la hipótesis de que la glicoproteína Gc de los virus hanta y de otros miembros de la familia Bunyaviridae dirige la actividad fusogénica del virus y podría ser clasificada como proteína de fusión clase II.

INMUNOLOGÍA

31. LA INFLUENCIA DE LA APOPTOSIS EN LA ODONTOGENESIS (The influence of apoptosis in the odontogenesis) Vilaxa, A.1, Escobar, J.1, Unda, F.2 y de Vega, S.2 1Facultad de Ciencias, Universidad de Tarapacá. 2Departamento de Biología Celular, Facultad de Medicina y Odontología, Universidad del País Vasco

En la odontogénesis y durante la etapa de morfogénesis, el epitelio dental comienza a proliferar en su parte inferior hasta formar una estructura semejante a una caperuza, momento que aparece un conjunto de células definidas denominadas nudo del esmalte primario, el cual es un centro señal implicado en la formación de las crestas dentales. El proceso de diferenciación puede terminar en muerte celular programada o apoptosis. Con el objetivo de analizar y relacionar el proceso apoptótico con la formación del diente, gérmenes dentales de embriones de ratones de 14 días de desarrollo se cultivaron durante 1 y 4 días en presencia de agentes morfogenéticos: heparina, ácido retinoico y SU5402. Mediante ensayo TUNEL y el test inmunohistoquímico para BrdU se determino apoptosis y proliferación celular respectivamente. Los molares de 14+1 día de cultivo en presencia de ácido retinoico son semejante a los controles. La presencia de heparina y SU5402, produce aumento de células apoptóticas. En cultivos de 14+4 días, solo en presencia de heparina y SU5402 muestran retraso en su desarrollo, escasa cantidad de células apoptóticas en el epitelio dental y ausencia de nudos del esmalte secundarios. Los resultados sugieren que la apoptosis es un proceso regulado que condiciona la odontogenesis.
Financiado por proyecto UTA y UPV

32. ESTUDIO DE LA APOPTOSIS DE NEUTRÓFILOS MEDIADA POR PATÓGENOS PERIODONTALES. (Study of the neutrophil apoptosis by periodontal pathogens). Chandía, S1., Valenzuela, M.A1., Chaparro, A2., Dutzan, N2, Vernal, R2., León, R2. Puente, J1. Gamonal, J2. 1Departamento de Bioquímica y Biología Molecular. Facultad de Ciencias Químicas y Farmacéuticas. 2Departamento de Odontología Conservadora Facultad de Odontología. Universidad de Chile.

Los neutrófilos se encuentran hiperreactivos en la enfermedad periodontal y presentarían una desregulación en la apoptosis, acumulándose y aumentando el daño tisular. Se estudió la activación y apoptosis de neutrófilos humanos normales y de enfermedad periodontal, por acción de patógenos periodontales.
Los neutrófilos se purificaron desde sangre periférica de pacientes con periodontitis crónica sin tratamiento y de controles sanos mayores de 35 años. Se incuban 106 cel/ml en medio RPMI-1640 - suero fetal bovino, con extractos de Actinobacillus actinomycetemcomitans (Aa), Porphyromonas gingivalis (Pg); LPS E.coli por períodos de 4 y 8 h. La apoptosis, utilizando ioduro de propidio y los marcadores fenotípicos, CD62L y CD11b, se determinaron por citometría de flujo. Los neutrófilos patológicos presentaron valores menores que los controles de CD62L y apoptosis (n=11; % promedio ± SD; 52,8 ± 12,3 vs 20,9 ± 18,0 y 42,5±17,1 vs 17,1± 11,5. P < 0,05 Student t test). El efecto de Pg, Aa y LPS mostró una disminución de la expresión de CD62L y aumento de CD11b en neutrófilos de pacientes y controles, en relación a los valores basales. En conjunto estos resultados sugieren que los neutrófilos patológicos presentan activación y un retraso en la apoptosis.
Proyectos CSIC-U.Chile, Fondecyt 1050518.

 

33. PARTICIPACIÓN DE IgM, PRL y SU RECEPTOR EN LA RESPUESTA INMUNE DE SALMÓN DEL ATLÁNTICO (Salmo salar) DESAFIADOS CON PATÓGENOS BACTERIANOS. (Participation of IgM, PRL and its receptor in the immune response of Atlantic salmon (Salmo salar) defied with bacterial pathogens). González, R., Romero, A. Haussmann, D. y Figueroa, J. LabBMP, Instituto de Bioquímica, Facultad de Ciencias, Universidad Austral de Chile, Valdivia. Novartis, Pto. Varas.

Los teleósteos han desarrollado un sistema inmune innato, donde diversas macromoléculas aumentan el reconocimiento inmune. Sus células poseen actividad fagocítica, citotóxicas y mediadoras de inflamación, entre otras, para minimizar el daño o actuar directamente sobre el patógeno. Sin embargo, en su respuesta humoral solo poseen IgM e IgD.
Recientemente, se ha establecido que la actividad del sistema inmune de peces puede ser potenciada por hormonas neuropeptídicas como prolactina (PRL).
En este trabajo, se evaluaron los niveles de expresión del receptor de PRL por Inmunohistoquímica en leucocitos de improntas y aislados de riñón cefálico y su capacidad para generar anión superóxido. En ambos casos se evidenciaron diferencias entre peces sanos y desafiados a un patógeno. Utilizando un anticuerpo monoclonal anti-IgM de salmón, se cuantificaron por western-blot los niveles plasmáticos de IgM, evidenciándose un incremento en peces desafiados con patógenos con respecto a los controles. Estos datos permitirían establecer una correlación entre la activación de los leucocitos en peces desafiados y la hormona PRL, cuyo receptor se expresa en células del sistema inmune de salmón del Atlántico.
Fondecyt 1040073

34. EVALUACIÓN DE LAS APOLIPOPROTEÍNAS A-I Y A-SAA COMO REACTANTES DE FASE AGUDA EN Oncorhynchus mykiss. (Evaluation of apolipoproteins A-I and A-SAA as acute phase reactants in Oncorhynchus mykiss). Villarroel, F., Casado, A., Amthauer, R. y Concha, M.I. Instituto de Bioquímica, Facultad de Ciencias, Universidad Austral de Chile, Valdivia, Chile.

En mamíferos las apolipoproteínas A-I (apoA-I) y sérica amiloide A (A-SAA) son consideradas reactantes de fase aguda negativa y positiva, respectivamente. Ello implica que su síntesis hepática se ve disminuida o aumentada en respuesta al efecto de citoquinas proinflamatorias liberadas durante la fase aguda.
Debido a su abundancia en el plasma y a su comprobada actividad antimicrobiana, la apoA-I ha sido considerada un importante efector de la inmunidad innata en los peces teleósteos. Por ello se evaluó mediante RT-PCR multiplex y Western blot la expresión de ambas apolipoproteínas en hígado de truchas arcoiris (sanas y enfermas) y en hepatocitos aislados estimulados con altas concentraciones de lipopolisacárido bacteriano (LPS).
Los resultados indican que apoA-I no disminuiría sus niveles de expresión y secreción durante la fase aguda, lo cual resultaría beneficioso para estos peces debido a las múltiples funciones defensivas de esta proteína. Por otra parte, en el hígado de peces naturalmente enfermos y en hepatocitos estimulados con LPS solo aumentó moderadamente la expresión de A-SAA, inmunodetectándose en el medio de cultivo de estos últimos, pero no en el plasma de peces enfermos, contrastando con lo observado en mamíferos. Ello podría explicar la ausencia de amiloidosis secundaria en peces.
Financiamiento: Proyectos Fondecyt 1050637 y DID-UACh S-2004-40.

 

35. PURIFICACIÓN, MEDICIÓN DE ACTIVIDAD ENZIMÁTICA DE CALICREÍNA GLANDULAR DE Salmo salar Y ANÁLISIS DE EXPRESIÓN EN PIEL Y MUCUS DE PECES SANOS Y DESAFIADOS A UN PATÓGENO. (Purification, measurement of enzymatic activity of glandular calicreína from Salmo salar and analysis of expression in skin and mucus of healthy and defied fish with a pathogen). Haussmann, D y Figueroa, J.. Instituto de Bioquímica, Facultad de Ciencias, Universidad Austral de Chile, Valdivia. NOVARTIS Puerto Varas S.A.

Calicreína glandular (CG) es una serina-proteasa con actividad tipo tripsina, que está presente en múltiples tipos celulares de peces. En este trabajo se purificó CG a partir de músculo de Salmo salar, y se midió su actividad enzimática por la capacidad de escindir el sustrato Leu-Val-Arg-nitroanilide, además de la eventual activación por tripsina.
Por otro lado, los peces poseen un sistema inmune innato altamente desarrollado donde macromoléculas como IgM, lisozima, y otras enzimas juegan un rol defensivo fundamental y teniendo presente que el mucus y la piel de los peces poseen actividad tipo tripsina, se exploró la participación de CG en mucus y piel de salmones sanos y desafiados a un patógeno. Por inmunohistoquímica de piel y Western-blot de proteínas de mucus de peces sanos y desafiados se evidencia que la exposición a agentes patógenos, denotan una sobre-expresión de esta serina proteasa. Por otro lado se evaluó la actividad de CG en el mucus de peces sanos y enfermos.
Con todos estos antecedentes se cree que CG estaría jugando posiblemente un rol importante en el sistema inmune innato del salmón del Atlántico.
Proyecto FONDECYT 1040073

36.Montaje de un sistema de caracterización molecular para genotipificación de Deficiencia de Adhesión Leucocitaria Bovina (BLAD) y Deficiencia de Argininosuccinato Sintetasa Bovina (Citrulinemia Bovina).
1Sepúlveda, H.,
2Ortiz, M. y 1Figueroa, J. 1 Instituto de Bioquímica, Facultad de Ciencias, Universidad Austral de Chile. 2 Centro de Inseminación Artificial, Universidad Austral de Chile.

La Deficiencia de Adhesión Leucocitaria Bovina (BLAD) es una enfermedad autosómica recesiva cuya característica es la deficiencia en la capacidad de unión de leucocitos bovinos a los antígenos siendo letal en ganado Holstein.
La Deficiencia de Argininosuccinato Sintetasa Bovina (Citrulinemia Bovina) es una enfermedad autosómica recesiva cuya característica es una hiperamonemia debido a la interrupción del ciclo de la urea resultando en coma y muerte al no haber un tratamiento vigoroso.
El objetivo de este trabajo es el montaje y estandarización de una metodología para el diagnóstico de estas enfermedades genéticas basándose en PCR y RFLP para su posterior puesta en servicio por parte del Centro de Inseminación Artificial de la UACh para la genotipificación de su ganado y como servicio para el resto del país. La extracción del DNA genómico de bovino a partir de muestras de sangre, pelo y semen se realizó con CHELEX-100 5% siendo un método simple y rápido, que involucra solventes no orgánicos y no requiere múltiples tubos de trasferencia para las muestras. Para la determinación de BLAD se diseñaron partidores con los cuales se obtienen productos de digestión de un mayor tamaño de pares de bases lo que hace más fácil su diagnóstico diferenciándose junto al método de extracción de DNA de anteriores publicaciones.

 

37. TRANSFERASA (RODANASA) de Acidithiobacillus Ferrooxidans. (Purification and characterization of a thiosulfate sulfurtransferase (rhodanese) from Acidiothiobacillus ferrooxidans). Ponce, J.A., Valenzuela, L., Acosta,M., y Jerez, C.A. Laboratorio de Microbiología Molecular y Biotecnología, Departamento de Biología, Facultad de Ciencias, Universidad de Chile. cjerez@uchile.cl

Acidiothiobacillus ferrooxidans es una bacteria quimiolitoautotrófica acidófila, que obtiene su energía a partir de la oxidación del ion ferroso, azufre elemental y otros compuestos de azufre reducidos. La habilidad de este microorganismo para solubilizar los sulfuros metálicos es aprovechada en operaciones de biominería. Se ha propuesto al tiosulfato como el intermediario principal en la oxidación de los sulfuros metálicos. Las rodanasas (tiosulfato: azufretransferasas) son una familia de enzimas ampliamente distribuidas que catalizan in vitro la transferencia de un átomo de azufre sulfano desde el tiosulfato al cianuro como aceptor. La actividad rodanasa ha sido descrita en A.ferrooxidans, lo que sugiere la existencia de una o varias proteínas pertenecientes a esta familia. Mediante análisis bioinformático se encontraron ocho secuencias nucleotídicas que contenían un dominio rodanasa simple en el genoma de A.ferrooxidans 23270: p11, p14, p14.3, p15, p16a, p16b, p21, y p28. Estos ocho genes se aislaron desde el ADN total de A.ferrooxidans, se clonaron y sobreexpresaron en Escherichia coli. Posteriormente se determinó que la proteína P15 presentaba claramente actividad rodanasa, medida en extractos crudos de E.coli recombinantes. Esta proteína tipo rodanasa se purificó a través de una columna de afinidad de níquel-NTA, para su caracterización bioquímica.
Financiamiento: Fondecyt 1030767.

BIOLOGÍA CELULAR Y
BIOMEDICINA

38. ESTUDIO DE LA EXPRESIÓN DEL RECEPTOR DE DOPAMINA D2 EN LÍNEA GERMINAL MASCULINA Y SU EFECTO EN VIABILIDAD ESPERMÁTICA (Dopamine receptor D2 expression in male germ line and its effect in spermatic viability). Torres, M. Carola Otth, Alfredo Ramírez, Mónica Brito, Maite Castro, M. Cecilia Rauch, Alejandro Yañez, Juan Carlos Slebe e Ilona I. Concha. Instituto de Bioquímica, Facultad de Ciencias, Universidad Austral de Chile.

Los receptores de dopamina han sido estudiados principalmente en Sistema Nervioso Central donde modulan funciones como el control motor, memoria, afectividad, placer, adicción y secreción neuroendocrina. A nivel periférico están presentes en el sistema cardiovascular y renal, sin embargo, poco se sabe acerca de su función. En el presente trabajo demostramos por primera vez la expresión de ambas isoformas del receptor de dopamina D2 en testículo de rata mediante análisis de RT-PCR. Mediante ensayos inmunocitoquímicos el receptor fue detectado en túbulos seminíferos y células espermatogénicas aisladas de ratas, así como también en espermatozoides de diversos mamíferos, incluyendo al humano. Se ha demostrado que el receptor D2 es capaz de activar la vía PI3k-Akt (la que se ha visto implicada en señales anti-apoptóticas) en neuronas en cultivo. Estas proteínas están presentes en el espermatozoide y su activación mediada por el receptor de dopamina D2 es capaz de aumentar la viabilidad celular y proteger al espermatozoide de estímulos tóxicos como el H2O2. DID-UACh 200460, FONDECYT 1051122.

39. MECANISMO DE LA INTERACCIÓN DE ANEXINAS I Y II CON FILAMENTOS DE ACTINA (Mechanism of the interaction of annexins I and II with actin filaments. Sandoval, M., de la Fuente, M.
Instituto de Ciencias Biomédicas, Facultad de Medicina, Universidad de Chile

Se ha propuesto que algunas proteínas de la familia de las anexinas participarían en la integración de la señalización de Ca2+ con la dinámica de actina en membranas. Sin embargo se sabe poco sobre las interacciones entre anexinas y actina. La anexina II se une a F-actina e induce la formación de manojos de los filamentos. Dos sitios independientes en la molécula de anexina II serían responsables de estas actividades. La anexina I también puede unirse a los filamentos de actina y formar manojos, pero se ignora el fundamento estructural de estas actividades. Presentamos en este trabajo un modelo para explicar la unión de anexinas I y II y la formación de manojos, basado en experimentos con péptidos y anticuerpos. Los resultados muestran que ambas proteínas compiten entre sí por la unión a los filamentos, pero no por la formación de manojos. Sin embargo la formación de manojos por ambas proteínas es bloqueada en ambos casos por un péptido que representa un dominio conservado de estas anexinas, y por un anticuerpo a esta secuencia. Proponemos que ambas anexinas se unirían a un mismo sitio en el filamento de actina y que ambas formarían los manojos a través de un dominio común conservado.

 

40. OBTENCIÓN DE LÍNEAS CELULARES ESTABLES DEL ROEDOR TETRAPLOIDE Tympanoctomys barrerae (Establishment of cell lines of the tetraploid rodent Tympanoctomys barrerae) Fahrenkrog, A1.; Dobner, T2.; Büchner, D2.; Sieber, T2.; Kausel, G3.; Gallardo, M1. Instituto de Ecología y Evolución, Facultad de Ciencias, Universidad Austral de Chile1; Institut für Medizinische Mykrobiologie und Hygiene, Universität Regensburg, Alemania2; Instituto de Bioquímica, Facultad de Ciencias, Universidad Austral de Chile3.
Patrocinante: Milton Gallardo

Tympanoctomys barrerae es el primer mamífero tetraploide descrito y representa un modelo interesante para estudios de regulación de la expresión génica. Dada la imposibilidad de mantenerlo en cautiverio se procedió a generar líneas celulares que permitan estudios in vitro.
Las líneas celulares se obtuvieron transformando fibroblastos de cultivo primario con genes adenovirales utilizando el método de transfección mediante lipofectamina. La transformación se comprobó construyendo curvas de crecimiento de las líneas celulares, las que presentaron un crecimiento más acelerado que las células de cultivo primario. También se documentaron los cambios de morfología, característicos de las células transformadas y se detectó la expresión de las proteínas adenovirales por inmunofluorescencia y Western blot.
Considerando que T. barrerae vive en ambientes salinos, se llevó a cabo un ensayo en cultivo primario para determinar si dichas células presentan mayor resistencia a concentraciones elevadas de sal en el medio. Efectivamente se observó una mayor resistencia en comparación con células control. Se discute la importancia ecofisiológica de la resistencia a la salinidad y las implicancias de una línea celular estable para investigaciones futuras.
Financiamiento: Fundación Andes y proyecto Fondecyt 1010727.

 

41. EVALUACIÓN HISTOPATOLÓGICA DEL EFECTO DE LA INFUSIÓN DE Leptocarpha rivularis EN PÁNCREAS DE RATAS DIABÉTICAS POR ALOXANO (Histopathologic Evaluation of the Effect of the Infusion of Leptocarpha rivularis in Pancreas of Alloxan Diabetic Rats. Álvarez, C1. León, G2. Martínez, R1. Cubillos, V3. López, I3.1Instituto de Química. 2Instituto de Bioquímica. Facultad de Ciencias. 3Instituto de Patología Animal. Facultad de Ciencias Veterinarias. Universidad Austral de Chile.
Patrocinio: Dr. Gloria León R.

Se estudió el efecto de la infusión con acción hipoglicemiante de Leptocarpha rivularis, sobre páncreas de ratas Sprague-Dawley macho adultas, diabéticas por inducción con aloxano, durante 10 semanas de tratamiento.
Para el análisis histológico y morfométrico de páncreas, se utilizaron muestras histológicas con tinción Eosina- Hematoxilina. También se realizó un ensayo inmunohistoquímico contra insulina con la técnica Streptavidina-Peroxidasa.
Los hallazgos microscópicos mostraron una disminución en el número y tamaño de los islotes en ratas diabéticas, además de degeneración fibrosa y depleción de células endocrinas, sin encontrarse hipertrofia de células ß.
En ratas diabéticas tratadas, los resultados de AIM muestran un aumento del contenido y la distribución de insulina en los islotes de Langerhans. Sin afectar el aspecto morfológico, tamaño de los islotes y distribución de insulina en animales sanos tratados utilizados como control. Sin embargo, no es posible solamente con estos resultados, establecer si la normalización de la glicemia, fue producto del aumento de insulina por acción directa de la infusión sobre células ß, o por una optimización del funcionamiento de células sanas remanentes.
Agradecimientos: Al proyecto DID-UACH S-2003-44.

 

42. MONITOREO CLÍNICO DE LA PAROTIDITIS CRÓNICA RECURRENTE INFANTIL (PCRI) A TRAVÉS DEL ANÁLISIS DE PARÁMETROS SALIVALES. (Clinical monitoring of chronic recurrent parotitis of childhood by the analysis of salivary parameters.) Montalbán R1., Landaeta M2., Pinochet Á1., Cóccola C1., Ortega A1., Urzúa B1., Morales I1. (1) Facultad de Odontología, U. de Chile. (2) Servicio Máxilofacial Infantil, Hospital San Juan de Dios.

PCRI es de etiología desconocida y tratamiento controversial. La biopsia glandular está contraindicada por su invasividad y la imagenología no siempre resulta consistente. No existen estudios que describan panorámicamente las alteraciones proteicas salivales asociadas a PCRI. En este trabajo preliminar, se realizó un barrido de la composición proteica de la saliva parotídea en distintos estadios de la enfermedad.
En 50 pacientes con PCRI, de ambos géneros de 4 a 14 años; y 30 voluntarios sanos pareados por género y edad, se recolectó saliva parotídea derecha e izquierda y se determinó: La concentración de proteínas (método de Bramhall); el modo de difusión de proteínas sobre membranas de celulosa y el perfil proteico (SDS-PAGE 10% tinción Coomassie Blue).
Los pacientes con PCRI presentan en relación al grupo control: un aumento de la concentración de proteínas, un modo de difusión de proteínas bifásico y una alteración del perfil proteico. La pérdida de la simetría de la saliva de la glándula derecha e izquierda constituye la alteración más frecuente, también es posible observar bandas polipeptídicas presentes muy escasamente en los controles.
Los resultados indican que es posible identificar, mediante técnicas relativamente simples, alteraciones salivales en casos de PCRI. El seguimiento de la calidad de la saliva a través del tiempo, permitiría correlacionar caracteres moleculares con aspectos clínicos; otorgando una herramienta inexistente hasta la fecha.

 

43. RELACIÓN DEL PROCESO APOPTÓTICO CON LA INFECCIÓN DEL PATÓGENO INTRACELULAR Piscirickettsia salmonis EN UNA LÍNEA CELULAR DE MACRÓFAGOS DE PECES. (Relation between the apoptotic process and the intracellular infection with the Piscirickettsia salmonis pathogen in a fish macrophage cell line). Rojas, M.V.1, Paredes, R.2, Galanti, N.2 y Marshall, S.H.1. (1)Laboratorio de Genética e Inmunología Molecular, Pontificia Universidad Católica de Valparaíso. (2) Programa de Biología Celular y Molecular, ICBM, Facultad de Medicina, Universidad de Chile.

Piscirickettsia salmonis es un patógeno intracelular obligado que produce la septicemia rickettsial de salmónidos (SRS), enfermedad que causa alta mortalidad en salmones de cultivo. No obstante el gran impacto económico que genera esta patología, se desconocen la mayor parte de los mecanismos de interacción entre esta bacteria y la célula hospedera.
Diversos patógenos intracelulares han desarrollado variadas estrategias para escapar del sistema inmune del hospedero y colonizar tejidos específicos del organismo afectado. La modulación de la muerte de la célula infectada puede ser un requisito necesario para establecer la relación patógeno-hospedero. Así, varios patógenos intracelulares inducen la apoptosis de macrófagos para impedir que desplieguen su potencial bactericida; otras especies inhiben este tipo de muerte en las células infectadas asegurando su permanencia en el hospedero. Se estudió la apoptosis como un posible mecanismo asociado a la modulación de la infección por P. salmonis en macrófagos en cultivo.
Aquí Macrófagos de la línea RTS11 de Trucha arcoiris se infectaron a diferentes tiempos con. P. salmonis La apoptosis se estudió mediante las técnicas de TUNEL, MET, Western blot e inmunocitoquímica con anticuerpos anti-caspasa 3. La detección de la bacteria se realizó con anticuerpos anti-P. salmonis.
Las técnicas de TUNEL y MET indican que la infección de macrófagos indujo la muerte celular apoptótica, proceso que sería gatillado por un sistema de caspasas, como ocurre en otros metazoos.
Nuestros resultados sugieren que P. salmonis podría evadir el sistema inmune de salmónidos modulando la población de macrófagos, favoreciendo así la patogénesis de la enfermedad.
Financiamiento: Proyectos DI 122780-P-UCV y Fondef D03I 1137.

 

44. Estudio comparativo de líquido cefalorraquídeo de pacientes con enfermedad de Creutzfeldt-Jakob y controles. (Comparative study of cerebrospinal fluid of Creutzfeldt-Jakob patients and controls). García1, L., Valenzuela1, M.A., Puente2, M Collados1 L, Cartier2, L., Kettlun1, A.M. 1Depto Bioquímica-Biología Molecular, Facultad Ciencias Químicas-Farmacéuticas, Universidad de Chile; 2Depto Ciencias Neurológicas, Facultad Medicina, Universidad de Chile.

Creutzfeldt-Jakob (CJ) es una alteración neurológica fatal caracterizada clínicamente por demencia e impedimentos cognitivo, neurológico y motor, e histopatológicamente por degeneración espongiforme del cerebro. Molecularmente se caracteriza por el cambio conformacional producido en la proteína prion normal PrPc (mayoritariamente α-helice) a la conformación infectiva PrPSc (principalmente sabana-β).
Como los síntomas clínicos pueden confundirse con otras patologías del SNC se propone buscar marcadores moleculares adicionales a la descrita proteína 14-3-3 en líquido cefalorraquídeo (LCR), muestra que mejor refleja lo que ocurre en el SNC, para optimizar el diagnóstico. Como en CJ hay destrucción de la matriz extracelular se buscó la presencia de MMP-9 por zimografía, encontrándose una alta frecuencia en pacientes y no visualizádose en controles, pero su cuantificación por "dot-blot" no mostró diferencia significativa con los controles. Como la neurodegeneración en CJ podría deberse en parte al estrés oxidativo y por el aumento de iNOS en enfermedades de prion, se cuantificaron en LCR metabolitos estables del NO (nitrito y nitrato) por electroforesis capilar, no encontrándose diferencias significativas.
De estas determinaciones solo se observaron cambios de MMP-9 por zimografía, pero no es un marcador propio de esta enfermedad, por lo que se continuará buscando otros marcadores adicionales para el diagnóstico.
Financiamiento: Proyecto DI MULT04/03-2.

 

45. ACTIVIDAD ANTITUMORAL DE UN AMILOIDE BACTERIANO (Anti-tumoral activity of a bacterial amyloid) Estrada1,3 L., Bieler1,2 S., Castilla1 J., Lagos3 R., and Soto1,3 C. (1Department of Neurology, University of Texas Medical Branch, Texas, USA, 2Department of Cell Biology, University of Geneva, Geneva, Switzerland, 3Departamento de Biología, Universidad de Chile, Santiago, Chile.)

La agregación de proteínas y la formación de fibras de amiloide es la característica principal de un grupo de enfermedades degenerativas que incluyen Alzheimer, Parkinson, Huntington, diabetes y encefalopatías espongiformes entre otras. Microcina E492 (Mcc) es un péptido antibiótico producido por Klebsiella pneumoniae, el cual destruye bacterias formando poros en la membrana interna de la célula blanco. Nuestros estudios han demostrado que Mcc es capaz de formar amiloide tanto in vitro como in vivo, el cual presenta características idénticas al amiloide asociado a las enfermedades degenerativas. Además, la formación de fibras juega un rol importante modulando la actividad biológica de esta proteína. Interesantemente, Mcc también puede inducir muerte celular en células eucariotas. Nuestro trabajo indica que Mcc induce apoptosis en diversas líneas tumorales, sin afectar cultivos primarios. Más aun, estudios in vivo usando modelos animales de melanoma, revelan una significativa reducción del tamaño tumoral en animales tratados con Mcc, sin efectos secundarios aparentes. Nuestros datos sugieren que la agregación de Mcc en fibras de amiloide es responsable de su toxicidad en células tumorales. La evidencia experimental indica que las fibras de amiloide asociadas a enfermedades degenerativas inducen toxicidad en forma específica para ciertos tipos celulares. La posibilidad de que la toxicidad de la microcina agregada sea restringida para células tumorales es prometedora y podría resultar en una nueva terapia contra el cáncer y revolucionar el concepto inherentemente negativo asociado hasta ahora al amiloide.

 

46. Estudios sobre el grado de fosforilación de la proteína Tau presente en líquido cefalorraquídeo de pacientes con paraparesia espástica tropical. (Studies on phosphorylation state of Tau protein in cerebrospinal fluid of patients with Tropical Spastic Paraparesis). Ortiz-Riaño1 E, Krause1, B., Valenzuela1, M.A. 1Depto Bioquímica-Biología Molecular. Facultad Cinecias Químicas-Farmacéuticas, Universidad de Chile.

La mielopatía asociada al virus linfotrópico humano tipo I (HTLV-I) o paraparesia espástica tropical (HAM/TSP) es una enfermedad progresiva y crónica del SNC central que afecta la médula espinal. Histopatológicamente se observa una pérdida axonal y desmielinización del haz córtico-espinal. La degeneración axonal observada se ha atribuido a un deficiente transporte axonal mediada tal vez por modificaciones de proteínas del citoesqueleto como la proteína Tau. Esta proteína se puede encontrar fosforilada principalmente en serina y treonina, lo que cambia el control de su actividad organizadora de microtúbulos.
Para su estudio, la proteína Tau fue detectada inicialmente en el líquido cefalorraquídeo (LCR) mediante "westernblot", la banda inmunoreactiva contra anti-Tau también fue reconocida por anticuerpos anti-fosfoserina y anti-fosfotreonina. Para confirmar que esta colocalización corresponde a Tau fosforilada se inmunoprecipitó desde el LCR con anticuerpos monoclonales (clon tau-5) y al analizarlo por "westernblot" utilizando anticuerpos contra los residuos fosforilados dio reacción positiva, indicando así que efectivamente Tau se encuentra fosforilado. Este antecedente justifica analizar la existencia de diferencias en estas modificaciones entre pacientes con HAM/TSP y controles junto con la identificación inmunológica de algunos residuos específicos fosforilados.
Financiamiento: Proyecto FONDECYT 105-0784.

 

47. CARACTERIZACIÓN PARCIAL DE PROTEASAS EPIDIDIMARIAS DE EQUINOS (Partial characterization of equine epididymal proteases) Curty, N; Ferreira, A; López, ML; Retamal, CA
Universidade Estadual do Norte Fluminense, Campos-RJ. Brasil (Apoyo: FAPERJ,CNPq,TECNORTE)

El proceso de maduración espermática incluye expresivas modificaciones en dominios específicos de sus membranas. Glicosidasas, glicosiltransferasas y proteases desempeñan un rol clave en este proceso. En este trabajo: demostraremos actividad gelatinolítica en las diferentes regiones epididimarias; determinaremos la masa molecular relativa de estas proteasas, utilizando una metodología que permite calcularla independientemente del efecto anómalo de migración que provoca la gelatina; purificaremos estas enzimas, señalando sus principales substratos intrínsicos. Se determinó actividad proteolítica en SDS-PAGE12%/gelatina 0,4% con/sin β-mercaptoetanol de fluido obtenido de conducto eferente, cabeza, cuerpo y cola epididimaria. Las masas moleculares relativas fueron determinadas en geles bidimensionales (SDS-PAGE 12% primera dimensión/SDS-PAGE 12% en presencia de gelatina con/sin β-mercaptoetanol, segunda dimensión). Nuestros resultados preliminares demuestran 3-7 manchas con actividad proteolítica, con expresión diferencial en las diversas regiones epididimarias. En la región proximal se detectan proteasas de ~200 y 90 kDa y de 105, 68, 60, 52, 44, 31 kDa en la región distal. En epidídimo predomina una banda de 68 kDa que no se observa en conducto eferente. En la región de cola aparece actividad en proteínas de 68, 52, 44, 31 kDa. En muestras con β-mercaptoetanol se visualizan bandas no observadas sin este reductor. Se purificaron algunas proteasas (cola epididimaria) e incubaron con fluido epididimario, detectándose sus substratos intrínsecos (105, 51, 39 kDa) y subproductos (35kDa).

 

48. IDENTIFICACIÓN DE UN SITIO ALOSTÉRICO EXOFACIAL EN EL TRANSPORTADOR DE HEXOSAS GLUT1 (Identification of an allosteric exofacial site on the hexose transporter GLUT1). Raddatz N., Valenzuela X., Pérez A., Bulnes P. y. Reyes A. M. Instituto de Bioquímica, Facultad de Ciencias, Universidad Austral de Chile, Casilla 567, Valdivia, Chile (areyes@uach.cl).

El transporte de hexosas en células animales es facilitado por proteínas integrales de membrana conocidas como GLUTs, de las cuales el transportador GLUT1 es el más estudiado. Algunos compuestos naturales de la familia de las flavonas, como genisteína, miricetina y quercetina, bloquean el transporte de hexosas mediado por GLUT1. Para identificar el sitio de unión de las flavonas responsable de la modulación de la actividad del transportador, ensayamos transporte bajo diversas condiciones en eritrocitos humanos intactos para probar que el sitio de unión es accesible solo desde la cara exofacial de la proteína. Nosotros mutamos diversos residuos en un segmento del transportador que es accesible desde el medio extracelular y que muestra homología con sitios de unión de nucleótidos en otras proteínas. Dos mutantes G116A y K117Q muestran una afinidad disminuida o ausente frente a quercetina en ensayos trans-cero de entrada o en condiciones de intercambio en equilibrio en ovocitos de Xenopus, mientras la mutante G111A no muestra diferencias con la proteína natural expresada en el mismo sistema. Las mutantes no exhiben diferencias significativas en cuanto a afinidad por el sustrato, niveles de expresión o sensibilidad frente a otros inhibidores que se unen al transportador por su superficie endofacial. En un modelo por homología de GLUT1, ambos residuos residen en un bolsillo adyacente al putativo sitio de unión exofacial de D-glucosa en el transportador. Nuestros resultados proveen pruebas convincentes para la presencia de un sitio alostérico exofacial en el transportador GLUT1 (Financiado por proyecto FONDECYT 1020908).

NEUROBIOLOGÍA

49. EL STRESS CRÓNICO DISMINUYE MÁS EL CONDICIONAMIENTO AUDITIVO QUE EL VISUAL EN RATAS: EVIDENCIAS MORFOLÓGICAS Y CONDUCTUALES (Chronic stress impairs acoustic conditioning more than visual conditioning in rats: morphological and behavioral evidence). Zepeda, R.1, Dagnino-Subiabre, A.1, Terreros, G.1,Carmona-Fontaine C.1, Orellana, J.1, Díaz-Véliz,G.2, Mora, S.2 y Aboitiz, F1. 1Departamento de Psiquiatría, Facultad de Medicina, Pontificia Universidad Católica de Chile. 2ICBM, Universidad de Chile. Patrocinio: Dr. Francisco Aboitiz.

El stress afecta a áreas del cerebro involucradas en el aprendizaje y en la regulación de las respuestas emocionales, favoreciendo el desarrollo de los síntomas depresivos en humanos. En este estudio se analizó el efecto del stress crónico sobre la morfología de las neuronas del colículo inferior (mesencéfalo auditivo) y del colículo superior (mesencéfalo visual) de rata utilizando la tinción de Golgi. Además, correlacionamos nuestro estudio morfométrico con estudios conductuales analizando el efecto del stress sobre el condicioniento auditivo y visual. El stress indujo atrofia dendrítica en el colículo inferior y no afectó la morfología del colículo superior. Este resultado se correlacionó con un mayor deterioro del condicionamiento auditivo respecto al visual en las ratas estresadas. Quince días después del stress las neuronas del colículo inferior de las ratas estresadas mostraron un alto nivel de plasticidad neuronal, recuperando su morfología y condicionamiento auditivo normal. Estos resultados sugieren que el stress afecta más al sistema auditivo que al visual. Nuestro estudio entrega una nueva aproximación para entender la fisiopatología del stress y enfermedades relacionadas como la depresión y el stress post-traumático.
Financiamiento: Núcleo Milenio Neurociencias Integradas.

 

50. EL STRESS CRÓNICO AFECTA LA CORTEZA AUDITIVA MÁS QUE LA VISUAL EN RATAS: EVIDENCIA MORFOLÓGICA (Chronic Stress Affects the Auditory Cortex More than the Visual Cortex in Rat: Morphological Evidence) Terreros, G.1, Dagnino-Subiabre, A.1, Zepeda, R.1, Díaz-Véliz, G.2, Mora, S.2 y Aboitiz, F.1 1Departamento de Psiquiatría, Facultad de Medicina, Pontificia Universidad Católica de Chile. 2ICBM, Universidad de Chile. Patrocinio: Dr. Francisco Aboitiz.

Previamente demostramos que el stress produce atrofia dendrítica en el colículo inferior de rata, área clave en el procesamiento auditivo. Esta alteración morfológica se correlaciona con el deterioro del condicionamiento auditivo en animales estresados. En este trabajo estudiamos el efecto del stress crónico en la corteza auditiva y visual de rata. En preparaciones de Golgi, analizamos el efecto del stress sobre la morfología de las neuronas piramidales de las cortezas auditiva primaria, visual primaria y temporal. El stress produjo una disminución significativa en la longitud y ramificaciones de neuronas piramidales de las capas II-III (24% y 16%, p < 0.05) y V-VI (49% y 46%, p < 0.001) de la corteza auditiva primaria, y de las capas V-VI de la corteza temporal (28% y 30%, respectivamente; p < 0.01), sin alterar la morfología de las neuronas de la corteza visual primaria. Estos resultados sugieren que la plasticidad inducida por el stress en la amígdala basolateral descrita previamente, podría amplificarse a nivel cortical afectando el procesamiento auditivo cortico-cortical y cortico-amigdalar, lo cual sería importante en el desarrollo de las alteraciones cognitivas en animales estresados.
Financiamiento: Núcleo Milenio Neurociencias Integradas.

51. DETECCIÓN DE UNA MUTACIÓN POCO FRECUENTE DE TPH2 EN POBLACIÓN CHILENA. (Finding of an infrequent TPH 2 mutation in a Chilean population). Galleguillos F., Bustamante M.L., Iturra P., Solari A., Villarroel J., Jerez S., Silva H.
Programas de Biología Celular y Molecular y de Genética Humana. Instituto de Ciencias Biomédicas-Facultad de Medicina. Unidad de Trastornos de la Personalidad (UTP), Clínica Psiquiátrica Universitaria.
Universidad de Chile.
Proyectos Fondecyt 1030305 y Mecesup 1004.

El neurotransmisor Serotonina ha sido vinculado al origen de diversas patologías psiquiátricas. Es sintetizada en una reacción catalizada por la enzima Triptofano hidroxilasa (TPH), de la cual existen dos subtipos. El subtipo 1 se expresa en tejidos periféricos, mientras que el subtipo 2 se expresa en sistema nervioso central, por lo que puede tener relevancia en la producción de trastornos mentales. El gen de TPH 2 presenta dos variantes alélicas funcionalmente diferentes. En una población de pacientes depresivos, su distribución es diferente a la de la población normal, existiendo en la primera mayor frecuencia del alelo A. Este hallazgo no ha sido replicado en otras poblaciones, lo que se explicaría por la baja frecuencia de este alelo. En este estudio, se efectuó la genotipificación, por medio de AMRS PCR, de una población de pacientes portadores de Trastorno de Personalidad con Impulsividad(n=55) y de una muestra de la población general (n=60). Ningún paciente presenta la variante A, mientras que un individuo de la población general es heterocigoto para esta variante, hallazgo que fue confirmado por medio de secuenciación.
Agradecemos a todos los miembros de la UTP.

 

52. Aislamiento y análisis del grado de fosforilación de los neurofilamentos de líquido cefalorraquídeo de pacientes con paraparesia espástica tropical. (Isolation and analysis of the phosphorylation state of neurofilaments in cerebrospinal fluid of pacients with Tropical Spastic Paraparesis). Alberti1, C., Valenzuela1, M.A. 1Depto Bioquímica y Biología Molecular, Facultad Ciencias Químicas-Farmacéuticas, Universidad de Chile, 2Depto Ciencias Neurológicas, Facultad Medicina, Universidad de Chile.

La infección por el retrovirus linfotrópico humano tipo I (HTLV-I) puede provocar paraparesia espástica tropical (TSP/HAM). Esta enfermedad desmielinizante se caracteriza por degeneración axonal originando espasticidad progresiva de los miembros inferiores llegando a ser incapacitante.
La degeneración axonal plantea la posibilidad de visualizar si en el líquido cefalorraquídeo (LCR) de pacientes con TSP/HAM hay modificaciones en el grado de fosforilación de las proteínas de los neurofilamentos liviano (NF-L), mediano (NF-M) y pesado (NF-H). Para este propósito, a partir de LCR de pacientes y controles se inmunoprecipitaron los distintos neurofilamentos con anticuerpos policlonales, los que fueron analizados mediante westernblot y tinción de geles con plata.
Los resultados preliminares, por westernblot, empleando anticuerpos contra cualquiera de los 3 neurofilamentos muestran la inmunoprecipitación de NF-L inmunorreactivo contra antifosfo-serina y antifosfo-treonina. La utilización de anticuerpos policlonales contra NF-M y NF-H ha mostrado ser infructuosa para inmunoprecipitar selectivamente estas proteínas, debido tal vez a que se encuentran en razones molares menores que NF-L. Además podría haber una aparente inmunorreactividad cruzada de los anticuerpos debido a la presencia de epítopes comunes en dichas proteínas.
Financiamiento: Proyecto FONDECYT Nº 105-0784

 

53. FACTORES LIBERADOS POR ASTROCITOS INDUCEN UN MODO RÁPIDO DE EXOCITOSIS EN NEURITAS DE CÉLULAS CROMAFINES BOVINAS (Astrocyte-released factors elicit a rapid exocytosis mode in neurites of bovine chromaffin cells) Toro R.1, Ardiles A.1,2, Maripillán J.1,2, Mora I.1,2, Lagos V.1, Villarroel L.3, Cárdenas AM.1 (Neely A.). 1Centro de Neurociencia de Valparaíso, Universidad de Valparaíso. 2Instituto de Química, Pontificia Universidad Católica de Valparaíso. 3Departamento de Biología, Facultad de Ciencias, Universidad de Valparaíso. Fondecyt 1020812.

Hemos utilizado medio condicionado de astrocitos (MCA) para promover un fenotipo neuronal en células cromafines bovinas y estudiar modificaciones en la exocitosis de catecolaminas. En terminales neuríticos observamos una distribución preferencial de vesículas secretoras y señales de calcio inducidas por despolarización. De manera interesante, encontramos la presencia tanto de vesículas grandes de núcleo denso (VGND) como de vesículas claras pequeñas. Usando amperometría observamos una aceleración de la cinética de los eventos exocíticos en terminales neuríticos. Experimentos realizados en células cargadas con EGTA, sugirieron que la distancia entre vesículas secretoras y canales de calcio no dan cuenta de los cambios en la cinética de exocitosis. El análisis de Q1/3, un parámetro que se relaciona con el diámetro de la vesícula, indica que los eventos exocíticos rápidos observados corresponden a exocitosis de VGND. Adicionalmente, la menor duración y amplitud de la corriente de pre-espiga sugieren que el MCA cambia la estabilidad y la conductancia del poro de fusión. Estos hallazgos demuestran que los factores liberados por astrocitos inducen un fenotipo neuronal en células cromafines, y aceleran la exocitosis de VGND.

54. EFECTO DE LA ENDOTELINA-1 SOBRE LA ACTIVIDAD QUIMIOSENSORIAL DEL CUERPO CAROTÍDEO Y DEL GANGLIO PETROSO. (Endothelin-1 effect on carotid body and petrosal ganglion chemosensory activity). Del Rio, R., Rey, S., Moya, E., Alcayaga, J., Iturriaga, R. Laboratorio Neurobiología, P. Universidad Católica de Chile.

La hipoxia libera neurotransmisores desde las células quimiorreceptoras (glómicas) del cuerpo carotídeo (CC), aumentando la descarga de impulsos aferentes generada en los terminales de neuronas del ganglio petroso (GP). El CC posee un alto flujo sanguíneo, a través de vasos de resistencia y capilares. Así, moléculas vasoactivas como endotelina-1 podrían modificar el flujo sanguíneo y modular la actividad quimiosensorial en el CC, pero también podrían actuar a nivel de las neuronas del GP. En CCs y GPs extraídos de gatos anestesiados con pentobarbitona (40 mg/kg ip), estudiamos inmunohistoquímicamente la expresión de endotelina-1 (ET-IR) y los efectos de la aplicación de endotelina-1 in vitro sobre la descarga neural en preparaciones del CC aisladas o no vascularmente, y en una preparación de GP. Encontramos presencia de ET-IR en zonas interlobulares en el CC y en somas y axones del GP. Endotelina-1 (0.01-1 mg) aplicada intravascularmente produjo una potente excitación quimiosensorial en el CC. Sin embargo, en el CC superfundido la endotelina-1 no aumentó la descarga. En el GP, endotelina-1 no aumentó la descarga y no modificó las respuestas a acetilcolina. Nuestros resultados sugieren que endotelina-1 modula la quimiorrecepción carotídea predominantemente por una vasoconstricción que reduce el flujo sanguíneo y el aporte de O2 al CC.
Financiamiento: FONDECYT 1030330.

 

55. PROPIEDADES ELÉCTRICAS DE NEURONAS DE GANGLIOS PETROSOS Y NODOSOS DE CONEJO (Electrical properties of rabbit nodose and petrosal ganglion neurons) Ortiz, F.C., Alcayaga, J. Lab. Fisiología Celular, Fac. Ciencias, Universidad de Chile.

Los ganglios nodoso (GN) y petroso (GP) contienen neuronas quimio-, baro-, y de otras modalidades sensoriales. Se ha postulado que las propiedades eléctricas de estas neuronas reflejan su modalidad sensorial. Por esto, estudiamos dichas propiedades en ambos ganglios.
Se extrajeron GNs y GPs de 6 conejos machos (1,27±0,13 Kg), anestesiados con ketamina/xilazina (75/7,5 mg/Kg), y se colocaron en solución de Hanks, tamponada con HEPES 5mM (pH 7,43, 22°C). Se registró intracelularmente con microelectrodos de vidrio llenos con KCl 3M (25<R<60 M©). Se midió el potencial de membrana, la amplitud y duración del potencial de acción (PA) y de la hiperpolarización, la resistencia y capacidad de entrada.
Por el curso temporal del PA las neuronas se clasificaron en "jorobadas", con una inflexión en la fase de repolarización, y "no-jorobadas", carentes de esta inflexión. El 81,2% de las neuronas nodosas resultaron "jorobadas" (nGNJ) y un 18,8% "no-jorobadas" (nGNnJ), mientras que un 26,7% y un 73,3% de las neuronas petrosas fueron "jorobadas" (nGPJ) y "no-jorobadas" (nGPnJ), respectivamente. La duración de los PAs fue: nGNJ > nGPJ > nGNnJ > nGPnJ. nGNJs presentaron hiperpolarizaciones de mayor duración que los otros grupos. Las demás variables no difirieron significativamente (ANOVA, P > 0,05).
Nuestros resultados sugieren que las propiedades eléctricas de la población neuronal ganglionar reflejarían sus distintas modalidades sensoriales.
Financiamiento: FONDECYT 1040638.

56. Efecto modulatorio de la dopamina en neuronas petrosas del gato (Modulatory effect of dopamine in cat petrosal ganglion neurons). Elgueta, C.A, Alcayaga, J. Lab. Fisiología Celular, Fac. Ciencias, Universidad de Chile.

La sinapsis entre los terminales de las neuronas del ganglio petroso (GP) y las células receptoras (glómicas) del cuerpo carotídeo (CC) es fundamental en la función de este órgano quimioreceptor. En la preparación de GP de gato in vitro, la dopamina modula, por un mecanismo desconocido, la acción excitatoria de acetilcolina. Por esta razón, estudiamos los efectos celulares de dopamina en neuronas aisladas del GP.
Los GPs se extrajeron bilateralmente de 5 gatos (3.3±0.5 Kg), anestesiados con pentobarbitona (60mg/Kg), se disociaron enzimáticamente y se cultivaron por 3-10 días. Se registraron, utilizando la técnica de "patch-clamp" en modalidad de célula completa, las corrientes inducidas por acetilcolina 1 mM y su modulación por distintas dosis de dopamina aplicadas previamente (30s).
Por su respuesta a dopamina se identificaron tres poblaciones neuronales. En una población la dopamina regula la amplitud de las corrientes de entrada inducidas por acetilcolina con una dosis dependencia bifásica, similar a la descrita en la preparación de ganglio completo. En un segundo grupo, dopamina, además del papel modulatorio ya descrito, genera corrientes de entrada (ED50 ª 54 µM) que presentan desensibilización a dosis altas de dopamina. El resto de las neuronas fue insensible a dopamina.
Estos resultados muestran que dopamina tendría un efecto excitatorio además de modular la respuesta a acetilcolina en neuronas petrosas en cultivo.
Financiamiento: FONDECYT 1040638.

 

57. LA HIPOTIROXINEMIA MATERNA PROVOCA DAÑO NEURONAL A SU PROGENIE. Gianini A1., Pancetti F2, Garikoitz Azcona3, Opazo C1, Mora S4, Riedel C1. Universidad Andrés Bello1. Universidad Católica del Norte2. Universidad del País Vasco, España3. Universidad de Chile4.

La hipotiroxinemia materna es una de las causas más frecuentes de daño neuronal en el hombre, evidenciado en la progenie como déficit atencional hasta retardo mental. Los mecanismos biológicos que subyacen a este daño se desconocen. Proponemos que la hipotiroxinemia materna deteriorará la capacidad cognitiva mediante la alteración de las sinapsis glutamatérgica en el hipocampo y su regulación por la neurotrofina BDNF (Brain Derived Neurotrophic Factor). A ratas preñadas se les indujo hipotiroxinemia mediante la administración de metimazol en el agua de beber durante los días E12-E15. A los dos meses de edad la progenie fue evaluada. En los tests de aprendizaje y memoria se observó deterioro de la memoria espacial; en registros de hipocampo daño en el establecimiento de la LTP (long term potentiation); en inmunohistoquímica tinción positiva para el receptor de BDNF, TrkB en neuronas con migración aberrante de la zona del CA3 del hipocampo. Nuestros resultados indican que la hipotiroxinemia materna en las ratas induce daño cognitivo a su progenie y que esto fisiológicamente se observa por la ausencia de LTP y estructuralmente por cambios en el contenido y distribución de BDNF y TrkB en el hipocampo. Estos resultados contribuyen con evidencias que apoyan la noción de la importancia de la T4 materna para el desarrollo del SNC de su progenie.
FONDECYT 1040349.

 

58. EFECTO DE LA ACTIVACIÓN FARMACOLÓGICA DE LOS ADRENORRECEPTORES BETA-2 EN EL APRENDIZAJE VISUO-ESPACIAL DE RATAS MALNUTRIDAS IN UTERO: POSIBLE RELACIÓN DOSIS-EFECTO (Effect of pharmacological activation of beta-2 adrenoceptors on the visuo-spatial learning of in-utero malnourished rats: possible dose-effect relationship) Castillo, A.1, Oviedo N.1, Ortiz I.1, Fernández, V.2, Hernández, A.3, Burgos, H.1 1Escuela de Psicología, Universidad Santo Tomás, 2ICBM, Facultad Medicina, Universidad de Chile, 3Facultad de Química y Biología, USACH.

Existen evidencias que la estimulación de adrenoreceptores beta en el cerebro, en particular el subtipo beta-2, mejora la consolidación de la memoria en pollos. El presente estudio aborda la influencia de la activación de adrenoreceptores beta-2 mediante el agonista selectivo clenbuterol, en un modelo de ratas con malnutrición prenatal, y su efecto en el aprendizaje visuo-espacial medido en el laberinto radial octogonal de Olton. Se utilizaron ratas Sprague-Dawley nacidas de madres alimentadas con una dieta hipoproteica, pero isocalórica durante la gestación. Estas crías nacen aparentemente normales, sin embargo se han descrito cambios significativos en los sistemas noradrenérgicos y serotoninérgicos en la corteza cerebral e hipocampo, alteraciones que podrían implicar deterioros en la memoria y aprendizaje, entre otros desórdenes psicomotores. Los resultados indican que la activación farmacológica de los receptores beta-2 mediante clenbuterol (0.019, 0.038 y 0.075 mg/kg i.p.) en ratas malnutridas mejora el aprendizaje en forma dosis-dependiente, mientras que en ratas eutróficas se observó un deterioro del desempeño visuo-espacial. Se discuten posibles explicaciones relacionadas con mecanismos de autorregulación a nivel cortical e hipocampal.
PROYECTOS: FONDECYT 1030729; INV-03-04(UST)

 

59. CONCENTRACIÓN DE LA HORMONA LIBERADORA DE CORTICOTROPINA (CRH) EN HIPOTÁLAMO DE RATAS QUE EXPERIMENTARON MALNUTRICIÓN PRENATAL (Corticotrophin Releasing Hormone (crh) Concentration in the Hypothalamii of Rats that Underwent Prenatal Malnutrition) Núñez, H.1, Gotteland, M.1, Ruiz, S.2, Pérez, H1. 1 INTA, Universidad de Chile,2 Facultad de Ciencias de la Salud, Universidad Diego Portales.

Un estudio reciente de desnutrición prenatal en rata mediante restricción dietaria materna, señala que la expresión hipotalámica para RNAm de CRH está aumentada respecto de animales eutróficos. CRH es sintetizado por células del núcleo paraventricular hipotalámico (NPH), células que conectan con diversos núcleos del tronco cerebral. Interesantemente los RNA mensajeros para CRH también están aumentados en núcleos hipotalámicos tanto de ratas espontáneamente hipertensas como en humanos con hipertensión primaria. El objetivo de este trabajo es estudiar en ratas eutróficas y malnutridas de 2 y 40 días de edad los efectos que la malnutrición prenatal genera en la actividad del eje HHA en la vida postnatal, a través de la cuantificación de CRH hipotalámico mediante radioinmunoensayo. Esta malnutrición se indujo en ratas Wistar, sometiendo a las madres, desde el inicio de su preñez hasta el nacimiento de las crías, a una dieta del 40% del consumo ad-libitum respecto del grupo control. Los resultados muestran que la malnutrición fetal induce a los 2 y 40 días de vida postnatal aumento de la concentración de CRH, con respecto a los animales eutróficos. Por lo tanto, el grupo malnutrido prenatalmente evidencia una hiperactividad del eje HHA en la vida postnatal.
FONDECYT 1030626

60. EFECTO DE LA ESTIMULACIÓN DE ADRENORRECEPTORES b2 EN LA POTENCIACIÓN DE LARGO PLAZO NEOCORTICAL: ESTUDIO ELECTROFISIOLÓGICO IN VIVO EN RATAS EUTRÓFICAS Y CON MALNUTRICIÓN PRENATAL (Effect of b2 adrenoceptor stimulation on neocortical long-term potentiation: In vivo electrophysiological study in eutrophic and prenatally malnourished rats). Serrano, N.1, Hernández, A.2, Pérez, H.1, Valladares, L.1, Sierralta, W.1 1INTA, Universidad de Chile, 2Fac. Quim. Biol., USACH.

Noradrenalina central puede influenciar críticamente la memoria y el aprendizaje, así como la potenciación de largo plazo cortical (LTP). Dado que la malnutrición proteica suave durante la gestación induce sub-expresión del adrenoreceptor b2 en la neocorteza de la progenie, en el presente estudio se investigó en ratas eutróficas y malnutridas durante la gestación el efecto de la administración del agonista selectivo b2 clenbuterol (0.019, 0.038, 0.075 y 0.15 mg/kg i.p.) en la potenciación sináptica cortical inducida in vivo mediante shocks tetanizantes. Los resultados muestran que: (i) en los animales eutróficos, la administración de clembuterol fue capaz de aumentar la LTP neocortical; (ii) en los animales malnutridos, clenbuterol restauró la capacidad de las neuronas corticales para inducir y mantener LTP; y (iii) en ambos grupos de animales el efecto de clenbuterol fue dosis-dependiente (DE50 eutróficos = 0.035 mg/kg i.p.; DE50 malnutridos = 0.032 mg/kg i.p.). Se sugiere que los déficits de LTP que presentan durante la vida adulta las ratas sometidas a malnutrición proteica prenatal pueden estar relacionados con la sub-expresión de adrenoreceptores b2 que acompaña a esta forma de malnutrición.
FONDECYT 1030729.

 

61. ACCIÓN DE DEXAMETASONA EN LOS NIVELES PLASMÁTICOS DE CORTICOSTERONA EN RATAS QUE EXPERIMENTARON MALNUTRICIÓN PRENATAL (Effect of dexamethasone in corticosterone levels of rats that underwent prenatal malnutrition) Navarrete, M.1, White, A.2, Pérez, H1. 1 INTA, Universidad de Chile, 2 ICBM, Facultad de Medicina.

La malnutrición fetal reduce el número de receptores para glucocorticoides en hipotálamo de ratas. Dado que los receptores de glucocorticoides inhiben la actividad neuronal, su disminución podría determinar un incremento en la actividad del eje hipotálamo-hipófisis-adrenal (HHA). Previamente se ha demostrado que la malnutrición prenatal induce un aumento de la corticosterona plasmática en la vida postnatal, programando cambios a largo plazo en la actividad del eje HHA. En consecuencia, se estudió la susceptibilidad del eje frente a dexametasona en ratas malnutridas prenatalmente. Esta malnutrición se indujo en ratas Wistar, sometiendo a las madres, desde el inicio de su preñez hasta el nacimiento de las crías, a una dieta del 40% del consumo ad-libitum respecto del grupo control. A los 39 días de edad las crías malnutridas y controles, recibieron una dósis subcutánea de 100 mg/kg de dexametasona, determinándose la corticosterona plasmática 24 horas post dexametasona mediante radioinmunoensayo. Los resultados muestran que las ratas malnutridas son significativamente menos sensibles a dexametasona en su acción reductora de los niveles plasmáticos de corticosterona. Como consecuencia el eje HHA debería permanecer hiperactivo por la disminución de la retroalimentación negativa ejercida por los glucocorticoides endógenos.
FONDECYT 1030626

62. VITAMINA C, CELULAS MICROGLIALES Y SU ROL EN EL EFECTO BYSTANDER EN GLIOMA. (Vitamin C, microglial cells and the Bystander effect in glioma). Rodríguez, F., Sánchez, A., Nualart, F. Laboratorio de Neurobiología, Departamento de Biología Celular, Facultad de Ciencias Biológicas, Universidad de Concepción.

La vitamina C es un antioxidante esencial para el sistema nervioso central. Se han clonado dos isoformas de los co-transportadores de ácido ascórbico y sodio, solo SVCT2 se expresa en cerebro. La forma oxidada de la vitamina C es transportada por GLUTs. Se desconoce la capacidad de los gliomas para captar vitamina C. Los gliomas son tumores infiltrados por microglía, que resisten las terapias anti-tumorales. Proponemos que la microglía, por un "Efecto Bystander" oxidaría el ácido-ascórbico por la actividad de la NADPH-oxidasa, cargando los gliomas con ácido deshidroascórbico (DHA) a través de GLUT1. Este efecto sería potenciado debido a que la microglía expresaría GLUT5, transportador que no incorpora vitamina C oxidada. Analizamos la expresión de GLUTs, SVCT2 y p47phox por RT-PCR y determinamos su localización mediante estudios de microscopía confocal en cultivos primarios de microglía de rata y glioma humano. Confirmamos que la microglia expresa GLUT5 y la enzima NADPH oxidasa. Además, observamos la expresión in vitro del ARNm para GLUT1, GLUT3 y SVCT2. Análisis en los tejidos de glioma humano indican solamente la expresión de GLUT5 en la microglía, lo cual sugiere que estas células inducen in vitro la presencia de otros transportadores de glucosa. La presencia de un transportador de fructosa en microglía que no transporta DHA, potenciaría el Efecto Bystander en gliomas.
Proy. FONDECYT 1050095.

 

63. RECICLAJE DE VITAMINA C ENTRE CÉLULAS NEURONALES Y ASTROCITOS (Recycling of vitamin C between neuron cells and astrocytes) Cisternas P, Teresa Caprile y Francisco Nualart. Laboratorio de Neurobiología, Departamento de Biología Celular, Facultad de Ciencias Biológicas, Universidad de Concepción, Chile.

El cerebro es uno de los órganos que mayor cantidad de radicales libres genera. Dichos radicales son eliminados gracias a la presencia de antioxidantes, entre los cuales se encuentra la vitamina C. Esta vitamina funciona como antioxidante gracias a su capacidad para pasar de ácido ascórbico (AA, forma reducida) a ácido deshidroascórbico (DHA, forma oxidada) mediante la captación de dos radicales libres. El DHA que se genera es inestable y debe ser reducido nuevamente para evitar su hidrólisis. Nuestros estudios muestran que las neuronas y los astrocitos presentan características moleculares para realizar el reciclamiento de vitamina C en el cerebro. En primer lugar, de determinó que el AA captado por la neurona a través de SVCT2 se oxida intracelularmente produciendo DHA. El DHA generado intracelularmente es liberado por la neurona a través de un mecanismo parcialmente inhibible por floretina. El astrocito es capaz de captar DHA (pero no AA), mediante GLUT1, el cual se reduce intracelularmente generando AA. Esta forma de la vitamina C es liberada a través de un mecanismo no inhibible por citocalasina B o floretina, pero sí parcialmente inhibible por quercetina y DIDS. Los resultados funcionales obtenidos en este trabajo apoyan la hipótesis de reciclamiento de vitamina C en el cerebro.
Financiado por FONDECYT 3020007 y 1050095.

64. EFECTOS CONDUCTUALES DEL EXTRACTO HIDROALCOHÓLICO DE Annona muricata EN RATAS (Behavioral effects of Annona muricata hydroalcoholic extract in rats). 1Mora, S., 2Azkona, G., 3García-González, M., 1Díaz-Véliz, G. 1Programa Farmacología Molecular y Clínica (ICBM), Facultad de Medicina, Universidad de Chile. 2Departamento Neurociencias, Facultad de Medicina y Odontología, Universidad del País Vasco, España. 3Facultad de Medicina, Universidad de Costa Rica.

Annona muricata (Annonaceae) es un árbol frutal originario de zonas tropicales de Centro América y el Caribe. Sus partes se utilizan en medicina popular con diversos fines, entre ellos como tranquilizante y antidepresivo. El presente trabajo tiene por objeto validar estos efectos en modelos animales.
Se utilizaron ratas Sprague Dawley machos, que fueron tratados ip con el extracto de A. muricata (12,5; 25 y 50 mg/kg) o salina. Como controles positivos se utilizaron diazepam (1mg/kg), fluoxetina (10mg/kg) e imipramina (12,5mg/kg). Se estudiaron los efectos sobre la actividad motora espontánea, laberinto en cruz elevado (LCE) y natación forzada (NF).
Solo la dosis de 50 mg/kg produjo una disminución significativa de la actividad motora sin alterar la exploración del LCE. Todas las dosis disminuyeron la inmovilidad en NF, aumentando significativamente la conducta de natación. Se concluye que esta planta poseería moderados efectos sedantes y un marcado efecto antidepresivo similar al de los inhibidores de la recaptación de serotonina.
Proyecto X.8, Subprograma X, Programa Iberoamericano de Ciencia y Tecnología para el Desarrollo (CYTED).

 

BOTÁNICA-FISIOLOGÍA
Y BIOTECNOLOGÍA VEGETAL

65. EFECTO DEL COBRE SOBRE LA EFICIENCIA FOTOSINTÉTICA EN UNA GRAMINEA SILVESTRE PROVENIENTE DE UN SITIO CONTAMINADO (Copper effect on photosynthetic efficiency in a wild gramineae growing in a polluted site) Parada, N., Ortiz, C., Departamento de Biología, Facultad de Química y Biología, Universidad de Santiago de Chile cortiz@lauca.usach.cl

El cobre es esencial en plantas, aunque altas concentraciones generan especies reactivas de oxigeno (EROs), lo que provoca fitotoxicidad y disminuye la eficiencia fotosintética.
En un sitio contaminado con cobre (2500 mg/Kg), crecen poblaciones de una gramínea silvestre (Polypogon sp) que acumula sobre 500mg/Kg p.s. de cobre en hojas y raíces. Semillas colectadas en el sitio fueron germinadas in vitro, y posteriormente fueron transferidas a sistemas hidropónicos hasta una edad de 3,5 meses.
Se evaluó la tasa de crecimiento radicular y foliar en medios líquidos suplementados con concentraciones crecientes de Cu++ (0 a 124.5 ºM), determinando el EC50 radicular y foliar (concentración que inhibe el crecimiento en 50%), para posteriormente determinar el efecto de una concentración de Cu++ 4 veces mayor al EC50 radicular, sobre la eficiencia fotosintética de las plantas. Se determinó el daño oxidativo por lipoperoxidación y la variación en peso seco y pigmentos fotosintéticos entre 0 y 48 horas de tratamiento.
No se observaron diferencias significativas en la eficiencia fotosintética ni en el contenido de clorofilas y carotenoides entre plantas control y tratadas. La lipoperoxidación mostró un aumento no significativo en las plantas tratadas respecto al control.
De acuerdo a los resultados, se concluye que los individuos de Polypogon sp. estudiados son tolerantes a cobre, lo que estaría relacionado con mecanismos de protección de la actividad fotosintética. Esta planta se propone como un modelo para el estudio de la homeostasis de cobre en vegetales.

 

66. EFECTO DEL MEDIO NUTRITIVO SOBRE LA TOXICIDAD DE COBRE EN Mimulus cupreus (Nutrient solution effect on copper toxicity in Mimulus cupreus). Vera G, Ginocchio R y Ortiz C. Facultad de Química y Biología, Universidad de Santiago de Chile y Centro de Investigación Minera y Metalúrgica (CIMM) cortiz@lauca.usach.cl

El cobre es un nutriente esencial pero altas concentraciones pueden causar la muerte de las plantas. Sin embargo, algunas poblaciones viven en presencia de cobre gracias a procesos microevolutivos. En Chile se ha descrito la especie nativa Mimulus cupreus Dombr. creciendo cerca de la mina de cobre El Teniente.
Para evaluar si la tolerancia de M. cupreus a cobre depende del medio de crecimiento, se midió la toxicidad de 0.5 y 2.0 mg/L del metal en Phostrogen 0.3gr/L, Nitrato de calcio 0.5g/L y Hoagland, con renovación del medio cada 2-3 días. Se midió aparición de raíces adventicias, clorofila total y el peso fresco de hojas y raíces, 7 y 14 días luego de montado el sistema. El Phostrogen estimuló la formación de raíces en los controles e inhibió la emergencia y desarrollo de raíces en presencia de cobre. A los 14 días, no hubo diferencias significativas entre el crecimiento en Phostrogen y Hoagland para los controles mientras que 2mg/L de cobre en Hoagland favorece el crecimiento radicular y desarrollo de biomasa con baja necrosis del tejido. El Nitrato de Calcio inhibió el desarrollo vegetal en ausencia y presencia de cobre. No hubo diferencias significativas en el contenido de clorofilas entre Phostrogen y Hoagland, pero en nitrato de calcio estas disminuyeron significativamente.
El medio Hoagland resultó ser el más adecuado para estudios de dosis-respuesta y se descartó el uso de Nitrato de Calcio en estudios de tolerancia a metales.

67. IDENTIFICACIÓN DE UN LOCUS QUE RETRASA EL DESPLAZAMIENTO SISTÉMICO DE TMV-U1 EN Arabidopsis thaliana (Identification of a locus that delays the systemic movement of TMV-U1 in Arabidopsis thaliana) Serrano, C. Medina, C., Mancilla, P. y Arce-Johnson, P.
Departamento de Genética Molecular y Microbiología. Facultad de Ciencias Biológicas. Pontificia Universidad Católica de Chile
Patrocinio: Dr Patricio Arce-Johnson

El establecimiento de una infección viral en plantas está determinado por la interacción entre factores del virus y del hospedero. En este trabajo se evaluó la infección del virus del mosaico del tabaco cepa U1 (TMV-U1) en Arabidopsis thaliana. Se encontró que el ecotipo Uk-4 permite el rápido desplazamiento sistémico de este virus, lo que no ocurre en el ecotipo Col-0, en el que se retrasa el desplazamiento viral. Para analizar las diferencias genéticas entre ambos ecotipos y mapear el carácter que retrasa el desplazamiento viral en Col-0, se obtuvieron marcadores moleculares polimórficos CAPS y microsatélites para cada uno de los 5 cromosomas de Arabidopsis thaliana. Se realizaron cruces recíprocos entre estos 2 ecotipos y se evaluó obtuvo la F1 generada. En esta el 100% de las plantas acumulan sistémicamente la proteína de la cápside de TMV-U1 como en el ecotipo Uk-4. El análisis de la población F2 y F2 recíproca, sugiere que el carácter de retraso del desplazamiento sistémico en Col-0, está controlado por un locus recesivo, monogénico, nuclear y que se comporta de forma mendeliana. Este locus se denominó DSTM1 (Delayed Systemic Tovamovirus Movement 1) y se ubica en el cromosoma 5 entre los marcadores moleculares nga129 (105 cM) y ciw10 (115 cM).
Financiamiento: FONDECYT 1040789

 

68. CARACTERIZACIÓN Y ANÁLISIS DE EXPRESIÓN DE UN GEN TIPO MADS-BOX EN Vitis vinifera (Characterization and expression pattern of a MADS-box type gene in Vitis vinifera) Poupin, MJ., Federici, F., Medina, C., Arce-Johnson P. Departamento de Genética Molecular y Microbiología, Pontificia Universidad Católica de Chile,. email: parce@bio.puc.cl)

Los genes de la familia MADS-box codifican para un gran número de factores de transcripción con funciones fundamentales durante procesos de diferenciación y desarrollo de los órganos florales en plantas. La mayoría de los estudios de estos genes se han realizado en especies modelo como Arabidopsis y Anthirrinum. Nosotros estamos interesados en estudiar genes de esta familia en Vitis vinifera con el fin de conocer su participación en el desarrollo de la flor y el fruto. En esta investigación se identificó, clonó y secuenció un gen tipo MADS-box en vid (Vitis vinifera) a partir de DNA genómico y RNA de tejido floral. La secuencia codificante aislada (VvPI) presenta un 70% de identidad con la secuencia Pistillata en Arabidopsis thaliana. VvPI pertenecería a un clado monofilético de la subfamilia de genes Pistillata/Globosa (PI), que en Arabidopsis está involucrado en la formación de pétalos y estructuras masculinas en la flor. Hemos analizado los patrones de expresión de este gen en distintos tejidos y estadíos del desarrollo floral de Vitis vinifera. La comparación de estos resultados con la del gen PI en Arabidopsis nos permitirá evaluar si VvPI efectivamente es un homólogo del gen PI.
Agradecimientos proyecto Fondef G02S1001

69. EFECTO DEL SUBCULTIVO SUCESIVO SOBRE LA FOTOINACTIVACIÓN DE MICROTALLOS DE Eucalyptus globulus Labill. PROPAGADOS IN VITRO. (Effect of successive subculture on photoinhibition of Eucalyptus globulus Labill. shoots propagated in vitro). Gómez, C., Materán, M., Coopman, R., Véjar, P., Bravo, L., Sánchez-Olate, M. y D. Ríos. Laboratorio de Biotecnología Forestal y Laboratorio de Fisiología Vegetal. Universidad de Concepción. crigomez@udec.cl., mmateran@udec.cl

El cultivo in vitro de tejidos vegetales establece una pérdida de la capacidad autotrófica, asociada a los aportes de carbohidratos en el medio de cultivo, el intercambio gaseoso y la humedad relativa en los envases de cultivo. Esta disminución podría estar afectando la capacidad de proliferación de brotes adventicios en cada subcultivo.
Considerando la importancia de la micropropagación, como técnica para clonar genotipos selectos, se estudió el efecto del subcultivo sucesivo de microtallos de Eucalyptus globulus propagados in vitro, sobre la fotoinactivación del fotosistema II. Los microtallos fueron subcultivados cada 50 días en medio de proliferación (MS + 1 mgL-1 BAP + 0,01 mgL-1 ANA) hasta obtener 10 subcultivos. Posteriormente se midió la fotoinactivación directamente sobre los microtallos con fluorímetro modulado Hansatech.
Los resultados indicaron que no existen diferencias significativas entre los subcultivos, concluyendo que la fotoinactivación del fotosistema II no es afectada por la propagación sucesiva de microtallos.
El estudio será complementado con el análisis de carbohidratos solubles totales en cada subcultivo, relacionando tanto la fase clara como oscura de la fotosíntesis.
Agradecimientos: A los proyectos FONDEF D97-F1059 y DIUC 99.142.008-1.0, por el financiamiento de esta investigación.

 

70. EFECTO DE LA APLICACIÓN DE REGULADORES DE CRECIMIENTO EN LA DIFERENCIACIÓN FLORAL DE JOJOBA (Simmondsia chinensis (Link) Schneider). (Effect of plant growth regulators on floral differentiation in Jojoba (Simmondsia chinensis (Link) Schneider)). Prat L., Botti C., Fichet T. Departamento de Producción Agrícola, Facultad de Ciencias Agronómicas, Universidad de Chile, Casilla 1004, Santiago, Chile. Patrocinio: FONDEF D97F032

La transición de yemas vegetativas a florales es un proceso complejo que se encuentra regulado por muchos factores, dentro de los cuales la regulación fitohormonal tiene gran importancia. Con el objetivo de determinar el efecto de la aplicación de reguladores de crecimiento se estudiaron los cambios histológicos producidos en yemas florales de jojoba. Se aplicaron dos reguladores de crecimiento: 150 mg* L-1 de benciladenina (BA) ó 150 mg* L-1 de giberelinas (GA4+GA7) en dos clones seleccionados de jojoba de 5 años de establecimiento, bajo condiciones de campo. Las evaluaciones se realizaron a los 120, 240 y 360 días post-aplicación y las semillas se cosecharon 18 meses después de esta. Los resultados muestran que en el clon 4.11.32 BA logró un aumento significativo en el nº de flores totales y nº de flores en roseta. El estudio histológico mostró que la aplicación de BA en el clon 4.11.32 produjo ampliación de la zona meristemática de la axila de la hoja, la que posteriormente se diferenció en varias flores, formando una roseta.

71. AISLAMIENTO Y CARACTERIZACIÓN DE HONGOS SOLUBILIZADORES DE FOSFATO EN SUELOS DE LA VI REGIÓN DE CHILE. (Isolation and characterization of phosphate solubilizing fungi in soils of VI region of Chile). Retamales, P1; Lozano, C2 and Cifuentes, V2. (1). Instituto de Investigaciones Agropecuarias, INIA y Centro de Investigaciones en Biotecnología Silvoagrícola, CIBS. (2) Laboratorio de Genética, Facultad de Ciencias, Universidad de Chile.

Diferentes microorganismos pueden solubilizar formas no disponibles de fosfatos naturales y convertirlas en asimilables por las plantas. En este trabajo se caracterizó hongos nativos solubilizadores de fosfatos inorgánicos en suelos de la provincia de Cachapoal. La población de hongos se evaluó utilizando 3 medios de cultivo con 2 fuentes de Fosfato inorgánico. Las muestras de suelo se analizaron en laboratorio (pH, %M.O. y P-Olsen) y mediante estudios microbiológicos. La capacidad solubilizadora de fosfato se determinó en medio con CaHP04, hidroxilapatita y SFT mediante la formación de zonas claras o halos de disolución de los cristales de fosfatos alrededor de las colonias. Las bacterias presentaron pequeños halos de solubilización comparados con los hongos. Entre los hongos aislados la mayoría pertenece al género Penicillium, Aspergillus, Alternaria, Fusarium, Rhizopus y Paecilomyces. Las cepas que presentaron los mayores niveles de solubilización de fosfatos correspondieron a los géneros Aspergillus spp. Y Penicillium spp. Los resultados indican una respuesta selectiva de la microflora nativa en la utilización de diferentes fuentes de fósforo. Estas cepas podrían tener una proyección en la formulación de biofertilizantes para la agricultura regional. pretamal@inia.cl
Agradecimientos: Nadia Fontecilla, M. Sc. Directora CIBS.

 

72. ECOTIPOS Y ADAPTACIÓN LOCAL EN CONVOLVULUS CHILENSIS-CONVOLVULACEAE (Ecotypes and local adaptation in Convolvulus chilensis-Convolvulaceae) Gianoli, E., Suárez, L.H., Quezada, I.M. & Ruiz, E. Departamento de Botánica, Universidad de Concepción. Casilla 160-C, Concepción, Chile.

El concepto de ecotipo fue introducido en la teoría ecológica por el botánico Turesson en 1922 y alude a una población diferenciada genéticamente y adaptada a un ambiente particular. Desde entonces, experimentos de jardín común, transplantes, y análisis moleculares se han usado como evidencia para la existencia de ecotipos y adaptación local. Sin embargo, en una misma población algunos atributos mostrarán diferenciación ecotípica y otros no, y no todos los atributos que exhiban diferenciación poblacional tendrán valor adaptativo. En la especie vegetal endémica Convolvulus chilensis, típica de laderas costeras y semiáridas del norte chico, evaluamos en dos poblaciones naturales (Aucó _ interior de la IV región, y Canelo _ costa de la V región) la existencia de ecotipos y adaptación local. Análisis de aloenzimas, transplantes, y experimentos de jardín común de resistencia a la sequía y al congelamiento revelaron patrones contrastantes. Así, las poblaciones aparecían genéticamente diferenciadas pero no hubo evidencia de adaptación local en terreno. Las poblaciones mostraron diferenciación en algunos atributos morfológicos y fisiológicos, tanto en sus valores medios como en su plasticidad frente a ambientes experimentales de disponibilidad de agua y temperatura. Se discute estos resultados subrayando el potencial y restricciones al desarrollo de adaptación local en las poblaciones estudiadas.
FONDECYT 1030702

73. ALTERACIONES EN LA MORFOLOGÍA Y QUÍMICA FOLIAR DE Coffea arabica EN EL CONTROL DEL HONGO Hemileia vastatrix (Changes in morphology and chemistry of Coffea arabica in the control of the Hemileia vastatrix fungi). Lichston, J. E. & Godoy, S. A. P. FFCLRP/USP, Av. Bandeirantes, 3900, Ribeirão Preto-SP, Brasil; e-mail jmespada@yahoo.com

A maioria das doenças vegetais é causada por fungos. O controle destas doenças é feito usando-se fungicidas, grandes contribuidores da poluição ambiental. A principal barreira protetora contra o ataque de fungos em plantas é a cera epicuticular, a qual exerce importante papel na seleção de substâncias que entram pela folha e na resistência à perda d'água. Portanto, são relevantes os estudos das relações entre a superfície foliar e Substâncias nela aplicadas. O presente trabalho analisou o efeito de um fungicida foliar em Coffea arabica, variedades Obatã e Catuaí vermelho, na morfologia, teor e constituintes da cera foliar epicuticular. Após quatro aplicações do fungicida, verificou-se a diminuição gradativa do teor de cera, apenas nas folhas tratadas com o fungicida. Quanto à composição química da cera, há um predomínio de alcanos, seguido por álcool primário, que diminui com a aplicação do fungicida. Nas folhas controle observa-se cera do tipo filme e cristalina, porém nas folhas tratadas com o defensivo verifica-se apenas cera do tipo filme e lesões por ruptura da cera. Há indícios de um efeito degenerativo do fungicida sobre a cera epicuticular, o que pode tornar a planta mais suscetível a outras doenças, ao estresse hídrico e à herbivoria.
Agradecimentos: CNPq

 

ECOLOGÍA VEGETAL

74. HOMOGENIZACIÓN FLORÍSTICA EN CHILE CONTINENTAL: UNA APROXIMACIÓN PRELIMINAR (Floristic homogenization in continental Chile: a preliminar approach) Villavicencio, N., Guzmán, D., Castro S.A. & Jaksic F.M. Pontificia Universidad Católica de Chile. E-mail: navilla@puc.cl.

El fenómeno de homogenización biótica producto de la introducción de especies por parte del hombre ha sido poco estudiado. Los escasos estudios disponibles son en su mayor parte cualitativos. En este trabajo se realizó un análisis cuantitativo de homogenización florística en Chile, basándose en la comparación de la flora vascular de tres regiones administrativas de Chile continental (II, IV y XII Región). Para esto, se analizó la composición específica actual y original de cada región de acuerdo a la información disponible en la literatura. Utilizamos el índice de similitud de Jaccard para evaluar el cambio composicional entre la flora actual y original de estas regiones. Nuestros resultados revelaron que la similitud original promedio fue de 8,6%, mientras que la actual es de 10,3%. A pesar que el incremento en similitud es bastante reducido (1,7%), muestra una tendencia a incrementar el parecido composicional entre las regiones estudiadas.

75. Gesneriáceas epífitas en bosques de Chiloé (Epiphytic Gesneriads in forests of Chiloé) Salinas, M.F. y J.J. Armesto. Departamento de Ecología, Universidad de Chile y CASEB, Universidad Católica de Chile.

En los bosques templados del sur de Sudamérica se encuentran tres géneros monotípicos endémicos de la familia Gesneriaceae, cuyo hábito ha sido descrito como epífito. En esta investigación cuantificamos su forma de crecimiento y estimamos su abundancia en bosques de tipo Nord Patagónico y Valdiviano en la isla de Chiloé. En cada bosque se contabilizaron las gesneriáceas y su posición vertical en los árboles mayores a 5 cm dap dentro de cuatro parcelas de 50 x 20 m. Además, en cada parcela usamos seis transectos de 50 m para evaluar la abundancia de las gesneriáceas en el piso del bosque. Encontramos diferencias en formas de crecimiento entre las tres especies. Asteranthera ovata y Mitraria coccinea fueron frecuentes tanto en el piso del bosque como en los árboles, por lo que se clasificaron como trepadoras. Sarmienta repens se encontró con mayor frecuencia en los estratos superiores del bosque y solo sobre árboles, por lo que se clasificó como holoepífita (no enraíza en el suelo). En el bosque Nord Patagónico, Mitraria fue la especie más abundante, seguida porÄAsteranthera; y Sarmienta fue la menos abundante. En el bosque Valdiviano, por el contrario, Sarmienta fue la especie más abundante y Asteranthera no fue registrada. Estas tres especies representan tres líneas divergentes de epifitismo en bosques templados australes.
FSD, Fondap-Fondecyt 1501-0001, CONICYT.

 

76. INCENDIO CATASTRÓFICO EN EL PARQUE NACIONAL TOLHUACA: ¿DENTRO O FUERA DEL RANGO HISTÓRICO NATURAL DE VARIABILIDAD? (Catastrophic fire in Tolhuaca Nacional Park: inside or outside of the historical range of natural variability?) González, M.E., Muñoz, A., Quezada, J., Le Quesne, C.
Facultad de Ciencias Forestales, Universidad Austral de Chile, Valdivia, Chile.

 

El fuego es el disturbio más importante que modela los ecosistemas forestales de Araucaria _Nothofagus en la Cordillera de los Andes. Los incendios catastróficos ocurridos en la cordillera andina de la Araucanía (temporada 2002) afectaron extensas superficies de este tipo de bosques. En particular, más del 60% de la superficie del Parque Nacional Tolhuaca (PNT) cubierta principalmente con bosques de Araucaria _Nothofagus fueron consumidos por el fuego. El objetivo de este estudio fue reconstruir la historia de incendios en el PNT para establecer su variabilidad temporal y espacial. En la reconstrucción del régimen de incendios se distinguen preliminarmente dos patrones importantes asociados estrechamente al impacto del uso del paisaje por los pueblos indígenas y colonos Euro-chilenos: i) Una alta frecuencia de incendios desde ca. 1750 hasta mediados de 1950, asociada a la ganadería adoptada por el pueblo mapuche/pehuenche, y posteriormente a la colonización Euro-chilena (ca. 1900-1960); ii) Una baja frecuencia de incendios pre-1700 y post-1960 que indicaría el menor impacto humano en el ecosistema derivado de un uso distinto del medio natural por parte de la población indígena (pre-1700) y chilena luego de la creación del PNT. Durante los últimos 300 años al menos un incendio catastrófico de igual magnitud al ocurrido el 2002 habría afectado estos bosques de Araucaria.
Agradecimientos: Fundación Andes (C-13860), IFS (D/3124-2), DID (S-200508)

 

77. RECUPERACIÓN DE BOSQUES DE NOTHOFAGUS SOBRE PRADERAS ABANDONADAS: LECCIONES A PARTIR DEL CAMBIO HISTÓRICO EN EL USO DE LA TIERRA (Secondary Nothofagus forest succession in the temperate region of Chile: Lessons from historical land-use change). González, M., Abarzúa,A., Christie, D.A., García, J.L., Jara, C., Lara, A., Muñoz, A., Núñez, M. & Parada, T. Núcleo Milenio FORECOS-UACh. duncan@sendadarwin.cl

A finales del sXIX y como resultado del proceso de colonización chileno-europea de la X Región, los bosques de Nothofagus de los faldeos de la cordillera de los Andes, fueron sometidos a una severa intervención antrópica mediante repetidos incendios y talas dando como resultado ecosistemas degradados y amplias zonas convertidas en praderas agropecuarias. Posterior a la década de los 40`s y luego de una disminución de la presión antrópica, las comunidades de Nothofagus han comenzaron a recuperarse y recolonizar antiguas praderas abandonadas.
El objetivo del presente estudio es evaluar, tanto a nivel de rodal como de paisaje, la dinámica de recolonización de comunidades arbóreas sobre praderas abandonadas en los faldeos andinos de la X Región. Nuestra aproximación metodológica se basa en la realización de una reconstrucción dendrocronológica a nivel de microcuencas, y de fotointerpretación temporal a nivel de paisaje mediante SIG. Actualmente la estructura y dinámica comunitaria a nivel de paisaje, esta influenciada por la historia en el uso del suelo durante el sXX.
Nuestros resultados demuestran la capacidad de recuperación de las comunidades arbóreas post-perturbaciones humanas, y que preguntas que aborden metodologías tanto espacial como conceptualmente multiescalares serán claves para elaborar propuestas de manejo y conservación de estos ecosistemas.
Iniciativa Científica Milenio

 

78. BOSQUES DE AUSTROCEDRUS CHILENSIS EN PARQUE NACIONAL LAGUNA DEL LAJA: COMPOSICIÓN, ESTRUCTURA E INFLUENCIA CLIMÁTICA (Austrocedrus chilensis forests in Laguna del Laja National Park: composition, structure and climatic influences) Le Quesne, C., Barichivich, J., y González, M.E.
Facultad de Ciencias Forestales, Universidad Austral de Chile, Valdivia, Chile.

Austrocedrus chilensis (Ciprés de la Cordillera) es considerada la conífera más xérica de los bosques templados de Sudamérica. La estructura de los bosques de A. chilensis varía de acuerdo al gradiente medioambiental y régimen de disturbios a través de su rango geográfico. Los objetivos de este estudio fueron: i) describir la composición y estructura de las poblaciones de Ciprés ubicados sobre un sustrato volcánico en su límite extremo de precipitación; y ii) examinar, a partir de anillos, las tendencias de crecimiento asociadas a la variabilidad climática durante los últimos 300 años. El estudio fue desarrollado en 6 rodales ubicados entre los 1020 y 1100 m s.n.m.. Las relaciones clima-crecimiento fueron analizadas usando dos cronologías desarrolladas en el Parque. En este ambiente de montaña, Ciprés coloniza terrazas fluvioglaciales formando bosques puros y abiertos con reducidos diámetros y alturas. En general, estos rodales son jóvenes, de una estructura coetánea, con edades entre 100 a 140 años. El crecimiento de Ciprés mostró una relación significativa con la precipitación de primavera y negativa con la temperatura de primavera y verano de la estación de crecimiento previa y actual. La influencia humana a través de la ganadería tiene hasta hoy, un efecto importante en la conservación de estas poblaciones de A. chilensis.

 

79. FACTORES ABIÓTICOS QUE INFLUENCIAN LOS PROCESOS GERMINATIVOS DE SCHIZANTHUS LITORALIS (SOLANACEAE) (Abiotic factors influencing germination processes of Schizanthus litoralis (Solanaceae)) Jara PA123, G Arancio1, M Carmona3 & R Moreno1 (1. Departamento de Ecología, Facultad de Ciencias, Universidad de La Serena. 2. Laboratorio de Ecología y Sistemática Vegetal, Facultad de Ciencias, Universidad de Chile. 3. Fundación "Senda Darwin", Santiago. pjarancio@yahoo.com)

Schizanthus litoralis (Solanaceae), es una hierba endémica anual, distribuida entre la II y V Región, con valor ornamental y cuyos frutos son altamente depredados. Se determinó cuales son los factores abióticos que controlan sus procesos germinativos. Semillas escogidas al azar fueron sometidas a pruebas de viabilidad y dos experimentos germinativos, con distintas combinaciones de tiempos de hidratación (0-24-48-72-96 hrs), temperatura (10º y 25ºC) e iluminación (0-12-24 hrs). Debido a los bajos niveles germinativos, se realizó un tercer experimento con tratamientos de hidratación/deshidratación/escarificación (manual y con sustrato). Los análisis de varianza muestran valores significativos para los tratamientos donde se escarificaron las semillas, alcanzando un 75% de germinación. Además, se observaron diferencias en los tipos de lesiones y niveles de germinación entre los procesos de escarificación manual y por sustrato. La ausencia de germinación asociada al tratamiento sin escarificación, se explica porque la testa es una verdadera barrera física. Aparentemente, el arrastre in situ de las semillas por flujos de agua, causan el deterioro de la testa, dejando la semilla apta para germinar.
PA Jara Becaria CONICYT. Millennium Scientific Initiative P02-051-F (ICM) y Herbario U. de La Serena

 

80. ESTIMACIÓN DE VARIABLES CLIMÁTICAS USANDO FISIONOMÍA FOLIAR EN CHILE (Estimation of climatic variables using foliar physiognomy in Chile). Aguilera, K. & Hinojosa, L.F. Lab. Paleoecología. Depto. Ecología, Fac. Ciencias, Universidad de Chile.

La relación fisionomía foliar y clima se basan en la correlación actual que exhiben ciertas características morfológicas de hojas de angiospermas y diferente variables climáticas. Estos análogos modernos han sido una herramienta muy útil para acceder a las condiciones climáticas en escalas temporales de millones de años. Diferentes ecuaciones predictivas de esta relación han sido construidas a partir de la dependencia estadística del porcentaje de hojas con borde entero y temperatura media anual, o el tamaño foliar y precipitación media anual, entre otros. Estas estimaciones lineales se basan en datos globales provenientes principalmente de Norte América, Asia, Australia y recientemente en Sudamérica tropical. Sin embargo, estas ecuaciones y predicciones no han sido evaluadas con datos de regiones extra tropicales en Sudamérica, desconociéndose cómo se ajustan las morfologías foliares y su clima asociado.
El objetivo de este trabajo es establecer la relación lineal entre la morfología foliar y el clima actual en un gradiente altitudinal y latitudinal entre 33ºS y 47ºS, en Chile. Para ello se midieron porcentajes de hojas con borde entero y tamaño foliar en diferentes floras lo largo de ambos gradientes climáticos y vegetacionales. Los resultados evidencian una discordancia entre valores estimados y observados lo que es explicado por la singular historia evolutiva de la región.
Agradecimientos: DI I-05/01-2, U. Chile. 14255007, Japón. PO2-051-F, CMEB U. Chile.

 

81. AGUA Y ESTABLECIMIENTO DE PLÁNTULAS DE Prosopis pallida "ALGARROBO", Caesalpinia spinosa "TARA" y Myrcianthes ferreyrae "ARRAYÁN DE LOMAS" EN LAS LOMAS DE MEJÍA (Water and establishment of seedlings of Prosopis pallida "algarrobo", Caesalpinia spinosa, "tara" and Myrcianthes ferreyrae "arrayán de lomas" en las lomas de Mejía) Jiménez, M.1 Squeo, F.2,3 Jiménez, P.4 Villasante, F.4 Villegas, L. 4
1
Pontificia Universidad Católica de Chile
2 Departamento de Biología, Universidad La Serena
3 Centro de Investigaciones en Zonas Áridas CEAZA, La Serena
3 Universidad Nacional de San Agustín, Arequipa-Perú
PATROCINIO: Dr. Francisco Squeo

En plantas leñosas, los adultos son menos vulnerables a desecación y herbivoría que las plántulas, por lo que el reclutamiento es probablemente el estado más crítico. El incremento de lluvias durante eventos El Niño/Oscilación del Sur (ENOS) interrumpe las condiciones extremadamente áridas del desierto costero peruano-chileno, abriendo ventanas de oportunidad para la regeneración de la vegetación. En las Lomas de Mejía en Arequipa-Perú, instalamos parcelas con cercos para excluir grandes y pequeños mamíferos, en las cuales transplantamos plántulas de Prosopis pallida, Caesalpinia spinosa y Myrcianthes ferreyrae, y aplicamos diferentes niveles de riego (0, 50, 100, 200, 400 y 600 mm). Registramos sobrevivencia, altura, diámetro y número de hojas. Las plántulas de P. pallida se establecieron con 110 mm de precipitación, sin riego extra, las de C. spinosa, con riegos mayores a 50 mm y las de M. ferreyrae con riegos mayores a 100 mm, que sería la precipitación que cae durante un evento Mega-Niño.
Agradecimientos: Unión Europea, Proyecto INCO-DEV ICFP500A4PR02, Centro de Estudios Avanzados en Ecología y Biodiversidad, PUC.

 

82. FISIONOMÍA-FOLIAR Y CLIMA EN LA REGIÓN EXTRA TROPICAL DE SUDAMÉRICA. (Foliar Physiognomic and climate in the extra tropical region of South America). Carmody, M. & Hinojosa, L.F. Lab. Paleoecología. Depto. Ecología, Fac. Ciencias, Universidad de Chile.

Los análisis fisionómicos _ climáticos se basan en la relación actual que presentan ciertas características morfológicas de hojas de angiospermas y variables de temperaturas y precipitaciones. Esta relación ha sido una herramienta muy útil para acceder a las condiciones climáticas de sistemas terrestres a escalas temporales mayores a los del registro instrumental, y su cuantificación ha permitido la construcción de modelos predictivos que han sido usados para la reconstrucción del paleoclima terrestre en períodos como el Cenozoico (65 Ma.). En la actualidad la construcción de estos análogos modernos se ha centrado en las relaciones observadas principalmente de Norte América, Asia, Australia y recientemente en Sudamérica tropical, desconociéndose cómo se comporta esta relación en regiones extra tropicales de nuestro continente.
El objetivo de este trabajo, es dar a conocer la relación morfología foliar y clima actual en un gradiente de vegetación entre 33º S y 47 º S en la región de bosques de Chile. Para ello se realizó un análisis de correspondencia canónica entre 31 caracteres morfológicos de hojas de angiospermas en diferentes unidades de bosque y sus respectivas variables climáticas incluyendo temperaturas y precipitaciones. A partir de los resultados se dan a conocer nuevos modelos para la estimación de condiciones paleoclimáticas continentales en la región.
Agradecimientos: DI I-05/01-2, U. Chile.£14255007, Japón. PO2-051-F, CMEB U. Chile.

 

83. PALEOCLIMA DE LA FORMACIÓN LIGORIO MÁRQUEZ, CHILE (~47ºS; PALEOCENO SUPERIOR-EOCENO INFERIOR). (Paleoclimate of Ligorio Márquez Formation, Chile (~47ºS; upper Paleocene- lower Eocene). Pesce, O. & Hinojosa L.F. Lab. Paleoecología. Depto. Ecología, Fac. Ciencias, Universidad de Chile.

El período de tiempo comprendido entre fines del Paleoceno y comienzos del Eoceno (~57-50 Ma.) ha sido descrito como el momento de mayor calentamiento global durante el Cenozoico. Para el sur de Sudamérica los análisis paleobotánicos evidencian condiciones tropicales _ subtropicales a latitudes tan australes como 47 ºS durante el rango Paleoceno-Eoceno, con elevados montos de temperaturas, precipitaciones, y número de riqueza de especies, siendo considerado este período como el punto de máxima biodiversidad a nivel global, asociado al evento de calentamiento. En este contexto, la flora fósil de Ligorio Márquez juega un importante rol para la comprensión paleoclimática y paleoecológica de este período, representando el paleo-límite austral de los trópicos en Sudamérica.
El objetivo de este trabajo es dar a conocer nuevas estimaciones paleoclimáticas en función de temperaturas y precipitaciones, a partir de colectas recientes realizadas en la Formación Ligorio Márquez. Las estimaciones paleoclimáticas fueron obtenidas a partir de modelos univariados y multivariados de la relación fisionomía foliar y clima actual, utilizando para ello, una base de datos global enriquecida con localidades actuales chilenas.
Agradecimientos: DI I-05/01-2, U. Chile. Grant 14255007, Japón. PO2-051-F, CMEB, U. Chile.

 

84. SUCESIÓN INICIAL EN BOSQUES DE ARAUCARIA-NOTHOFAGUS LUEGO DEL INCENDIO CATASTRÓFICO EN EL PARQUE NACIONAL TOLHUACA (Initial succession in Araucaria-Nothofagus forests after a catastrophic fire in Tolhuaca Nacional Park) Parada, T., González, M.E., Christie, D., Abarzúa, A.M., García, J.L., Jara, C., Muñoz, A., Núñez, M., y Lara, A. (Facultad de Ciencias Forestales, Universidad Austral de Chile, Valdivia, Chile.)

El fuego tiene un rol central en la dinámica y estructura de los bosques de Araucaria-Nothofagus en la Cordillera de los Andes. En la región de la Araucanía, este tipo de eventos ha modelado estos bosques andinos al menos durante los últimos 500 años. Este estudio tuvo por objetivo examinar la respuesta post-fuego de la comunidad vegetal en bosques de Araucaria-Nothofagus en el Parque Nacional Tolhuaca, el cual fue afectado por un incendio catastrófico en Febrero del 2002. La investigación contempló el muestreo en dos tipos de bosques: bosque adulto de Araucaria-Nothofagus y renoval mixto de Nothofagus, los cuales fueron afectados por distintas severidades de fuego. En áreas quemadas con mayor severidad, donde la mortalidad del componente arbóreo fue mayor a un 90%, la recuperación de la comunidad ha sido más lenta que en áreas quemadas con una severidad intermedia. En esta ultima situación, la densidad de plántulas arbóreas, riqueza y cobertura de plantas de sotobosque ha sido más alta que en las áreas quemadas más severamente. Sin embargo, el crecimiento en altura de Araucaria y Nothofagus fue mayor en áreas quemadas con una mayor severidad.
Agradecimientos: Fundación Andes (C-13860), IFS (D/3124-2), DID (S-200508)

85. Efectos de la fragmentación del bosque Maulino sobre la producción y depredación pre-dispersión de semillas de nothofagus glauca (Effects of Maulino forest fragmentation on the production and predispersal predation of seeds of Nothofagus glauca). Burgos, A1. Grez, A.A.2 1 Facultad Ciencias, Universidad de Chile, 2 Facultad de Ciencias Veterinarias y Pecuarias, Universidad de Chile

La fragmentación del hábitat puede modificar procesos reproductivos de las plantas que ocurren en los primeros estados del ciclo de vida. El bosque Maulino ha sido altamente fragmentado, existiendo hoy en día como un mosaico dominado por fragmentos pequeños rodeados por plantaciones de pino. En este trabajo se compara la producción y la depredación pre-dispersión de semillas de Nothofagus glauca en el bosque continuo (BC) (600 ha) y en cuatro fragmentos (Fr) (1-5 ha), a partir de la lluvia de semillas entre diciembre 2004 y abril 2005. En total se produjeron 212 semillas en el BC y 712 en los Fr, pero la producción por árbol no varió significativamente entre ambos hábitats. El porcentaje de semillas depredadas por árbol al final de la temporada fue mayor en el BC que en los Fr(79,8% y 65,7%, respectivamente, F(1,37)= 4,68, P = 0,037). En fragmentos, un mayor número de semillas escaparían a la depredación predispersión, lo cual podría incrementar su probabilidad de establecimiento. Esto, sumado a que la germinación es mayor en los Fr, favorecería el reclutamiento de plántulas en este nuevo hábitat, lo que puede tener consecuencias sobre estructura futura del bosque. FONDECYT 1010852.

 

86. REGENERACIÓN IN VITRO DE GOMORTEGA KEULE (GOMORTEGACEAE), UNA ESPECIE CHILENA ENDÉMICA EN PELIGRO DE EXTINCIÓN. (In vitro regeneration of Gomortega keule (Gomortegaceae), a Chilean endemic tree in danger of extinction). Jordan, M, González, J. y C. Roveraro. Departamento de Ecología, Facultad de Ciencias Biológicas, Pontificia Universidad Católica de Chile, Alameda 340, Santiago, Chile.
Email mjordan@genes.bio.puc.cl.

Yemas axilares de secciones uninodales de plantas juveniles de 2 años de Gomortega keule (Mol.) Baillon, "Queule" (Gomortegaceae), fueron cultivados en presencia de varios reguladores de crecimiento; entre ellos, en concentraciones de 0.54 µM de ácido a-naftalenacético (ANA) y 4.44 µM de bencilaminopurina (BA) en medio liquido WP (Lloyd y McCown, 1980). Dicha condición condujo a la brotación y crecimiento de las yemas con profusa formación de nuevos brotes, en un periodo de 2-3 semanas. En subcultivo, con el mismo medio basal, aunque en conteniendo niveles más altos de BA (22.2 µM), cada nueva sección inició la formación de numerosos brotes adventicios; hasta un máximo aprox. de 50 brotes/sección, entre 0.3-0.5 cm de longitud. Alternativamente, explantes transferidos a un medio con ácido indolbutírico (AIB) en concentraciones de 2.95, 12.3 o 24.6 µM, evidenciaron formación de raíces. La iniciación de raíces fue más abundante en el tratamiento con 24.6 µM de AIB ocurriendo en approx. 46% de los explantes en subcultivo, finalizado un periodo de 3 meses. El enraizamiento de estos explantes y de brotes adventicios derivó en la regeneración de plántulas las cuales presentaron buena aclimatización en condiciones de invernadero. A pesar de la vasta serie de combinaciones hormonales ensayadas, solo las yemas axilares de secciones nodales evidenciaron respuestas regenerativas; otros explantes ensayados; entre ellos, pecíolos, lámina foliar o secciones internodales, solo condujeron a la formación de callo, el cual no expresa respuestas morfogénicas. (Europ. J. Hort. Sci. 70(4), 2005, in press).

 

87. FENOLOGÍA Y SISTEMA REPRODUCTIVO DE AEXTOXICON PUNCTATUM EN LOS EXTREMOS DE SU RANGO GEOGRÁFICO (Phenology and reproductive system of Aextoxicon punctatum in the northern and southern limits of its distribution) Núñez-Ávila, M. & J. Armesto FORECOS, Universidad Austral de Chile CASEB, Universidad Católica de Chile

Aextoxicon punctatum (30º-43ºS), árbol endémico del bosque templado de Sudamérica, presenta poblaciones aisladas en la Cordillera de la Costa de la zona semiárida (30°-32°S). El objetivo del presente estudio fue contrastar la fenología y el sistema reproductivo de las poblaciones de A. punctatum de Fray Jorge (30ºS) y del centro-sur de Chile (41ºS). En cada zona se registró periódicamente la fenología. El sistema reproductivo se evaluó mediante 1) exclusión de insectos y polen por viento, 2) exclusión de insectos, 3) polinización manual y 4) polinización natural (N=36).
Los resultados preliminares muestran una floración de 5 meses en los individuos de Fray Jorge, con frutos presentes durante todo el año. En contraste, en Valdivia la floración duró dos meses. En Fray Jorge un 12% de frutos se originaron por polinización natural y solo un 1% por apomixis. En Valdivia un 2% de los frutos fueron producto de polinización natural y un 15% por apomixis. Se concluye que las poblaciones de A. punctatum en los extremos de su distribución geográfica presentan diferentes patrones fenológicos y sistemas reproductivos. Esto podría ser consecuencia de las diferencias genéticas documentadas entre estas poblaciones y revelarían una tendencia a la reproducción asexual de los individuos al sur de su rango geográfico.

88. EFECTOS DE ÁRBOLES EMERGENTES SOBRE EL ÍNDICE DE ÁREA FOLIAR EN RODALES ANTIGUOS DEL BOSQUE VALDIVIANO. Jara, C.K 1 y Lusk, C.H.2 1Facultad de Ciencias Forestales, Universidad Austral de Chile, Valdivia.2Departament Biological Science, Mcquarie University, Australia.

La estratificación vertical es una característica común en los bosques húmedos. Existen estudios que muestran evidencias de efectos aditivos en PPN en bosques donde se presenta un estrato emergente. Las causas de estos efectos aditivos son poco conocidas y a su haber se postulan dos hipótesis. Este estudio busca determinar el efecto que produciría la presencia de emergentes en el bosque y averiguar si este efecto es aditivo o compensatorio sobre las especies del dosel, esperando encontrar que las capas foliares extra aportadas por los emergentes, sean compensadas por una reducción correspondiente en el número de capas sostenidas por las especies inferiores (lo que se mide con el IAF). El estudio se realizó en el bosque Valdiviano de la X Región, en rodales antiguos, donde domina la especie emergente Nothofagus dombeyi. Para desarrollar el objetivo se realizaron mediciones de IAF en parcelas con y sin emergentes utilizando el instrumento LAI-2000 plant canopy analizers. Los datos obtenidos mostraron que no existe diferencia significativa entre el IAF de las parcelas con y sin emergentes, lo que nos indica que existe un efecto compensatorio en el IAF de las especies que conforman el dosel gracias a la presencia de los emergentes. Los resultados sugieren que cualquier aumento de la producción primaria por la presencia de los emergentes, probablemente se debe una mayor eficiencia del bosque en la utilización de la luz, debido a una favorable yuxtaposición o una mejor combinación de tipos funcionales de plantas, sin incrementar el IAF.

 

89. EL VALOR ECONÓMICO DEL BOSQUE NATIVO TEMPLADO EN LA PROVISIÓN DE AGUA PARA CONSUMO HUMANO (The value of native temperate forests in supplying water for human consumption) Núñez, D., Nahuelhual, L. y Oyarzún, C. Universidad Austral de Chile. Núcleo Científico Milenio FORECOS.
Patrocinante: PhD. Antonio Lara (FORECOS).

Los bosques templados chilenos proveen servicios ecosistémicos de importancia local y global, tales como reciclaje de nutrientes, protección del suelo, conservación de la biodiversidad, regulación del clima y provisión de agua, entre otros. Bajo un escenario de cambio climático global, el abastecimiento de agua se convierte en uno de los servicios ecosistémicos más relevantes. En este trabajo se estimó el valor económico de los bosques templados chilenos considerando su contribución en el abastecimiento de agua fresca que permite la producción de agua potable. El área de estudio correspondió a la cuenca de Llancahue -perteneciente a la Eco-Región Valdiviana de los Bosques Templados Lluviosos- la cual abastece de agua fresca a la ciudad de Valdivia. Utilizando el método de Cambio en Productividad y series de tiempo mensuales entre enero de 1995 y diciembre de 2003, se obtuvieron medidas de valor económico por hectárea de bosque, considerando cambios en los valores económicos entre el verano y el resto del año. Los beneficios económicos por hectárea de bosque nativo fueron USD 162,4 en el verano y USD 61,2 en el resto del año.
Palabras clave: Agua potable; Bosque templado chileno; Método de cambio en productividad; Servicios ecosistémicos; Valor económico.

90. COSTOS Y BENEFICIOS DE LOS RASGOS DE ATRACTIVIDAD FLORAL EN MADIA SATIVA (ASTERACEAE) (Cost and Benefits of Attractive Floral Traits in the Annual Tarweed Madia sativa) Celedón-Neghme, C., Gonzáles, WL, Gianoli, E. ECOBIOSIS, Departamento de Botánica, Universidad de Concepción. cceledon@udec.cl

El mantenimiento de la variación intra-poblacional de rasgos florales atractivos a los polinizadores ha sido explicado mediante selección fluctuante, balanceada y frecuencia-dependiente. Sin embargo, la existencia de costos de asignación (estimado como reducción del desempeño de fenotipos atractivos en ausencia del agente selectivo) podría explicar el mantenimiento del polimorfismo en particular en especies autogámicas. Aquí, evaluamos los posibles costos y beneficios de fenotipos florales (número de lígulas) en una población de la planta autogámica Madia sativa, que presenta una variación natural en el número de lígulas (rango de 2 a 9). Específicamente evaluamos:(1) ¿En presencia de polinizadores, un mayor número de lígulas incrementa la visita de polinizadores? (beneficio) y (2) ¿En ausencia de polinizadores, un mayor número de lígulas representan un costo en adecuación biológica? Encontramos que el número de lígulas incrementa la probabilidad de visita de polinizadores y se correlaciona positivamente con el número de visitas. Sin embargo, en ausencia de polinizadores, se encontró una relación negativa entre el número de lígulas y la tasa de conversión de semillas/floretes, el peso de semilla y el porcentaje de germinación. Mostramos evidencia que el mantenimiento del polimorfismo floral podría explicarse en parte por el costo de asignación de los fenotipos más atractivos.
Fondecyt postdoctoral 3040036

 

91. RED MUTUALISTA PLANTA-FRUGÍVORO EN UN BOSQUE ESCLERÓFILO DE CHILE CENTRAL (Plant-frugivore mutualistic network in a central Chilean sclerophyllous forest) Reid, S., Celis J.L., Marquet, P.A., & Armesto J.J. Centro de Estudios Avanzados en Ecología & Biodiversidad. PUC. sreid@bio.puc.cl

Chile central se caracteriza por una alta riqueza de plantas vasculares (> 3,000 especies), alto endemismo (46,8%) y una considerable proporción de plantas poseen frutos carnosos dispersados por animales (20-53%). Los bosques esclerófilos en Chile central se ubican en las regiones más perturbadas por el hombre (30º-37ºS), estando solo un 2.0% protegidos dentro del SNASPE. A pesar de la importancia de la conservación de la biodiversidad de este sistema, existe escasa información de la estructura de la red mutualista planta-frugívoro. En este trabajo analizamos la red mutualista planta-frugívoro de un bosque esclerófilo ubicado en San Carlos de Apoquindo. En base a la literatura se construyó una matriz de presencia/ausencia de interacciones. Demostramos que la conectividad del sistema es de un 12,2% y la red está altamente anidada (Índice de Anidamiento 25,92º, P = 0,047). Por lo tanto, las especies más especialistas interactúan solo con un subconjunto de las especies que interactúan con las más generalistas. Este patrón genera interacciones asimétricas (especies especialistas solo interactúan con generalistas) y organiza la comunidad alrededor de un nudo central de interacciones de las especies más generalistas. Se discuten los resultados en base a la sensibilidad del sistema frente a perturbaciones y a la pérdida de especies.
BECA CONICYT & FONDAP-FONDECYT 1501-0001

92. DIVERSIDAD GENÉTICA Y ACTIVIDAD DE BACTERIAS DIAZÓTROFAS EN SUELOS CON DIFERENTE TIPO DE COBERTURA VEGETAL (Genetic diversity and activity of diazotrophic bacteria in soils with different plant cover). Guevara, R.(1); Armesto, J.J.(2); Corredor, P.(3) y Carú, M.(1). 1Facultad de Ciencias, U. de Chile. 2CASEB, P. Universidad Católica. 3MPI for Limnology. rguevara@uchile.cl

Los cambios en el tipo de cobertura vegetal modifican los factores edáficos, pudiendo afectar indirectamente la estructura y composición de las comunidades microbianas. El objetivo de nuestro trabajo fue comparar la diversidad del gen nifH y la actividad nitrogenasa en suelos con diferente tipo de cobertura vegetal. Se definieron cuatro sitios de muestreo: dos bosques de olivillo (Aextoxicon punctatum) y las matrices no forestadas que los rodean. Estos bosques están separados geográficamente pero tienen similar composición florística y química del suelo. El DNA se extrajo directamente del suelo. El gen nifH se amplificó por PCR y se resolvió en electroforesis en geles con gradiente denaturante (DGGE). La actividad nitrogenasa se determinó por el método de reducción de acetileno. El bosque de Chiloé y el pastizal adyacente mostraron los patrones de DGGE más complejos, sin embargo, solo en el bosque se detectó actividad nitrogenasa. El análisis de componentes principales mostró, de manera general, que las muestras se agrupan según el sitio de procedencia. El agrupamiento se confirmó por análisis de correspondencia canónica. Ambos sugieren que existe un patrón particular del gen nifH en cada sitio de estudio.
Beca AT: 4040213, Fondecyt-Fondap 1501-0001, Fondecyt 1040880.

 

93. EFECTO NODRIZA EN EL ESTABLECIMIENTO DE PLÁNTULAS: FACILITACIÓN Y TOLERANCIA AL DAÑO EN LOS ANDES DE CHILE CENTRAL. (Nurse effect in seedling establishment: facilitation and tolerance to damage in the high Andes of central Chile). Acuña-Rodríguez, I., Cavieres, L. & Gianoli, E. ECOBIOSIS, Departamento de Botánica, Universidad de Concepción.

El incremento en la supervivencia o crecimiento de una especie vegetal al estar asociada con otra se define como efecto nodriza. Este tipo de interacciones serían más relevantes en ambientes estresantes y durante el periodo de establecimiento. Por su parte, la tolerancia a la herbivoría refleja el grado en el cual una planta puede mantener su capacidad de crecimiento y reproducción después de sufrir daño, esta capacidad está además muy ligada al nivel de recursos del ambiente. En los Andes de Chile central, la especie en cojín Laretia acaulis (Apiaceae) actúa como atenuante del estrés ambiental, mejorando la supervivencia de varias especies. Predecimos que la capacidad de tolerar daño debería ser mayor en plántulas asociadas a L. acaulis en relación a plántulas aisladas. Utilizamos dos especies nativas: Hordeum comosum (Poaceae) y Haploppapus anthylloides (Asteraceae) con el fin de probar esta hipótesis. Plántulas de ambas especies fueron transplantadas en campo dentro y fuera de los cojines de L. acaulis y la mitad de ellas recibieron daño (50% del tejido foliar). Plántulas creciendo dentro de Laretia presentaron una mayor supervivencia en relación a plántulas creciendo fuera, independiente del nivel de daño. Si bien la posición (dentro o fuera) no afectó la tolerancia en Haploppapus, sí influyó significativamente en los niveles de tolerancia de Hordeum. Así, la supervivencia de plántulas dañadas y control de Hordeum no difirió dentro de los cojines, pero en el suelo desnudo la supervivencia de plántulas dañadas fue menor en relación a plántulas control. Se verificó la ocurrencia de efecto nodriza por parte de L. acaulis en el establecimiento de ambas especies, y conjuntamente, el aumento en la tolerancia al daño para H. comosum.

 

ECOLOGÍA ANIMAL

94. Anidamiento comunal en Octodon degus (Rodentia): Implicancias sobre la formación de jerarquías entre hembras. (Communal nesting in Octodon degus (Rodentia): implications in the formation of females' hierarchy. Franco L. M., Soto-Gamboa M. Instituto de Zoología, Facultad de Ciencias, Universidad Austral de Chile

El anidamiento comunal de hembras ha sido descrito para numerosas especies de roedores, y se ha asociado a beneficios de protección de crías frente a depredadores y de termorregulación. Sin embargo, en la mayoría de ellos se desconoce el tipo y naturaleza de interacciones que se establecen al interior del los grupos. En este trabajo evaluamos si dentro de los grupos de anidamiento existe la formación de jerarquías, y si éstas se asocian a la separación de tareas. Para ello utilizamos a Octodon degus, roedor caviomorfo diurno que habita en ambientes semi-áridos de Chile central. Separamos animales en grupos familiares de un macho y dos hembras. Inmediatamente después del parto, las hembras fueron separadas junto con sus camadas en jaulas individuales. Los experimentos consistieron en una serie de 10 réplicas en que dos hembras junto con sus camadas fueron colocadas en un área común. Evaluamos las conductas de interacción entre hembras, y entre hembras-crías, separándolas entre propias y ajenas. Se utilizaron dos tratamientos diferentes: hembras del mismo grupo (conocidas) y hembras de diferentes grupos (desconocidas), todas ellas con camadas de la misma edad. Los resultados indican que existe una clara jerarquía entre hembras conocidas, asociadas con una separación de tareas en el cuidado de las crías. Por el contrario en hembras desconocidas no presentan un claro patrón. Estos resultados sugieren que el conocimiento previo de las hembras al menos durante todo el periodo de preñez establece una jerarquía entre hembras y una separación de tareas.
MECESUP AUG-011.

 

95. DIRECCIONALIDAD AUDITIVA EN ANFIBIOS ANUROS DE DISTINTOS AMBIENTES ACÚSTICOS. (Auditory directionality in amphibians anuran from different acoustic environment). Quispe, M.1, Pérez, A.2, Solís, R.2 & Penna, M. 1
1
Programa de Fisiología y Biofísica, Facultad de Medicina.
2 Departamento de Ciencias Biológicas Animales, Facultad de Ciencias Veterinarias y Pecuarias, Universidad de Chile.

Los anuros se comunican en diversos ambientes que difieren en sus propiedades acústicas. En Chile, los machos de Pleurodema thaul cantan desde la superficie del agua en arroyos y lagunas. Eupsophus calcaratus en tanto, emite sus vocalizaciones desde pequeñas cavidades en el suelo de pantanos. Esta diferencia en los sitios de emisión y recepción de vocalizaciones, podría estar asociada a distintas capacidades para discriminar la localización espacial de los cantos de sus vecinos coespecíficos.
Machos de ambas especies fueron expuestos en sus respectivos hábitats a cantos sintéticos coespecíficos de igual intensidad, provenientes de parlantes ubicados en tres posiciones diferentes (0º, 90º derecha y 90º izquierda) con respecto al sujeto experimental. En ambas especies, las respuestas vocales evocadas desde estas tres posiciones no presentaron diferencias en la tasa, duración ni latencia de canto (P. thaul (N=15); E. calcaratus (N=11); Prueba de Friedman, p > 0.05; ANOVA p > 0.05 respectivamente).
Los resultados sugieren que la dirección desde la cual provienen los cantos de vecinos coespecíficos no es relevante para las interacciones acústicas en coros naturales.
Financiamiento: Proyecto FONDECYT 1040830

96. FAUNA ECTOPARASITARIA DEL MONITO DEL MONTE (DROMICIOPS GLIROIDES) EN LA ISLA DE CHILOÉ (Ectoparasitic fauna of Monito del monte (Dromiciops gliroides) at Chiloé island). 1Marín, P.A., 2Celis-Diez, J.L., 3González-Acuña, D., 1Cattan, P. E.
1Facultad de Ciencias Veterinarias y Pecuarias, 2Facultad de Ciencias, Universidad de Chile. 3Facultad de Medicina Veterinaria, Universidad de Concepción.

Dromiciops gliroides es un marsupial endémico de los bosques templados de Sudamérica sobre el cual se desconoce gran parte de su biología, ecología y fauna ectoparasitaria. Los parásitos constituyen un indicador importante del estado de sanidad de los individuos y son parte importante de la biodiversidad. Este trabajo constituye la primera prospección de la fauna ectoparasitaria de D. gliroides con el propósito de describir sus especies y analizar la riqueza y abundancia. En bosques nativos de Chiloé se capturaron 67 ejemplares de D. gliroides, a los cuales se les extrajo su fauna ectopasitaria. Un 97% de los ejemplares capturados resultó infestado. La fauna ectoparasitaria de D. gliroides es rica en especies y está constituída por los órdenes Siphonaptera y Acarina. Del total de individuos parasitados, un 77,6% presentan exclusivamente pulgas pertenecientes a las familias Stephanocircidae y Hytricopsyllidae. Un 41,8% a la especie de garrapata Ixodes neuquenensis (Acarina: Ixodoidea) la cual es descrita por primera vez para Chile. Un 56,7% presentó ácaros. Finalmente, un 37,3% presentó monoparasitismo, 27% biparasitismo, 22,3% triparasitismo y un 10,5% cuatriparasitismo.
Se discuten diferencias en la frecuencia de parasitismo según sexo y edad, para evaluar preferencias y relación hospedero-parásito.
Financiamiento CONICYT AT-24050068 & FONDAP-FONDECYT 1501-0001.

 

97. COMPORTAMIENTO DE PUPACIÓN DEL PARASITOIDE DE AFIDOS APHIDIUS ERVI (HALIDAY) Y SUS CONSECUENCIAS EN EL APRENDIZAJE PREIMAGINAL.(Pupation behaviour in the aphid parasitoid Aphidius ervi (Haliday) and its consequences on preimaginal learning) Gutiérrez-Ibáñez C., Villagra C.A. y Niemeyer H.M.
Departamento de Ciencias Ecológicas, Facultad de Ciencias, Universidad de Chile.

El aprendizaje olfativo puede ocurrir en distintas etapas de la ontogenia de los insectos. En avispas parasitoides, se sugiere que ocurre principalmente durante la eclosión, mientras que el aprendizaje preimaginal es todavía controversial.
En algunas avispas de la familia Braconidae, la larva abre un orificio en la parte ventral del exoesqueleto del áfido antes de la pupación, exponiéndose al ambiente externo. En este trabajo, mostramos que esto ocurre en Aphidius ervi Haliday (Hymenoptera: Braconidae), y probamos si avispas adultas reconocen estímulos olfativos presentados durante esta etapa.
Se expusieron larvas a olores de vainilla durante la etapa de apertura. La mitad de estos individuos fueron extraídos de los restos del áfido muerto, la otra mitad completó su desarrollo normalmente. En los controles la vainilla fue reemplazada por agua. La preferencia por vainilla fue probada en parasitoides adultos, en olfatómetros de vidrio en Y.
Parasitoides expuestos a vainilla presentan una mayor respuesta hacia la vainilla que aquellos no expuestos, independiente de si fueron o no extraídos de la momia. Esto es interpretado como evidencia de aprendizaje preimaginal en una avispa parasitoide.

98. ENERGÉTICA Y OSMORREGULACIÓN EN PASERIFORMES: VARIACIÓN GEOGRÁFICA EN Zonotrichia capensis (Energetics and osmoregulation in passeriformes: geographic variation in Zonotrichia capensis) Sabat P, Veloso C, Canals M, Cavieres G. Departamento de Ciencias Ecológicas, Facultad de Ciencias, Universidad de Chile, Casilla 653, Santiago, Chile. psabat@uchile.cl

Los esfuerzos orientados a entender y explicar la diversidad fisiológica se han centrado en estudios entre especies de diferentes ambientes. Sin embargo, escasos estudios se han orientado a estudiar la variabilidad fenotípica intraespecífica. Dentro del marco de un estudio de gradientes ambientales, investigamos la variabilidad fenotípica a nivel poblacional del metabolismo basal y perdida de agua por evaporación, en una especie de ave paseriforme (Zonotrichia capensis) en dos poblaciones (La Serena, Quebrada de la Plata) con diferencias de precipitaciones y temperatura en Chile. La Pérdida total de agua por evaporación (TEWL) fue significativamente mayor en la región semi-arida de La Serena. La TEWL de La Serena fue un 74% del valor esperado para paseriformes de ambientes mésicos y un 101 % del esperado para paseriformes de ambientes secos, mientras que para los capturados en Quebrada de la Plata los valores fueron de un 97% y 133% respectivamente. A su vez el RMR fue un 25% superior en la población de Quebrada de la Plata. Las diferencias en RMR y TEWL entre estas poblaciones sugieren fuertemente la existencia de adaptaciones fisiológicas (microevolución o flexibilidad fisiológica) para minimizar la pérdida de agua y mantener un adecuado balance hídrico. Fondecyt 1050196.

 

99. COMUNIDADES DE MICROARTRÓPODOS DE SUELO EN AMBIENTES ALTOANDINOS: DIFERENCIAS ENTRE PLANTAS EN COJÍN. (Soil microarthropod communities in high Andes: Differences between cushion plants). Concha-Bloomfield, I. & Cavieres, L. A. Grupo de Investigación en Ecología, Biogeografía y Sistemática (ECOBIOSIS), Departamento de Botánica, Universidad de Concepción

Las plantas en cojín generan condiciones microclimáticas muy diferentes a su entorno. Estas condiciones favorecen el establecimiento de otras especies de plantas, pero poco se sabe con respecto a su impacto sobre la fauna edáfica.
Se analizaron las variaciones de riqueza específica de microartrópodos asociados al espacio interior de los cojines de Laretia acaulis (LA) y Azorella monantha (AM). Las muestras fueron recolectadas desde el interior y exterior de los cojines desde enero hasta abril de 2005 en la localidad de Valle Nevado (3200 m.s.n.m.). La fauna edáfica fue extraída desde las muestras mediante el uso de embudos Berlese-Tullgren. Acari, Collembola y Diptera fueron los microartrópodos más representativos del ambiente altoandino con un 83.9%, 9.5% y 4.4%, respectivamente. Si bien Acari fue el grupo dominante al interior de ambos cojines (93.1% AM y 52.5% LA), se observan claras diferencias en la composición específica y de abundancia entre ellos. Prostigmata dominó las muestras de AM (66.6%), mientras que Mesostigmata lo hizo para LA (38.1%). Los individuos representados en los espacios abiertos aportaron solo un 2.5% del total de las muestras, por lo que se demuestra que las plantas en cojín facilitan el establecimiento de las comunidades de microartrópodos.
FONDECYT 1030821

 

100. EFECTO DEL TAMAÑO CORPORAL Y LA DIETA SOBRE LAS CAPACIDADES DIGESTIVAS Y OSMORREGULATORIAS EN PASERIFORMES DE AMBIENTES TERRESTRES. Sepúlveda, M.; Maldonado; K.. González S Y Sabat P.. Departamento de Ciencias Ecológicas, Facultad de Ciencias, Universidad de Chile; maritza.sepulveda@uv.cl.

Aunque el correlato entre la composición de la dieta en aves y la fisiología ha sido analizada ampliamente, son escasos lo estudios que abordan esta problemática en forma integrada. Estudiamos las relaciones alométricas de algunas características de la fisiología digestiva y renal de aves paseriformes. Además se estudió la composición isotópica de nitrógeno y carbono del músculo pectoral y su relación con las variables fisiológicas. La actividad de enzimas digestivas maltasa, y aminopeptidasa-N presentaron una relación alométrica positiva y significativa, mientras que las variables relacionadas con la función renal (osmolardad de orina, fracción ocupada por la médula renal) presentaron una relación negativa con el tamaño corporal. Contrario a lo esperado no se encontraron correlatos entre la composición isotópica, las variables fisiológicas y la dieta de las especies. Se discuten el efecto del tamaño corporal sobre las funciones fisiológicas y las posibles causas de desacoplamiento funcional entre la capacidad digestiva, la composición química de la dieta y la función renales en paseriformes terrestres. Fondecyt 1050196.

 

101. DEFENSAS INDUCIBLES PRE-ENCUENTRO VERSUS POST-ENCUENTRO. ANÁLISIS EN UN SISTEMA RECURSO-CONSUMIDOR. (Pre-encounter versus post-encounter inducible defenses. Analysis in a resource-consumer system). Ramos-Jiliberto, R., Frodden, E., Aránguiz-Acuña, A., Departamento de Ciencias Ecológicas, Facultad de Ciencias, Universidad de Chile, casilla 653, Ñuñoa, Santiago.

En años recientes, estudios experimentales han demostrado que respuestas fenotípicas plásticas de los organismos frente a señales de otros organismos ejercen un efecto importante en el resultado de las interacciones bióticas, a nivel organísmico, poblacional y comunitario. Las defensas inducibles se encuentran en muchos taxa y descansan en diversos mecanismo biológicos, e.g. evasión conductual, desarrollo de estructuras, cambio de forma, etc.
En este trabajo estudiamos los efectos dinámicos de defensas inducibles en un sistema recurso-consumidor. El énfasis está en discriminar, tanto en la modelación como en el análisis, entre defensas del tipo pre-encuentro y del tipo post-encuentro. Al mismo tiempo, analizamos los efectos asociados a dos tipos de trade-off involucrados: reducción en las tasas de alimentación, e incremento en los requerimientos mínimos de mantención poblacional. Nuestros resultados muestran gráficamente diferentes dominios de estabilidad para las 4 combinaciones de tipo de defensa versus tipo de trade-off. En forma laxa, tanto la efectividad de las defensas como la magnitud de los costos ejercen un efecto estabilizador en el sistema, aunque dinámicas complejas aparecen en ciertas regiones del espacio de parámetros. En el sistema bidimensional estudiado, la diferenciación de los trade-off no parece ser importante, pero el tipo de defensa define diferentes resultados dinámicos.
Trabajo financiado por Proyecto Fondecyt 1040821/2004 a RRJ.

 

102. Ciclos térmicos, dieta y patrón de alimentación diario en machos y hembras adultas de Agathemera crassa (Phasmatodea: Pseudophasmatidae). (Thermal cycles, diet and daily feeding pattern in adult males and females of Agathemera crassa (Phasmatodea:Pseudophasmatidae)). Veloso, C. y Díaz, L. Dpto. Cs. Ecológicas, Facultad de Ciencias, Universidad de Chile.

Agathemera crassa es un fásmido herbívoro que habita principalmente sectores de alta montaña sobre los 2.000 m s.n.m., sujetos a fuertes cambios diarios y estacionales de temperatura ambiente. Su sistema digestivo es simple con ausencia de estructuras que aumenten la superficie de absorción o digestión. Los objetivos de este trabajo fueron realizar un análisis dietario y estudiar experimentalmente algunas de las variables digestivas asociadas a ciclos diarios de temperatura ambiente. Se trabajó con machos y hembras adultas, las que fueron aclimatadas por una semana a condiciones de laboratorios. Los análisis de fecas se realizaron los meses de noviembre y abril. Durante el mes de octubre 20 hembras y 20 machos fueron mantenidos en cuatro tratamientos térmicos experimentales durante el ciclo luz:oscuridad: 10°C:10°C; 10°C:20°C; 20°C:10°C; 20°C:20°C. Los análisis de dieta muestran un consumo exclusivo de plantas del género Acaena, A. splendens>>A. pinnatifida=A. alpina y sin diferencias estacionales, ni entre sexos. Los mayores niveles de ingesta y asimilación se observaron en los tratamientos con ciclo de temperatura y el valor más bajo de digestibilidad se observó en el tratamiento 20°C:20°C. Los resultados indican que A. crassa se comporta como un herbívoro especialista, y aparentemente, requiere obligatoriamente de ciclos térmicos diarios para optimizar su actividad digestiva. Proyecto DI I 05/02-2 (Universidad de de Chile).

103. CARNÍVOROS EN PLANTACIONES FORESTALES: ¿UNA OPORTUNIDAD PARA SU CONSERVACIÓN? (Carnivores in plantations: an opportunity for its conservation?). Muñoz, J.L. y Simonetti J.A. Facultad de Ciencias, Universidad de Chile.

Las plantaciones forestales son un factor importante en la transformación del paisaje. La respuesta de los carnívoros ante esta trasformación es fundamental para su sobrevivencia, ya que requieren grandes áreas de bosque nativo para establecer poblaciones viables y son potencialmente más sensibles a la extinción por pérdida su hábitat. En este trabajo estudiamos la distribución de carnívoros en cuatro hábitats diferentes conformados por plantaciones de P. radiata que difieren estructuralmente entre sí: plantaciones con sotobosque (denso-escaso), plantaciones jóvenes y tala rasa. Además evaluamos los atributos de la vegetación y el paisaje relacionados con la abundancia relativa de carnívoros. Mediante estaciones de visita olfativa registramos cinco especies en las plantaciones. De éstas, Oncifelis guigna y Conepatus chinga seleccionaron plantaciones con abundante sotobosque, mientras que Pseudalopex culpaeus seleccionó plantaciones juveniles y tala rasa. La abundancia de O. guigna se relacionó con un mayor porcentaje de bosque nativo circundante y una mayor riqueza arbórea del sotobosque. Medidas de manejo en pos de conservar carnívoros en plantaciones consideran la mantención de los fragmentos de bosque nativo remanentes entre las plantaciones y permitir el desarrollo del sotobosque de modo que las plantaciones actúen temporalmente como hábitat y permitan conectar los fragmentos de bosque nativo.
FIA, PI-C-2003-1-F-051 & Fondecyt 1010852.

 

104. Variación interpoblacional en el tiempo de recuperación después de un coma térmico a lo largo de un gradiente geográfico. (Interpopulational variation in recovery time from chill coma along a geographic gradient). Castañeda, L.E.1, Lardies, M.A.2 y Bozinovic, F.3. 1Universidad Austral de Chile, 2Universidad Santo Tomás y 3Universidad Católica de Chile. 1Beca CONICYT, 2FONDECYT 3040042, 3FONDAP 1501-0001.

Las temperaturas extremas restringen el desempeño de los artrópodos terrestres, y las variaciones en las temperaturas mínimas sobre una escala latitudinal afectan a las variables fisiológicas. El tiempo de recuperación desde un coma térmico es una medida de la tolerancia térmica y un excelente índice de adaptación climática. Examinamos las diferencias en el tiempo de recuperación del isópodo terrestre, Porcellio laevis, expuesto a diferentes condiciones térmicas. Individuos de cuatro poblaciones fueron muestreados a lo largo de Chile, abarcando un rango latitudinal de aproximadamente 10 grados. Diferencias significativas fueron encontradas en el tiempo de recuperación entre temperaturas experimentales y entre poblaciones, pero no hubo interacción entre ambos factores. El tiempo de recuperación en P. laevis mostró un incremento con la temperatura mínima anual, indicando la existencia de una variación geográfica en este rasgo. Por otra parte, la masa corporal también presentó variación interpoblacional, sin embargo ésta no estuvo asociada a alguna variable climática o a la latitud. En resumen, nuestros resultados concuerdan con resultados previos en donde el tiempo de recuperación disminuye hacia altas latitudes, siendo esta respuesta independiente del taxa, continente y hemisferio.

105. ENERGÉTICA ESTÁNDAR DEL CISNE DE CUELLO NEGRO (Cygnus melancoryphus). (Standard Energetics of the Black-Necked Swan (Cygnus Melancoryphus)). Norambuena, MC,1,2 y Bozinovic, F1,3. 1Centro de Estudios Avanzados en Ecología y Biodiversidad y 2Departamento de Ciencias Animales, Facultad de Agronomía e Ingeniería Forestal, Pontificia Universidad Católica de Chile, Santiago, Chile 3Departamento de Ecología, Facultad de Ciencias Biológicas, Pontificia Universidad Católica de Chile, Santiago, Chile.

RESUMEN.- Estudiamos la energética estándar del cisne de cuello negro (Cygnus melancoryphus) de ambientes temperados del sur de Sudamérica. Se midió el consumo de oxígeno (VO2) en un rango de temperaturas de -3 a 20.1 ºC. Calculamos la tasa metabólica basal (BMR), la conductancia térmica mínima (Cm) y medimos la temperatura corporal. El BMR promedio fue superior al valor esperado de acuerdo a ecuaciones alométricas y Cm resultó equivalente a los valores predichos de acuerdo a su masa corporal. Los valores masa-independiente estándar de Cm acoplados a valores masas-independientes de BMR altos contribuyen a una alta capacidad termorregulatoria permitiendo la conservación de calor. En C. melancoryphus la razón BMR/C fue 29.4°C que representa un 115% del valor esperado. La capacidad termorregulatoria alta del cisne de cuello negro explicaría porque esta especie es capaza de colonizar regiones frías del sur de Sudamérica
Agradecimientos. FONDAP 1501-0001 (Program 1), Beca MECESUP Ph.D y Buin ZOO.

 

106. EFECTOS DE LA FRAGMENTACIÓN Y PÉRDIDA DE HÁBITAT SOBRE LA DENSIDAD DE COLEÓPTEROS AFIDÓFAGOS DE FOLLAJE Y SUELO (Effects of habitat loss and fragmentation on the density of foliage and ground dwelling aphidophagous beetles). Grez, A.A.1, T. Zaviezo2, S. Díaz1 & B. Camousseigt1. 1 Fac. Ciencias Veterinarias, Universidad de Chile, 2 Fac. Agronomía e Ingería Forestal, P. Universidad Católica de Chile.

La fragmentación y pérdida de hábitat afectan principalmente a los grupos tróficos superiores, como los depredadores. La pérdida generalmente tiene efectos negativos sobre la biota, pero la fragmentación puede tener efectos positivos, incrementando la densidad poblacional en paisajes más fragmentados. Ambas variables generalmente se han confundido en la literatura. Evaluamos experimentalmente cómo la fragmentación y pérdida de hábitat en parches de alfalfa afectan la abundancia de depredadores que habitan en el follaje (coccinélidos) y en el suelo (carábidos), en verano y otoño. Se generaron 20 paisajes de 30 x 30 m de alfalfa continua, distribuidos en 5 bloques. Se removió alfalfa, dejando en cada bloque un paisaje control (sin fragmentación ni pérdida), un paisaje con 4 fragmentos y 55% pérdida, uno con 4 fragmentos y 84% pérdida y uno con 16 fragmentos y 84% pérdida. Si bien la abundancia total de coccinélidos en general no varió entre paisajes, algunas especies incrementaron su densidad en los paisajes más fragmentados y con mayor pérdida, al igual que los carábidos. La estructura del paisaje puede modificar la probabilidad de encuentro entre ambos tipos de depredadores, modificando las interaciones intra-gremio.
FONDECYT 1011041, Proyecto Enlace ENL 05/2

 

107. DIETA DEL CONEJO EUROPEO (Oryctolagus cuniculus) EN CHILE CENTRAL (Diet of European rabbit (Oryctolagus cuniculus)in central Chile) Vargas, SP & Jaksic, FM. Pontificia Universidad Católica de Chile
Patrocinio: Fabián Jaksic

El conejo europeo (Oryctolagus cuniculus) es considerado una de las especies invasoras que más perjuicios causan a los ecosistemas de Chile central, principalmente a su vegetación. Pese a ello, poco se sabe en cuanto a su ecología y menos se conoce acerca de su dieta. Este aspecto resulta relevante ya que la disponibilidad de recursos dietarios que encuentre en el nuevo hábitat podría determinar el éxito de su establecimiento. Este estudio propone determinar si el hábito trófico del conejo corresponde al de un herbívoro oportunista, un atributo usualmente asociado en forma cualitativa a la invasividad. El estudio está siendo realizado en Estación de Investigaciones Ecológicas Mediterránea (EDIEM), Región Metropolitana. Para conocer la dieta del conejo durante la temporada de invierno (2005), se colectaron sus fecas al mismo tiempo de determinar la abundancia de las especies de hierbas. En la actualidad, nos encontramos realizando el análisis microhistológico con el objeto de determinar las plantas presentes en las fecas de conejo. Dado que los muestreos de hierbas indican una abundancia relativa de Geranuim robertianum (40.2%), Bromus berterinus (46.5%) y Pectocaria linearis (31.9%), esperamos poner a prueba cuantitativamente la hipótesis propuesta encontrando una representación similar de estas especies en la dieta del conejo.

 

108. Evaluación experimental de Monitoreo social de compañeros de grupo por parte del roedor Octodon degus durante el forrajeo. (Experimental assessment of social monitoring of group mates by Octodon degus during foraging) Quirici, V., R. Castro & L.A. Ebensperger. Centro de Estudios Avanzados en Ecología & Biodiversidad y Departamento de Ecología, P. Universidad Católica de Chile. FONDECYT 1020861.

Es frecuente que aves y mamíferos que forrajean socialmente disminuyen el tiempo individual destinado a vigilancia (i.e., efecto "tamaño de grupo"). Como consecuencia, cada individuo puede destinar este ahorro de tiempo a actividades que proporcionan beneficios directos tales como obtención de alimento. Por lo tanto, se asume que existe una dicotomía entre forrajeo y vigilancia: individuos que forrajean no son capaces de permanecer alerta. Sin embargo, estudios recientes en aves han mostrado que individuos en actitud de forrajeo también son capaces de percibir la aproximación de objetos, depredadores simulados, o la presencia de compañeros de grupo. En este estudio examinamos si esta capacidad de algunas aves puede ser extrapolada a mamíferos. Para ello, evaluamos el efecto de restricciones ambientales al campo visual de individuos del roedor Octodon degus forrajeando en parejas. En un primer tratamiento, registramos el comportamiento de vigilancia de pares de individuos en terrarios con un divisor opaco que obstaculizó totalmente la capacidad de ambos para visualizar al compañero, y lo comparamos con el comportamiento de los mismos individuos en presencia de un divisor que solo dificultó parcialmente la visión del compañero cuando el individuo se encontraba forrajeando (i.e., animal con el cuerpo recogido y la cabeza dirigida hacia el horizonte o hacia abajo). Un tercer tratamiento control consistió en registrar el comportamiento de los individuos en presencia de un divisor transparente. Los resultados preliminares revelan que degus cuyo campo visual es obstaculizado parcialmente forrajearon con el cuerpo erguido y la cabeza levantada por sobre el horizonte. Esta postura de "forrajeo erguido" permitiría a los individuos mantener contacto visual con el compañero cuando el campo visual es obstruido parcialmente. Más importante, los resultados sugieren que en mamíferos los individuos también son capaces de monitorear su entorno durante el forrajeo, y que ambas actividades no son mutuamente excluyentes, necesariamente.

 

109. ESTUDIO COMPARATIVO ENTRE LA ESTRUCTURA COMUNITARIA DE MICROMAMÍFEROS EN UN BOSQUE NATIVO Y UN AGROECOSISTEMA FORESTAL DE CHILE CENTRAL. (Comparative study between the community structure of small mammals in the native forest and an agroecosystem in Central Chile). García, K. & J.C. Ortiz. Departamento de Zoología. Facultad de Ciencias Naturales y Oceanográficas. Universidad de Concepción

Se estudió la diversidad y abundancia de micromamíferos en un bosque nativo siempreverde y en un agroecosistema forestal de Pinus radiata. Ochenta trampas Sherman se colocaron a ras de suelo y 40 trampas a 1.5 m. de altura en cada ecosistema. En la plantación se registraron: Abrothrix longipilis, A. olivaceus y Rattus rattus y en el bosque: A. longipilis, A. olivaceus, Mus musculus y Oligoryzomys longicaudatus. En ninguno de los dos ecosistemas se recolectaron marsupiales. Las abundancias relativas mostraron diferencias significativas para cada hábitat. El ecosistema nativo dominó A. olivaceus y en el agroecosistema A. longipilis. El bosque presentó los valores más altos de diversidad, riqueza y equidad de especies. Sin embargo, no se registraron diferencias estadísticas con la plantación. La diversidad y abundancias registradas concuerdan con lo documentado para la región en ambientes similares. Las trampas con y sin éxito de captura no mostraron diferencias significativas entre sitios, así como tampoco entre la vegetación y las especies a pesar que el bosque presentaba mayor riqueza de arbustos. En general, estos resultados indican que los individuos capturados ocuparon indistintamente sitios de bosque como plantación, de acuerdo a los parámetros vegetacionales cuantificados.
Agradecimientos: Forestal Mininco S.A.

 

110. EFECTOS MATERNOS AMBIENTALES EN FISIOLOGÍA: MADRES DE MAYOR TAMAÑO CORPORAL PRODUCEN DESCENDENCIA CON MAYOR DESEMPEÑO A LARGO PLAZO PERO CON MENOR TOLERANCIA TÉRMICA (Environmental maternal effects in physiology: bigger mothers produce offspring with higher long-term performance but with lower thermal tolerance) Carter3 M. J, Leonardo D. Bacigalupe1, Monserrat Araya2,Tamara P. Catalán2, Marco A. Lardies4 & Francisco Bozinovic2
1
Department of Animal and Plant Sciences, University of Sheffield, UK 2Center for Advanced Studies in Ecology & Biodiversity, Universidad Católica de Chile, Chile 3Departamento de Ciencias Ecológicas, Universidad de Chile, Chile 4Departamento de Ciencias Básicas, Universidad Santo Tomás, Chile

El fenotipo de un individuo es considerado el resultado de la interacción entre sus genes y el ambiente que experimenta durante su desarrollo. Las madres contribuyen al parecido de su progenie no solo con la mitad del material genético, sino también con el ambiente que otorgan. En este contexto el objetivo de este estudio es examinar las consecuencias de la variación natural de la masa de las madres sobre el desempeño térmico de su progenie en el isópodo terrestre Porcellio laevis y examinar la integración fenotípica en rasgos del desempeño relacionados con la fisiología térmica. Nuestros resultados muestran: una asociación positiva entre la masa de las madres con el gasto de energía a largo plazo y el coma térmico y una asociación negativa entre el metabolismo y el coma térmico. En general los efectos maternos juegan un importante rol en determinar el desempeño térmico de P. laevis, lo que puede ser de gran valor en el hábitat estacional donde este habita.
FONDAP1501-001, FONDECYT 3040042

 

111. DISCRIMINACIÓN OLFATIVA Y RECONOCIMIENTO DE PARENTESCO EN EL ROEDOR SOCIAL Octodon degus. (Olfactory discrimination and kin recognition in the social rodent Octodon degus). C.P. Villavicencio, N. Márquez & R.A. Vásquez. Departamento de Ciencias Ecológicas, Facultad de Ciencias, Universidad de Chile

A partir del desarrollo de la teoría de selección de parentesco han surgido numerosos estudios sobre los mecanismos que subyacen al reconocimiento de parentesco. En roedores, se ha reportado que las señales olfativas juegan un papel central en este proceso. Por otro lado, si individuos genéticamente emparentados producen olores semejantes, es posible que conespecíficos discriminen diferencialmente entre individuos con distinto grado de parentesco genético. En este trabajo estudiamos la discriminación olfativa en el roedor social Octodon degus. Utilizamos el método de habituación para determinar si O. degus es capaz de distinguir a individuos con distinto grado de parentesco(coeficientes de parentesco: r=0,5 y r=0), mediante señales olfativas. Se cuantificaron conductas de investigación, frente a odorantes obtenidos de diferentes fuentes corporales (boca, lomo, zona ano-genital y orina). Los resultados indican que este roedor puede discriminar entre individuos que no están emparentados (r=0), pero no puede distinguir individuos con alto grado de parentesco (r=0,5). Esto sugiere que individuos emparentados tienen composiciones de odorantes más similares entre sí que individuos no emparentados. La capacidad de discriminar estas diferencias en las señales olfativas puede ser relevante en los mecanismos de reconocimiento de parentesco en O. degus.
Financiamiento: FONDECYT 1020550, P02-051-FICM, Beca MECESUP UCO0214

112. VARIACIÓN DE LA FORMA DEL CRÁNEO EN OCTODON DEGUS Y SPALACOPUS CYANUS: ANÁLISIS PRELIMINAR DE MORFOMETRÍA GEOMÉTRICA. (Skull shape variation of Octodon degus and Spalacopus cyanus: Preliminary analysis by Geometric Morphometrics). Ahumada P. 1, Velásquez N. 1, Cortés N. 1, Manríquez G.2
1
Programa de Fisiología y Biofísica, Facultad de Medicina, Universidad de Chile. 2Programa de Genética Humana, Facultad de Medicina, Universidad de Chile.

La Morfometría Geométrica (MG) estudia la covariación de la forma de los objetos biológicos con las variables que la afectan, removiendo las diferencias debidas a tamaño, rotación y traslación; usando hitos de coordenadas 2D y 3D como datos primarios y obteniendo un estimador del tamaño independiente de los estimadores de la forma. En el presente trabajo, se estudió la variación de los componentes de la forma del craneo en O. degus y S. cyanus para 9 y 8 hitos homólogos en vista dorsal y lateral, respectivamente. En vista lateral, la regresión multivariada interespecífica mostró un efecto significativo del tamaño del centroide y el largo del cráneo sobre los componentes de la forma (uniforme y no uniforme). En vista dorsal, este análisis mostró un efecto significativo solamente del largo del cráneo para ambos componentes de la forma. Las mayores deformaciones se explicaron por la variación vectorial de hitos anatómicos en la región rostral, principalmente en el arco zigomático. El análisis de ordenamiento de Relative Warps confirmó la robustez del enfoque de la MG para distinguir inequívocamente unidades taxonómicas (RW1 + RW2 = 73, 79 % y 75, 24 % del total de la varianza en vistas lateral y dorsal, respectivamente). Agradecimientos: José Yánez (MNHN), FONDECYT Nº: 10203

 

ECOLOGÍA ACUÁTICA

113. RESPUESTAS DEMOGRÁFICAS A LA TEMPERATURA DE CLADÓCEROS COEXISTENTES: UN EXPERIMENTO DE RESPUESTA DE TABLA DE VIDA. Rodrigo Ramos-Jiliberto y Aránguiz-Acuña, A.

El zooplancton de agua dulce es a menudo expuesto a severos cambios de condiciones bióticas y abióticas que definen su desempeño individual y poblacional. El objetivo de este estudio es indagar los efectos de la temperatura en la demografía de la fauna cladócera de un lago templado en la zona central de Chile (El Plateado). Se utilizó un acercamiento de experimento de respuesta de tabla de vida (LTRE) para estimar las respuestas demográficas de cuatro especies Daphnia ambigua, Ceriodaphnia dubia, Diaphanosoma chilensis y Moina micrura cultivadas bajo diferentes temperaturas constantes cubriendo su rango ambiental. Para ello, a partir de tablas de vida individuales se estimaron matrices poblacionales edad-estructuradas, que posteriormente fueron reducidas a matrices de dos estados que permiten explicitar el parámetro de edad a la primera reprpoducción, junto a los de sobrevivencia juvenil, sobrevivencia adulta y fertilidad promedio. Para estos parámetros se calculó sus contribuciones sobre la tasa de crecimiento poblacional. Se estimaron intervalos de confianza para cada contribución mediante un re-muestreo bootstrap.
Nuestros resultados sugieren que, en general para las cuatro especies estudiadas, cuando la temperatura disminuye, la consecuente disminución dela crecimiento poblacional es fundamentalmente dirigida por un retraso en la edad de primera madurez y secundariamente por fertilidades reducidas. Estos efectos no son compensados por la leve contribución positiva de una alta sobrevivencia adulta, mientras que la sobrevivencia juvenil no representa ninguna contribución positiva a los cambios en crecimiento.

 

114. EVENTOS RECURRENTES DE FLORACIONES ALGALES NOCIVAS (FANs) EN EL MAR INTERIOR DE CHILOÉ: IMPORTANCIA DE NUTRIENTES DISUELTOS NITROGENADOS (Recurrent events of harmful algae blooms (habs) in the interior sea of Chiloé: the significance of dissolved nitrogen nutrients) Iriarte, J.L.1, Rodríguez, C.2, Uribe, C.3, Rivas, C.1, Leal, C.1, Arismendi, I.1, González, H.4, Quiñones, R.5, González, R. 5
1
Núcleo Milenio FORECOS, Instituto de Acuicultura, Universidad Austral de Chile, Puerto Montt. 2Mariscope, Puerto Montt. 3Multiexport, Puerto Montt. 4COPAS, Instituto de Biología Marina, Universidad Austral de Chile, Valdivia. 5COPAS, Departamento Oceanografía, Universidad de Concepción, Concepción
Patrocinio: Sandra Marín

Los nutrientes inorgánicos en la región sur-austral de Chile revelan una razón baja de NO3:PO4 ª 7, lo cual sugiere que el ensamble fitoplanctónico agota el nitrato antes que el ortofosfato en la columna de agua. Las fuentes de nitrógeno orgánico e inorgánico pueden ser importantes para la dinámica de poblaciones algales que desarrollan floraciones nocivas en esta extensa región. Durante una floración algal de Gymnodinium chlorophorum se observó una estrecha correlación entre la concentración de clorofila a y actividad enzimática de glutamina sintetasa sugiriendo que ciertas especies de dinoflagelados prefieren formas de nitrógeno reducido (amonio y urea) en comparación a nitrato o nitrito. La concentración de amonio en centros de cultivo de salmones no tuvo efecto significativo en la composición de especies y abundancia del fitoplancton. La relación entre las FANs y compuestos nitrogenados tendría implicancias biogeoquímicas en la razón carbono:nitrógeno que llega al sedimento post-floración algal en costas templadas.
Financiado parcialmente por FONDECYT

115. VARIACIÓN TEMPORAL EN LA ABUNDANCIA DE DOS ESPECIES DE DECÁPODOS BRAQUIUROS: IMPORTANCIA RELATIVA DE LA DEPREDACIÓN (Temporal variation in the abundance of two brachiuran decapod species: Relative importance of predation) Díaz, A.1 & Palma A.T.2,3
1
Departamento de Ciencias Ecológicas, Facultad de Ciencias, Universidad de Chile. Las Palmeras 357, Casilla 653 Santiago. 2Departamento de Ecología Pontificia Universidad Católica de Chile. Casilla 114-D. Santiago, Chile. 3Center for Advanced Studies in Ecology and Biodiversity, P. Universidad Católica de Chile

El periodo luego de ocurrido el asentamiento es considerado critico para decápodos braquiuros, debido principalmente a las importantes reducciones que presentan sus abundancias. Ante esto, la depredación (intra e interespecífica) es considerada una de las principales responsables de estas reducciones. En el submareal somero de la Península de Hualpén (Concepción) son comunes las especies Cancer setosus y Paraxanthus barbiger, quienes presentan una curva de sobrevivencia tipo III. Este patrón motiva la interrogante acerca del tipo de depredación que esta involucrada. A través de experimentos en laboratorio se estudio el efecto de la densidad, asimetría en tamaño y disponibilidad de sustrato como mediadores de la interacción entre y dentro de ambas especies. Nuestros resultados indican que el canibalismo ocurre solo entre individuos de C. setosus, especie que además se presenta como un importante depredador de pequeños individuos de P. barbiger, sugiriendo que la depredación puede explicar las variaciones estacionales de ambas especies en terreno.
Agradecimientos: Fondecyt 1020499 y CASEB.

 

116. REGISTRO DE LOS ENSAMBLES DIATOMOLÓGICOS PRESENTES EN EL LAGO LAJA DURANTE LOS ÚLTIMOS 2.000 AÑOS (Diatom assemblages record in laja lake during the last 2000 years) Cruces, F.1, Urrutia, R.2, Parra, O.2, Araneda, A.2 & Torres, L 1
1
Departamento de Botánica, Universidad de Concepción. 2Centro EULA-Chile, Universidad de Concepción.

Se realizó una reconstrucción de los ensambles diatomológicos sedimentarios del Lago Laja, para establecer si la comunidad de diatomeas ha reflejado las variaciones ambientales en el lago. Éstas se registraron por cambios en las características texturales del sedimento que se depositó a través del tiempo. La edad de las capas de sedimento fue establecida a través de la actividad de los radioisótopos 210Pb para el último siglo, y 14C para el período más antiguo. El núcleo de sedimento fue caracterizado de acuerdo a su composición granulométrica y se le determinó el contenido de materia orgánica. La identificación de las diatomeas se llevó a cabo a través de microscopía fotónica y electrónica. Los resultados indican que la flora diatomológica del Lago Laja ha presentado cambios en su composición y abundancia, asociados principalmente a los estratos con depósitos de arena. Las características sedimentológicas de estos estratos reflejarían las modificaciones ambientales producidas en el sistema lacustre como consecuencia de la actividad volcánica en la cuenca. Por otra parte, se determinó un aumento de las diatomeas planctónicas y de la materia orgánica en los estratos más recientes, lo que indicaría un aumento de la productividad del sistema hacia la actualidad.
Agradecimientos: Beca Doctoral CONICYT, DIUC N° 204.310.039-1.0 y 203.310.035-1.

117. VARIACIÓN LATITUDINAL EN LA TASA METABÓLICA ACUÁTICA Y AÉREA DEL CANGREJO INTERMAREAL CYCLOGRAPSUS CINEREUS. (Latitudinal variation in the aquatic and aerial metabolic rate of the intertidal crab Cyclograpsus cinereus). Muñoz, J.L.P.(1); Lardies, M.A. (2)Paschke, K.(3) & Bozinovic, F.(1). (1)Center for Advanced Studies in Ecology & Biodiversity P. Universidad Católica de Chile. (2)Universidad Santo Tomas, (3)Universidad Austral de Chile.

Los organismos que habitan ambientes fluctuantes, como los intermareales, están sujetos a variaciones en pequeñas escalas espacio-temporales. A escalas geográficas, las variaciones en factores como la temperatura, generan efectos sobre procesos fisiológicos y bioquímicos. El objetivo del presente estudio fue estudiar como los organismos responden diferencialmente ante estas variaciones. Utilizamos como modelo de estudio la especie Cyclograpsus cinereus (Decapoda, Grapsidae), que habita el supramareal rocoso (gran parte del día sometida a condiciones terrestres) y presenta amplia distribución en la costa de Chile. Se recolectaron individuos de cuatro poblaciones: Coquimbo, El Tabo, Valdivia y Puerto Montt y se les midió la tasa metabólica en agua y aire. Esta especie es semi-terrestre, presentando metabolismo tanto aéreo como acuático. Se encontraron diferencias entre las poblaciones, siendo las del sur las que poseen menor metabolismo acuático. Los individuos presentaron diferencias en metabolismo aéreo, con una mayor tasa en la población de baja latitud. Concluimos que los organismos son capaces de responder a condiciones terrestres presentando metabolismo aéreo alto en función de la exposición a condiciones terrestres en el intermareal.
FONDAP 1501-0001 (Programa 1), FONDECYT 3040042

 

118. UNA SERIE DE TIEMPO DE LA VARIABILIDAD EN LA PRODUCCIÓN SECUNDARIA DE ARQUEA EN LA ZONA DE MÍNIMO DE OXÍGENO FRENTE A CONCEPCIÓN. Levipan1,3 H. A., Quiñones1, 2 R. A. y Urrutia3 H.
1Centro de Investigación Oceanográfica en el Pacífico Sur-Oriental (COPAS), 2Departamento de Oceanografía, Facultad de Ciencias Naturales y Oceanográficas, 3Departamento de Microbiología, Facultad de Ciencias Biológicas. Universidad de Concepción, Chile

Los últimos avances en el campo de la ecología microbiana han revelado que las arqueas planctónicas representan unos de los tipos celulares más conspicuos de los océanos. Sin embargo, a pesar de la abundancia numérica de este grupo en los ecosistemas marinos su rol biogeoquímico es desconocido. La imposibilidad, a la fecha, de diferenciar los procesos metabólicos de arqueas del resto de los microorganismos in situ dentro de una comunidad procarionte, ha dificultado la estimación de procesos clave como la producción secundaria de Arquea (PSA). Este trabajo presenta la variabilidad temporal de determinaciones empíricas de PSA en la zona de mínimo de oxígeno (ZMO) frente a Coliumo. Se encontró que, mediante hibridación por dot blot de ARNr 16S, Arquea representó un grupo importante del bacterioplancton con aportes normalmente comprendidos entre 40-60% y que fueron disminuyendo hacia la superficie. Por otra parte, la PSA in situ determinada mediante incorporación de leucina-C14, osciló desde no detectable hasta un máximo ~910 mg C m-3 hora-1. Finalmente, las arqueas pudieron llegar a ser tanto o más activas que su contraparte bacteriana representando, en determinados periodos, una importante fracción de la producción procarionte total (i.e. ~97%).

 

119. IDENTIFICACIÓN TAXONÓMICA Y ESTRUCTURA GENÉTICA DE Codium EN CHILE (Taxonomy identification and genetic structure in Codium from Chile) A.V. González1,2, MTK Arroyo1 y B. Santelices 2

(1)Departamento de Biología, Facultad de Ciencias, Universidad de Chile (2)Departamento de Ecología, Facultad de Ciencias Biológicas, Pontificia Universidad Católica de Chile)

Codium dimorphum es un alga dominante en los niveles intermareales bajos de Chile. Sin embargo, su identificación taxonómica es aún poco clara ya que, basados en sutiles diferencias morfológicas, se han descrito para Chile otras cinco especies del subgénero Tylecodium. Con el objetivo de esclarecer la identidad taxonómica del grupo, se compararon secuencias del gen rbcL de 10 localidades a lo largo de Chile. Además, éstas fueron comparadas con secuencias de otras especies congenéricas depositadas en el Genebank, estimándose relaciones filogenéticas y divergencia genética a nivel intra e interespecífico. Para el análisis se utilizó Parsimonia, Neighbor-Joining y likelihood. Todos ellos entregaron la misma topología, agrupándose en un clado los ejemplares chilenos, con divergencia genética entre 3,5-10% del resto de sus congenéricas. La existencia de solo una especie de Codium a nivel nacional, nos llevó al segundo objetivo que fue estimar los patrones genéticos a lo largo de la costa chilena. Para ello se utilizaron marcadores poblacionales (gen cloroplastidial Trn-Gly) en las muestras chilenas. Este último análisis reveló que existe un haplotipo común y dominante a lo largo de Chile. Que la mayor diversidad haplotipica se encontró en la zona norte, y Punta Arenas es la zona que presentó mayor divergencia genética.
Financiamiento: Conicyt Beca AT-4040047

 

120. DISTRIBUCIÓN DE ENSAMBLES DE DIATOMEAS EN LOS SEDIMENTOS SUPERFICIALES DE DIEZ LAGOS ANDINOS CHILENOS (Distribution of diatom assemblages in the surface sediments of ten Andean Chilean lakes) Alvial I., F. Cruces, A. Araneda, O. Parra & R. Urrutia
Centro Eula, Universidad de Concepción.
Patrocinio: Oscar Parra B.

Uno de los indicadores biológicos más utilizados en estudios paleoambientales son las diatomeas. Estas microalgas han sido aplicadas, principalmente en el Hemisferio Norte, para inferir cambios en el estado trófico, en las condiciones de acidez y salinidad de diferentes cuerpos lacustres. Sin embargo, la utilización de estas microalgas en Chile es bastante incipiente, debido a que falta información ecológica de las especies presentes en nuestro país.
Dado lo anterior, esta investigación tuvo por finalidad estudiar las diatomeas presentes en los sedimentos de 10 lagos andinos y relacionar su distribución con las características físicas y químicas del medio.
Para ello, se extrajeron columnas sedimentarias desde el fondo de cada lago y se separó el centímetro superficial. De cada muestra, se pesó 0,1 g de sedimento, los que fueron oxidados para obtener las valvas de diatomeas. En el análisis de los taxa, solo fueron incluidos aquellos que registraron una abundancia relativa superior al 1%. Por otro lado, se recopilaron datos físicos y químicos de la estación estival para cada sistema en estudio.
Se contó un total de 77 taxa de diatomeas en los sedimentos superficiales de los 10 lagos estudiados; su distribución en los lagos, fue analizada en un análisis de Cluster. Como resultado de ello, se formaron tres grupos de lagos con similar componente diatomológico. Los lagos agrupados, comparten condiciones físicas y químicas particulares, lo que quedó demostrado al realizar un análisis de componentes principales. Entre las variables que estarían determinando la distribución de los taxa en los lagos andinos estudiados, se encuentran la altitud y el pH.
Este trabajo, se enmarca dentro de un estudio ecológico inicial de la flora diatomológica en lagos chilenos, que está desarrollando nuestro grupo de investigación.
Esta investigación fue realizada gracias al aporte de los proyectos Diuc nº 204.310.039-1.0 y 203.310.035-1.0.

 

121. DINÁMICAS DE RECLUTAMIENTO DE LARVAS DE INVERTEBRADOS INTERMAREALES EN LA COSTA OESTE DE NORTEAMÉRICA Y EL ROL DE LOS PROCESOS OCEANOGRÁFICOS. Broitman B., R Steven D. GainesCarol A. Blanchette, Bruce A. Menge
Marine Science Institute, University of California, Santa Barbara: Santa Barbara, California 93106

La variabilidad espacial y temporal en la llegada de larvas a la costa juega un papel determinante en las dinamicas de las poblaciones adultas. Estos patrones de variabilidad se encuentran determinados en gran parte por los procesos oceanográficos predominantes en la region de estudio.
Utilizando series de tiempo de reclutamiento de larvas al intermareal rocoso a lo largo de mas de 2000 km. de costa de tanto en Oregon como en el centro y el sur de California, estudiamos como los procesos oceanográficos predominantes influencian las tasas de reclutamiento. Las series de tiempo de reclutamiento larval permiten distinguir un marcado patrón espacial y temporal. En el espacio, existe un marca patrón geográfico con mayor reclutamiento en Oregon y marcadas diferencias dentro de las regiones. En el timpo, las larvas de mitílidos exhiben un fuerte ciclo anual, un patrón que es mucho menos marcado en el caso de los cirripedios chthamalidos. Al examinar la correlación cruzada entre las series de tiempo de reclutamiento y sus respectivas series de tiempo de temperatura supeficial del mar se observan marcadas diferencias tanto entre especies, como entre regiones. Estos resultados contrastan con resultados anteriores obtenidos en regiones individuales y sugieren que los procesos oceanográficos que determinan la llegada de larvas a la costa varían entre regiones.
Estos resultados tienen profundas implicaciones para la planificación de futuras reservas marinas y otras estrategias de manejo costero.

PANELES II

MICROBIOLOGÍA BÁSICA

1. CARACTERIZACIÓN MOLECULAR DE ISLOTES DE PATOGENICIDAD EN CEPAS CLÍNICAS Y AMBIENTALES DE VIBRIO parahaemolyticus. Guerra Opazo F. y Osorio Carlos G. (ICBM, Facultad de Medicina, Universidad de Chile)

Vibrio parahaemolyticus es una bacteria Gram negativa, mótil, halofílica, oxidasa positiva y habita normalmente en ambientes marinos. Clínicamente produce un cuadro de gastroenteritis aguda autolimitado en personas que consumen mariscos y pescados crudos o mal cocidos. Desde 1996, este microorganismo se ha expandido a nivel mundial evidenciándose que las cepas involucradas (principalmente del serotipo O3: K6) presentan un alto grado de similitud genética, conformando por tanto el denominado complejo clonal. En Chile, desde el primer brote epidémico que ocurrió en 1997 hasta el gran brote ocurrido en el verano de 2005, se ha observado un aumento gradual y dramático de casos de gastroenteritis provocados por este vibrión.
El genoma de la cepa clonal RIMD 2210633 fue secuenciado recientemente y se ha determinado que presenta una región denominada isla de patogenicidad (IP) en uno de sus cromosoides (cromosoide 2). En la IP descrita, se encuentra el factor de virulencia más estudiado del vibrión parahemolítico, denominado hemolisina directa termoestable (Tdh). A la fecha, no se han estudiado otras cepas de V. parahaemolyticus, en cuanto a la presencia o ausencia de la IP en sus respectivos genomas. En general, las cepas clínicas aisladas son fenotípicamente Tdh positivas. Este hecho sugiere que la IP está presente en dichas cepas, pues como se mencionó anteriormente el gen tdh esta normalmente dentro de la IP. Sin embargo, también es posible que si el gen tdh es un elemento movible, éste se localice en un lugar diferente del genoma. Por otra parte, existe la posibilidad que las cepas ambientales que normalmente presentan un fenotipo Tdh negativo, hayan perdido su IP por deleción completa o que solo hayan perdido el gen tdh.
El objetivo de este trabajo fue caracterizar cepas clínicas y ambientales de V. parahaemolyticus chilenas, en cuanto a la ausencia y/o presencia completa o parcial de la IP en ellas. Pudimos demostrar que cerca del 70% de las cepas ambientales en estudio presentaban una deleción completa de la IP, en cambio, la gran mayoría de las cepas clínicas poseían una IP idéntica a la cepa utilizada como patrón (RIMD 2210633). Además pudimos evidenciar que una cepa denominada RIMD 2210086, aislada en 1968 en Japón, ya poseía la IP completa. Este descubrimiento nos hace hipotetizar que la virulencia de la cepa pandémica no dependería de la presencia de la IP per se, sino que más bien de factores externos a la IP.

 

2. EVALUACIÓN DE UN POSIBLE MECANISMO DE ACCIÓN ANTIMICROBIANA PARA HDL DE CARPA. (Evaluation of a possible mechanism for the antimicrobial activity of carp HDL). Alvarez, C., Villanueva J., López R., Concha M. I., y Amthauer R. Instituto de Bioquímica, Facultad de Ciencias, Universidad Austral de Chile, Valdivia, Chile.

Recientemente, nuestro laboratorio ha descrito que tanto HDL como sus apolipoproteína A-I y A-II (apoA-I, apo A-II) aisladas de Cyprinus carpio y Oncorynchus mykiss, presentan actividad antimicrobiana contra bacterias gram negativas y positivas. Para esta función se postula como fundamental la interacción de apoA-I y apoA-II con membranas. En concordancia con los descrito para otras proteínas y péptidos con actividad antimicrobiana, apoA-I de distintas especies, en particular, muestran extensas regiones de a-hélices anfipáticas. Nuestros estudios demuestran que apoA I se asocia con membranas tanto de eucariontes como procariontes. Por otra parte ensayos de solubilización de vesículas de dimiristoilfosfatidil colina indican que apoA-I interacciona directamente con la bicapa lipídica, al menos en este sistema. Para estudiar si la actividad microbiana se debe a una permeabilización de la membrana bacteriana se realizaron ensayos incubando E. coli con distintas concentraciones de HDL en presencia de ioduro de propidio como indicador de permeabilidad. Bajo distintas condiciones de ensayo no se detectó un aumento significativo en la fluorescencia, comparado con bacterias permeabilizadas con Triton X-100. Estos resultados sugieren que el mecanismo de acción antimicrobiano de esta liporproteína sería distinto al clásicamente descrito para péptidos con estas características estructurales que en general involucra una permeabilización de la membrana.
DID-UACh S-200530.

 

3. Trypanosoma cruzi CALCINEURINA: INUSUAL INTERACCIÓN DE CICLOFILINA-CICLOSPORINAA (CYP-CSA). Sossa P.1, Orrego P.1, Romero P.1, Neira I.1, Sagua. H.1, González J.1 y Araya JE1*
1
Unidad de Parasitología. Universidad de Antofagasata-Chile. *jearayar@uantof.cl

Ciclosporina A (CsA) fuerte inhibidor de calcineurina, ha demostrado actividad antiparasitaria contra varios protozoos y helmintos parásitos, esto ocurre cuando se une a moduladores citoplasmáticos denominados ciclofilinas (CyPs), familia de prolil peptidil cis-trans isomerasas, proteínas altamente conservadas entre las especies. Bua y cols., (2001), clonaron y caracterizaron uno de los miembros de la familia CyP de T. cruzi (Cyp19), el cual presenta una fuerte interacción con CsA, siendo inhibida su actividad enzimática, a concentraciones muy bajas, nano moles. Recientemente, en ensayos de invasión, hemos demostrado que cepas tipo I y II de Trypanososma cruzi interactúan con esta droga de manera diferente, siendo sensibles o resistentes a su acción. La cepa CL presenta un 70% de inhibición en tanto que la cepa G no es inhibida. En un intento por buscar una eventual explicación para esta diferencia en el accionar de CsA, hemos clonado y caracterizado molecularmente CyP19 de ambas cepas ensayadas.
Así, partidores fueron diseñados y sintetizados para mediante RT-PCR amplificar CyP19 a partir de ADNc de la cepa CL y G, senso 5`GGATCCATGTCGTACAAGCCG3` y anti senso 5´GGATCCCAGTTTAAAGTTGACC3´. Los genes amplificados fueron clonados en vectores de amplificación y de expresión y caracterizados molecularmente. Sus secuencias, tanto de nucleotidos como la deducida secuencia de aminoácidos fueron comparadas mediante BLASTn y BLASTp. Con el inserto de cada clon, CL y G, se sintetizaron sondas mediante "Random Primers kit" y ellas se emplearon en ensayos de Southern blot, Northern blot y Cromo blot.
Los análisis realizados mediante Cromo blot y el Southern blot evidencian la existencia de un polimorfismo entre las cepas estudiadas para el posicionamiento de CyP19 en el genoma. Ambos genes son transcritos y traducidos en las formas invasivas del parásito., No obstante, los análisis comparativos a nivel de nucleótidos y aminoácidos revelaron una alta homología, evidenciando que la proteína CyP19 existente en ambas cepas es esencialmente la misma. La implicancia de estos resultados en los ensayos de invasión inicialmente realizados, serán aquí discutidos.
Financiamiento: FONDECYT 1051045, FUNDACION ANDES

 

4. CLONAMIENTO Y PURIFICACIÓN DE LA PROTEÍNA LipL21 DE Leptospira interrogans SEROVAR CANÍCOLA DESDE UN AISLADO NACIONAL. (Cloning and purification of LipL21 protein from Leptospira interrogans serovar canicola from a Chilean isolate). 1Palma, P.; 1González, P.; 1Riveros, B.; 2Style, J.; 3Maier, L.; 1Vásquez, A. 1Centro de Investigación y Desarrollo, Instituto de Salud Pública de Chile. 2Servico Agrícola Ganadero. 3Universidad Santo Tomás.

Leptospira es el agente etiológico de la leptospirosis, una zoonosis bacteriana de amplia distribución mundial. Existen aproximadamente 230 serovares definidos por los lipolisacáridos (LPS) de la bacteria.
Proteínas conservadas de membrana externa tienen un alto interés para el desarrollo de inmunobiológicos. Entre ellos, LipL21 es atractiva como inmunógeno por ser conservada y estar presente en todas las cepas patógenas.
El gen de LipL21 fue amplificado por PCR desde un aislado nacional de Leptospira interrogans serovar canicola y clonado en el vector pET21a para su expresión heteróloga en E. coli BL21(DE3). La proteína fue purificada mediante cromatografía de afinidad en resinas de Ni-agarosa.
El gen de LipL21 amplificado, de 581 pb, expresado en E. coli dio origen a una proteína de 21 kDa. La secuencia nucleotídica del gen clonado tiene un 99% de identidad con la secuencia descritas en la literatura. La identidad de la proteína purificada se estableció por Western blot utilizando un anticuerpo policlonal anti-His que reconoce en los residuos histidinas incorporados a la proteína por el vector pET21a.
Los resultados descritos nos permitirán evaluar inmunológicamente LipL21 como candidata en el desarrollo de inmunobiológicos.
Patrocinio: Dr. Alejandro Venegas.

 

5. DETECCIÓN DE BACTERIÓFAGOS LISOGÉNICOS EN CEPAS MULTIRRESISTENTES DE SALMONELLA ENTERICA DE ORIGEN BOVINO (Detection of lysogenic bacteriophage in multiresistant strains of Salmonella enterica from bovine origin) Suazo, P.1, Borie, C.2 y Robeson, J.1
Instituto de Biología, Pontificia Universidad Católica de Valparaíso1 y Facultad de Veterinaria, Universidad de Chile2

Salmonella enterica es un patógeno relevante en veterinaria, siendo los animales infectados focos de transmisión de la bacteria hacia humanos.
Por otra parte, la emergencia de cepas multirresistentes a antimicrobianos es problemática debido a las dificultades de control y los bacteriófagos lisogénicos, comunes en Salmonella sp., que son potenciales vectores para la diseminación de genes de resistencia, acentúan el problema.
Por tanto, en este trabajo se evaluó la incidencia de bacteriófagos lisogénicos en 28 cepas multirresistentes de Salmonella enterica provenientes de bovinos, de los siguientes serotipos: panama (7), mbandaka (4), dublín (2) y typhimurium (15)
Se prepararon sobrenadantes libres de células, los cuales se ensayaron por presencia de unidades formadoras de placas de lisis turbias en cepas indicadoras adecuadas de S. enterica y E. coli como control.
Se encontró que un 40% de las cepas de S. enterica ser. typhimurium producían bacteriófagos que solo plaquearon en cepas homólogas. No se detectó producción de bacteriófagos en cepas de los otros serotipos examinados, incluso cuando se realizaron infecciones cruzadas entre todas las cepas disponibles.
Concluímos que las cepas de S. enterica ser. typhimurium tienen el potencial de transducir genes de resistencia a
antimicrobianos.
Tutoría: Dra. Inés Contreras
Financiamiento: PUCV

6. LA GLUCOSA TERMINAL DEL "CORE" DEL LPS ES NECESARIA PARA LA INVASIÓN DE CÉLULAS EPITELIALES HEp-2 POR Salmonella TYPHI (The terminal glucose in the LPS "core" is necessary for the invasion of HEp-2 epithelial cells by Salmonella Typhi). Hoare, A., Bittner, M., Bravo, D., Altamirano, F., Zaldívar, M., Álvarez, S. y Contreras, I. Facultad de Ciencias Químicas y Farmacéuticas, Universidad de Chile.

Salmonella enterica serovar Typhi (S. Typhi) es el agente etiológico de la fiebre tifoidea. Una etapa clave en la infección por este patógeno es la invasión del epitelio intestinal. En este proceso es crucial la primera interacción de la bacteria con las células epiteliales. En S. Typhi la naturaleza de esta interacción no está totalmente clara, pero estarían involucrados componentes de la superficie bacteriana, como el lipopolisacárido (LPS). El LPS está constituido por tres dominios estructurales: el lípido A, el oligosacárido "core" y el polisacárido O. En este trabajo investigamos el rol del "core" del LPS en la capacidad invasiva de S. Typhi a células epiteliales. Con este objetivo, construimos mutantes definidas en genes de la biosíntesis del "core" externo (waaK, waaJ, waaI, waaB, waaG) de S. Typhi y evaluamos su efecto en la invasión y adherencia a células HEp-2 in vitro. Los resultados mostraron que la adherencia a células epiteliales no fue afectada por defectos en la estructura del "core". En cambio, la presencia de una glucosa terminal en el "core" del LPS resultó fundamental para la invasión de células epiteliales.
Financiamiento: FONDECYT 1040562

 

7. IDENTIFICACIÓN DE UNA ÁCIDO P-CUMÁRICO DESCARBOXILASA Y UNA 4_VINILREDUCTASA EN Brettanomyces bruxellensis. (Identification of p-coumaric acid decarboxylase and 4-vinylreductase from Brettanomyces bruxellensis) Godoy, L.2, Ganga, A. 1,2
1
Departamento Gestión Agraria. Facultad Tecnológica y 2Centro de Estudios en Ciencia y Tecnología de los Alimentos, Universidad de Santiago de Chile. Alameda 3363. Santiago, Chile.
Profesor Patrocinante: Marcela Wilkens.
Proyecto FONDECYT 1050104

Brettanomyces bruxellensis es una de las principales levaduras contaminantes en vinos, ya que su presencia estaría correlacionada con la aparición de aromas fenólicos que inciden negativamente en las propiedades organolépticas de éste. Si bien su presencia estaría vinculada con la aparición de estos aromas, se desconoce el mecanismo de producción de los mismos. Se postula que B. bruxellensis transformaría los ácidos cinámicos, presentes inicialmente en el jugo de uva, en sus derivados etilos (etilfenol, etilguaiacol). La ruta metabólica propuesta es que los ácidos cinámicos serían transformados en una primera etapa en sus derivados de vinilo para luego ser metabolizados en sus derivados de etilo. Sin embargo, las enzimas participantes en esta ruta metabólica aún no han sido identificadas en este microorganismo.
En base a ello, nuestro grupo de trabajo está realizando experimentos para identificar las enzimas participantes en la transformación de los ácidos cinámicos en sus derivados de etilo. En primer lugar se han estudiado las condiciones óptimas de crecimiento de B. bruxellensis, así como la definición de si estas enzimas son secretadas al medio o son mantenidas intracelularmente. Ambos estudios nos apoyarán para continuar con la purificación de ambas enzimas.

 

8. CLONAMIENTO Y CARACTERIZACIÓN DE PLASMIDIOS DE DSRNA PRESENTES EN XANTHOPHYLLOMYCES DENDRORHOUS (Cloning and caracterizaction of double stranded RNA plasmids on Xanthophyllomyces dendrorhous). Sanhueza, M., Marcoleta. A, Carmona, M., Cifuentes, V. y Baeza, M. Laboratorio de Genética, Facultad de Ciencias, Universidad de Chile.

Xanthophyllomyces dendrorhous es una levadura basidiomicete de gran importancia biotecnológica ya que produce astaxantina, un pigmento utilizado en la industria de los salmones. En varias cepas de esta levadura se ha demostrado la presencia de Elementos Genéticos Extracromosómicos cuya función es aún incierta. En otros géneros de levaduras estas moléculas codifican para factores de virulencia y diversos mecanismos de toxicidad.
Se analizó la presencia de estos elementos en 3 cepas de X. dendrorhous de origen ruso y 2 de origen japonés. Mediante el aislamiento de los ácidos nucleicos totales y posterior caracterización enzimática con distintas DNasas y RNasas, se definió la existencia de plasmidios del tipo RNA de doble hebra (dsRNA) en todas las cepas estudiadas. En las cepas de origen ruso se observó la presencia de 4 moléculas de dsRNA (entre 4. 2 y 0. 4 Kb), en cambio solo una en las de origen japonés (4. 2 Kb). Para el clonamiento de estos plamidios, cada uno de ellos fue purificado desde geles de agarosa y les fue adicionado el oligonucleótido PC1 (que contiene un segmento PoliA) mediante la enzima T4 RNA ligasa. Mediante transcripción reversa con el partidor poliT y posterior amplificación con el partidor PC2 (complementario a PC1) se obtuvo el cDNA completo de cada molécula, los que fueron clonados en el vector pBS. El análisis de estas secuencias de los clones obtenidos nos permitirá definir los ORF presentes, lo que nos dará luces de la posible función de los plasmidios dsRNA en X. dendrorhous.
Financiado por proyecto DI I-04/08-02 y Fondecyt 1040450.

 

9. EFECTO DEL METABOLISMO AEROBIO EN LA EXPRESIÓN DE LOS GENES DE CAROTENOGÉNESIS DE Xanthophyllomyces dendrorhous. (Effect of the aerobic metabolism in the expression of carotenogenesis genes from X. dendrorhous). Wozniak, A.; Alcaíno, J.; Carmona, M.; Marcoleta, A.; Lodato, P.; Baeza, M. y Cifuentes, V. Departamento Cs. Ecológicas, Facultad de Ciencias, Universidad de Chile.

En X. dendrorhous, la síntesis de astaxantina coincide con el agotamiento de glucosa y la aparición de etanol como producto de la fermentación, induciéndose específicamente cuando comienza su utilización aeróbica. Este trabajo estudia el efecto del metabolismo aerobio en la expresión de los genes de carotenogénesis y la producción de pigmentos durante el crecimiento de X. dendrorhous. Se determinó que en succinato, la producción de pigmentos es aproximadamente el doble que en glucosa, iniciándose al principio de la fase exponencial y al principio de la fase estacionaria respectivamente. La expresión de los genes idi y crtE, que participan en etapas tempranas de la carotenogénesis, ocurre durante todo el ciclo de crecimiento y es similar en ambos medios de cultivo. En succinato, el nivel de mensajero maduro del gen crtI disminuye al principio de la fase estacionaria mientras que un mensajero alternativo continúa expresándose hasta el final del crecimiento. Además, la expresión del mensajero alternativo del gen crtYB, comienza mucho después que el maduro, mientras que en glucosa ambos se expresan al mismo tiempo.
Los resultados indican que el patrón de expresión de los genes de carotenogénesis difieren entre metabolismo fermentativo y aerobio, su estudio conducirá al conocimiento de sus mecanismos de regulación.
Agradecimientos: FONDECYT Nº 1040450

 

10. LA EXPRESIÓN DE LOS GENES mceI y mceJ MODULA LA ACTIVIDAD BACTERICIDA DE LA MICROCINA E492 (The expression of the genes mceI y mceJ modulates the bactericidal activity of microcin E492) Marín M., Estévez C., Tello M., Lagos R. Laboratorio de Biología Estructural y Molecular, Departamento de Biología, Facultad de Ciencias, Universidad de Chile. mac0arena@gmail. com

La microcina E492 (mccE492) es una bacteriocina sintetizada por Klebsiella pneumoniae RYC492. La mayor actividad de mccE492 se reporta en fase exponencial de crecimiento, disminuyendo en fase estacionaria. Esta disminución en la actividad está correlacionada con una disminución de la transcripción de los genes de maduración mceJI. Con el objetivo de determinar si la expresión de estos genes modula la actividad de la mccE492, estos fueron clonados bajo el promotor f10 del fago T7 (pT7-IJ). El plasmidio pT7-IJ fue transformado en cepas productoras de mccE492 y se evaluó directamente el perfil de la actividad bactericida en el tiempo a partir de sobrenadante de estos cultivos. Estos experimentos permitieron determinar que un aumento en la expresión de los genes mceJI incrementa la actividad bactericida en fase exponencial y estacionaria, pero no elimina el descenso en actividad en fase estacionaria. Sin embargo al evaluar la actividad de mccE492 purificada a partir de sobrenadantes en fase estacionaria tardía se observa que la sobreexpresión de mceJI causa un aumento en la actividad bactericida de la microcina purificada. Se concluye que al menos uno de los factores que controla el nivel de actividad es la expresión de los genes mceJI, y que el proceso de purificación de mccE492 en fase estacionaria elimina un inhibidor de la actividad bactericida y/o favorece una conformación activa de la mccE492.
Proyecto FONDECYT 1020757

 

11. LA PRODUCCIÓN DE MICROCINA E492 ACTIVA ESTÁ ASOCIADA A LA VÍA DE SÍNTESIS DE ENTEROQUELINA. (The production of active microcin E492 is associated with the enterochelin síntesis pathway) Mercado*, G., Tello M., Estévez C., Marim M. y Lagos R. Laboratorio de Biología Estructural y Molecular, Departamento de Biología, Facultad de Ciencias, Universidad de Chile.
mg_9071@hotmail. com.

La microcina E492 (Mcc492), es una bacteriocina que dependiendo de las condiciones de crecimiento de la cepa productora, una fracción se sintetiza modificada post-traduccionalmente. La modificación consiste en la unión al carboxilo terminal de una molécula tipo salmoquelina, un catecol sideróforo similar a una enteroquelina a la cual se le han unido moléculas de glucosa mediante una reacción catalizada por una glucosil transferasa (IroB). En la producción de mcc E492 activa participan los genes de maduración mceCIJ, siendo mceC homólogo de iroB. Mediante estudios con mutantes en los genes de la síntesis de enteroquelina demostramos que para la producción de mcc E492 activa se requiere de la participación de productos génicos de esta vía, entre ellos entF. Este fenotipo se revistió al complementar la cepa con un plasmidio que expresa EntF. Para establecer si este requerimiento estaba asociado solo a la síntesis de enteroquelina, se realizaron experimentos de transcomplementación incubando las células con enteroquelina monoglucosilada y enteroquelina diglucosilada, que corresponden a salmoquelina. Se estableció que solo es posible transcomplementar con salmoquelina cepas que expresen EntF, indicando que la participación de esta proteína es además necesaria en un paso diferente de la producción de enteroquelina. Se elaboró un modelo para la producción de microcina modificada que relaciona la función de los genes de la maduración de la microcina con la vía de síntesis de enteroquelina.
Proyecto FONDECYT 1020757. *Becaria CONICYT.

 

12. LA MICROCINA MUTANTE Q8H INTERFIERE CON LA ACTIVIDAD BACTERICIDA DE LA MICROCINA SILVESTRE (Mutant microcin Q8H interferes with the bactericidal activity of wild type microcin) García* V.1, Estrada L. 2, Soto, C. 2, Monasterio, O.1, Lagos R.1 Laboratorio de Biología Estructural y Molecular, Departamento de Biología, Facultad de Ciencias, Universidad de Chile1. Departament of Neurology, University of Texas Medical Branch2.

La microcina E492 es una bacteriocina que ejerce su acción mediante la despolarización de la membrana de las células sensibles. Es producida en forma activa durante la fase exponencial de crecimiento, perdiendo su actividad en la fase estacionaria, efecto que ha sido correlacionado con la formación de fibras amiloide.
Mediante mutagénesis al azar con hidroxilamina se obtuvo una microcina mutante en el residuo 8 (Q8H) que perdió la actividad bactericida. La co-producción de microcina silvestre activa y microcina Q8H en E. coli, produce la pérdida de la actividad de la microcina silvestre. Este efecto también se observa cuando se incuba la mezcla de los sobrenadantes de un cultivo productor de microcina activa con uno de microcina mutante, indicando que la microcina mutante interfiere con la actividad de la microcina silvestre.
Mediante western blot se estableció que la microcina Q8H purificada forma oligómeros y que al igual que la microcina silvestre acelera la cinética de formación de agregados. Se concluye que el fenómeno de inactivación de la microcina silvestre por la microcina Q8H puede ser consecuencia de la polimerización mixta entre ambos tipos de microcinas.
Proyecto FONDECYT 1020757. *Becaria CONICYT.

13. 3-CHLOROBENZOATE IS TAKEN UP BY AN INDUCIBLE TRANSPORTER IN CUPRIAVIDUS NECATOR JMP134 (El 3-clorobenzoato es incorporado por un transportador inducible en C. necator JMP134). Ledger, T., Flores-Aceituno, F., & González, B. Depto. Genética. Molecular y Microbiología. Fac. de Ciencias Biológicas. P. Universidad Católica de Chile. Chile. tledger@bio. puc.cl

Cupriavidus necator JMP134 (pJP4) has been extensively studied because of its ability to degrade the herbicide 2, 4-dichlorophenoxyacetate (2, 4-D) and 3-chlorobenzoate (3-CB), using enzymes encoded by the tfd genes in plasmid pJP4. Since chlorobenzoates are not readily permeable through biological membranes at physiological pH, the presence of a transport system involved in 3-CB uptake by C. necator was investigated. Uptake experiments using ring 14C-labeled 3-CB were performed in strain JMP134 cells. 3-(14C)CB was taken up by C. necator at a rate of 1. 1 nmoles/(min x mg of protein) when it was grown on 3-CB or induced with this compound, but no uptake was observed when strain JMP134 was grown on fructose, or other aromatic substrates. Rates of uptake exhibited a saturation kinetics, with an apparent Vmax of 3. 54 nmols/(min x mg of protein) and an apparent Km of 27. 6 mM. Competitor assays were also performed using other chloro and methyl substituted benzoates to determine a substrate profile for the putative transporter. The results of this work clearly indicate that C. necator JMP134 expresses a 3-CB transport system in response to this compound, or an intermediate of its degradation. This is the first report for a 3-CB transport system.
Work supported by a FONDECYT grant (1030493). T. L. is a DIPUC PhD fellow.

 

14. Importancia de los genes de 3-oxoadipato CoA transferasa para la degradación de contaminantes aromáticos y cloroaromáticos en cupriavidus necator JMP134. (Importance of the genes of 3-oxoadipate-CoA transferases for the degradation of aromatic and chloroaromatic compounds in Cupriavidus necator JMP134 (pJP4)). Flores-Aceituno, F1., Pieper, D. H.2, González, B. 1 1Departamento de Genética Molecular y Microbiología, Facultad de Ciencias Biológicas, P. Universidad Católica de Chile; 2Department of Environmental Microbiology, German Research Center for Biotechnology, Braunschweig, Alemania. feflorea@puc.cl

Cupriavidus necator JMP134 es una bacteria usada como modelo para el estudio de la degradación de contaminantes (cloro)aromáticos. Una de las vías más estudiadas es la "vía orto", que produce 3-oxoadipato (3OA), metabolito que es degradado hasta intermediarios del ciclo de Krebs por vías pobremente estudiadas. A partir de la secuencia completa del genoma de C. necator se pudo identificar dos secuencias con homología a 3-oxoadipato CoA transferasa, la primera de las enzimas que degradan el 3OA. Uno de estas secuencias se mutó por intercambio alélico y el fenotipo mutante fue evaluado por crecimiento y degradación de una mezcla de 2, 4-diclorofenoxiacetato (2, 4-D) y 4-metilfenoxiacetato (4MPA). El crecimiento de la mutante en esta mezcla fue más lento que en la cepa silvestre. Sorprendentemente, esto no se debió a la acumulación de metabolitos, por ejemplo, 3OA, sino a una menor degradación del 4MPA. Estos resultados permiten postular que el fenotipo de la mutante se debería a un déficit energético que afectaría el transporte de 4MPA.
Este trabajo fue financiado por el proyecto FONDECYT 1030493 y una beca de la Fundación Andes para una pasantía en el extranjero.

 

15. PAPEL DE LOS POLIFOSFATOS INORGÁNICOS EN LA TOLERANCIA A COBRE DE SULFOLOBUS METALLICUS. (Role of inorganic polyphosphate in copper tolerance of Sulfolobus metallicus). Remonsellez, F., Orell, A. y Jerez, C. A. Laboratorio de Microbiología Molecular y Biotecnología, Departamento de Biología, Facultad de Ciencias, Universidad de Chile. cjerez@uchile.cl

Los polifosfatos (poliP) son polímeros lineales de cientos de residuos de ortofosfato. En las bacterias se postula que los metales pesados promoverían la hidrólisis de los poliP, mediada por la enzima exopolifosfatasa (PPX), y que el fosfato liberado sería excretado junto a los cationes, desintoxicando el ambiente intracelular. Para estudiar si este sistema de tolerancia a metales pesados existe en el género Sulfolobus, se determinó la concentración de poliP en Sulfolobus acidocaldarious, S. solfataricus y S. metallicus. Los tres microorganismos sintetizaron poliP durante su crecimiento, pero solo S. metallicus acumuló grandes gránulos del polímero, siendo los niveles de poliP 10 veces mayores que los de S. acidocaldarius y S. solfataricus. S. metallicus toleró concentraciones hasta de 200 mM CuSO4. En cambio, S. solfataricus no tolera más de 5 mM CuSO4, debido probablemente a sus bajos niveles de poliP. Los niveles de poliP disminuyeron en S. metallicus al someterlo a concentraciones sobre 100 mM CuSO4, fenómeno que fue concomitante con un aumento de la actividad PPX y una estimulación de la salida de fosfato desde las células. Nuestros resultados apoyan la hipótesis que los poliP tendrían un papel en la alta tolerancia de S. metallicus a metales tóxicos.
Apoyo: ICM P-99-031-F; Beca PG/07/2004 Depto. Postgrado-Postítulo, U. de Chile.

16. CARACTERIZACIÓN DEL GEN hdtS CODIFICANTE PARA UNA SINTASA DE HOMOSERINA LACTONA EN ACIDITHIOBACILLUS FERROOXIDANS (Characterization of the hdtS gene coding for an AHLs sintase in Acidithiobacillus ferrooxidans). Castro M., Banderas A., Jerez C. A. y Guiliani N. Laboratorio de Microbiología Molecular y Biotecnología, Facultad de Ciencias, Universidad de Chile.

El "Quorum Sensing" (QS) permite a las bacterias comunicarse y coordinar diversas funciones fisiológicas relevantes para su población y/o la comunidad, tales como el desarrollo de biopelículas y la virulencia. En bacterias Gram-negativas, el sistema de QS tipo AI-1 es el más estudiado. Éste utiliza moléculas del tipo acil homoserina lactonas (AHLs) como señal o autoinductor (AI-1) que son sintetizadas por las sintasas de AHLs homólogas a LuxI (familia de proteínas I o familia 1). Recientemente, se han identificada dos otras familias de sintasas de AHLs que están representadas por las proteínas de tipo AinS y HdtS.
A. ferrooxidans es una de las bacterias Gram-negativa quimiolitoautotrófica involucradas en los procesos de biolixiviación. Durante la caracterización del sistema de QS tipo AI-1 de A. ferrooxidans (Farah et al. 2005, Appl. Environ. Microbiol., en prensa), hemos identificado las diferentes AHLs que éste produce. Además del gen afeI cuya expresión estudiamos, identificamos un segundo marco abierto de lectura que codifica para una sintasa de AHLs de tipo HdtS.
Con el fin de caracterizar el gen hdtS y las AHLs producidas específicamente por la proteína de HtdS de A. ferrooxidans nos hemos propuesto clonarlo y sobreexpresaarlo en E. coli.
Financiamiento: Proyectos FONDECYT 1040676; Fundación Andes

 

17. DESARROLLO DE UN BIOSENSOR DE HOMOSERINA LACTONAS BASADO EN EL SISTEMA DE QS TIPO AI-1 DE ACIDITHIOBACILLUS FERROOXIDANS (Development of a biosensor for homoserine lactones based on QS type AI-1 system of Acidithiobacillus ferrooxidans). Valenzuela S., González A., Jerez C. A. y Guiliani N. Laboratorio de Microbiología Molecular y Biotecnología, Facultad de Ciencias, Universidad de Chile.

El Quórum Sensing (QS) permite a la población bacteriana comunicarse y coordinar funciones fisiológicas, tales como el desarrollo de biopelículas. En bacterias Gram-negativas el sistema de QS más estudiado es aquel que utiliza moléculas del tipo acil homoserina lactonas (AHL) como señal o autoinductores (AI-1).
A. ferrooxidans, bacteria Gram-negativa quimiolitoautotrófica de importancia en la biolixiviación, posee un sistema de QS tipo AI-1. Éste está conformado por los genes afeI y afeR, una caja de unión al DNA para el regulador transcripcional AfeR y AHLs sintetizadas por AfeI (Farah et al. 2005, Appl. Environ. Microbiol., en prensa).
Con el fin de medir la producción de AHLs en A ferrooxidans y otras especies bacterianas nos hemos propuesto desarrollar un biosensor basado en la regulación de la expresión del gen reportero luc, codificante para la luciferasa de luciérnaga, por los componentes del sistema QS afeI/afeR. Este sistema reportero proveerá de una nueva herramienta para analizar la producción de AHLs de diferentes microorganismos.
Financiamiento: Proyectos FONDECYT 1040676; Fundación Andes.

18. ANÁLISIS DE EXPRESIÓN GÉNICA EN Acidithiobacillus ferrooxidans ATCC23270 MEDIANTE UN SISTEMA DE MACRO-ARREGLOS DE ADN (Gene expression analysis in A. ferrooxidans ATCC 23270 by using a DNA macroarray system). Beard, S., Vera, M., Valenzuela, L., y Jerez, C. A. Laboratorio de Microbiología Molecular y Biotecnología, Departamento de Biología, Facultad de Ciencias, Universidad de Chile. cjerez@uchile.cl

Acidithiobacillus ferrooxidans es una bacteria quimiolitoautotrófica que puede obtener su energía por la oxidación del ión ferroso, azufre elemental o compuestos reducidos de azufre y que ha sido estudiada como organismo modelo en los procesos de biolixiviación. Mediante análisis proteómicos, hemos identificado proteínas expresadas diferencialmente en A. ferrooxidans al oxidar distintos sustratos. Entre las que aumentan su nivel de síntesis cuando la bacteria oxida azufre elemental, se encuentran una proteína tipo-rodanasa probablemente periplásmica (P21) y una proteína putativa de exporte de exopolisacárido (WcbC). Para profundizar el estudio de dichas proteínas se analizaron los contextos genéticos en los que se encuentran los genes p21 y wcbC, encontrándose que forman parte un putativo operón y un "cluster" relacionado con la síntesis de exopolisacárido respectivamente, y se analizó la expresión a nivel de mRNA de estos genes mediante un sistema de macro-arreglos de ADN. Se utilizaron sondas obtenidas a partir del RNA total de A. ferrooxidans ATCC23270 crecido en ión ferroso, tiosulfato y azufre elemental, encontrándose que el operón putativo de p21 se induce al crecer en azufre elemental y tiosulfato mientras que solo algunos genes pertenecientes al cluster wcbC se expresaron diferencialmente entre estos sustratos oxidables.
Financiado por proyecto FONDECYT 1030767 y beca MECESUP (SB)

 

19. EL REGULÓN PHO Y SU RELACIÓN CON EL METABOLISMO DE LOS POLIFOSFATOS EN ACIDITHIOBACILLUS FERROOXIDANS. (The Pho regulon and its relationship with polyphosphate metabolism in Acidithiobacillus ferrooxidans. Vera, M., Alvarez, S. Guiliani, N. y Jerez, C. A. Laboratorio de Microbiología Molecular y Biotecnología, Departamento de Biología, Fac. de Ciencias, Universidad de Chile. cjerez@uchile.cl

El regulón Pho es un conjunto de genes que se expresan en carencia de fosfato (Pi) y que codifican para proteínas involucradas en la captación de trazas de Pi desde el medio. El Pi puede ser almacenado como polifosfatos inorgánicos (poliP), polímero lineal de residuos de ortofosfato, que es sintetizado por la polifosfato quinasa (PPK) e hidrolizado a Pi por la expolifosfatasa (PPX). Hemos caracterizado el regulón Pho y el papel del poliP en la respuesta adaptativa de A. ferrooxidans a la carencia de Pi. A. ferrooxidans acumuló poliP al crecer en presencia de Pi, mientras que los degradó cuando fue sometido a la carencia de Pi, observándose un aumento concomitante de la actividad PPX. Por RT-PCR encontramos que el gen ppx de A. ferrooxidans se expresa como parte del operón pst, sugiriendo fuertemente que a diferencia de lo que ocurre en E. coli, el gen ppx de A. ferrooxidans formaría parte del regulón Pho en este microorganismo. Empleando PCR en tiempo real y macroarreglos de DNA cuantificamos los niveles de estos transcritos. La organización genética inusual del regulón Pho de A. ferrooxidans puede reflejar un cambio adaptativo de esta bacteria para sobrevivir en ambientes limitados en fosfato.
Financiado por ICM P99-031-F y beca CONICYT (MV)

 

MICROBIOLOGÍA MÉDICA Y
VETERINARIA

20. RESPUESTA INMUNE TIPO IgG e IgA EN SUEROS DE PACIENTES CHILENOS INFECTADOS POR H. PYLORI FRENTE A DISTINTOS ANTÍGENOS BACTERIANOS. (IgA and IgG immune response in sera from Chilean infected patients against different H. pylori antigens). Diaz, M.I., Lienlaf, M., Morales, J.P.,Serrano, C., Harris, P. y Venegas, A. Pontificia Universidad Católica de Chile.

Objetivo: Muchas infecciones producidas por microorganismos inducen respuesta IgA como responsable de la primera línea de defensa y como parte de la respuesta inmune celular. IgG en cambio, es un buen biomarcador de respuesta T helper (Th1 o Th2) aportando información útil en prognosis clínica. El objetivo es estudiar y comparar las respuestas IgG e IgA como biomarcadores de la infección por H. pylori. Métodos: Se analizaron 100 sueros de pacientes incluyendo infectados y no infectados. Todos fueron sometidos a endoscopía y se recolectó sueros para análisis de respuesta humoral. IgG e IgA se midieron por Western blot enfrentando cada suero a varios antígenos. Resultados: El segmento interno de CagA (A17), flagelina A (FlaA), la proteína de shock térmico (HspB), la subunidad mayor de ureasa (UreB) y la citotoxina VacA son los antígenos más frecuentemente reconocidos por anticuerpos tipo IgG de sueros de pacientes infectados. Los anticuerpos tipo IgA reconocen también HspB, UreB y VacA pero con distinta preferencia. Conclusiones: La mayoría de los sueros reconoce varios antígenos de H. pylori sin discriminación respecto del cuadro clínico. La información recabada será de gran utilidad en el desarrollo de vacunas contra esta bacteria.
Financiamiento: FONDECYT 1030894, FONDEF DO2I-1067.

 

21. Detección de genes hopE y hopV en cepas chilenas de Helicobacter pylori y su potencial PARA inducir anticuerpos en pacientes infectados. (Detection of hopE and hopV genes from Chilean H. pylori strains and its potential to induce antibodies in infected patients). Lienlaf, M., Morales, J. P., Diaz, M. I., Harris, P. y Venegas, A. Pontificia Universidad Católica de Chile.

Fundamento: En algunas bacterias las porinas son potentes inmunógenos. Con el fin de evaluar esto, se propone estudiar la distribución de los genes de porinas HopE y HopV de Helicobacter pylori en cepas chilenas de esta bacteria y la seroconversión en pacientes infectados. `Métodos: Los genes hopE y hopV se detectaron en cepas chilenas mediante PCR, se clonaron y expresaron ambas porinas de la cepa chilena CHCTX-1. Las proteínas expresadas heterólogamente se purificaron por SDS-PAGE y electroelución, y se prepararon anticuerpos policlonales para ambas. Para detectar las porinas en cepas aisladas de pacientes y evaluar su potencial inmunogénico en sueros de pacientes infectados, se utilizó Western blot, enfrentando estos últimos a lisados de E. coli que expresan las porinas HopE o HopV. Resultados: Se detectaron ambos genes en la mayoría de las cepas chilenas. Al evaluar niveles de expresión de estas porinas, se encontró que solo algunas cepas expresaban HopE y muy pocas HopV. Esto sugiere que hopV no está activo en muchas de éstas. Conclusiones: HopV estaría sometido a control génico mutacional del tipo on/off y por ausencia tendría un bajo potencial antigénico.
Financiamiento: FONDECYT 1030894 y FONDEF DO2I-1067

22. ANÁLISIS DE LA RESISTENCIA ANTIBIÓTICA EN AISLAMIENTOS DE H. PYLORI. (Antibiotics` Resistance Analysis in H. pylori isolations) Garrido L, Vallejos C, Defilippi C, Madrid A M, Defilippi C, Toledo H. Prog. Biología Celular y Molecular, ICBM. Fac. de Medicina. Univ de Chile; Unidad de Gastroenterología, Hospital Clínico Univ. de Chile.

La infección con Helicobacter pylori está asociada a patologías tales como: `úlcera gástrica y duodenal, cáncer gástrico, linfoma de MALT. El riesgo de infección y la prevalencia de la resistencia a antibióticos en H. pylori se determinó en un grupo de pacientes no seleccionados, derivados a la unidad de endoscopía del Hospital Clínico de la Universidad de Chile, entre lo años 2002-2004. En este estudio se enrolaron 272 pacientes a los cuales, previo firma del consentimiento informado, se les tomó tres biopsias, 2 en antro a 2 cm. del píloro y una tercera en el tercio superior del cuerpo, en la curvatura mayor. Una de las muestras antrales fue sometida al test de la ureasa. El 44, 9% de los pacientes enrolados resultaron ser ureasa positivos. El riesgo de estar infectado con H. pylori en individuos menores de 60 años fue de 2, 07(1, 40-3, 07) veces mayor comparado con el grupo de edad mayor de 61 años (p < 0, 0001). A partir de las biopsias se obtuvieron aislamientos, los cuales se analizaron por el ensayo de dilución antibiótica en placas de agar, para determinar la resistencia a Metronidazol (Mtz), Claritromicina (Cla) y Tetraciclina (Tet). La resistencia a Mtz fue de un 47, 7%, mientras que para Cla es de un 21, 7% y de Tet de un 38, 5%. La Multiresistencia alcanzó al 40, 5%. Con el propósito de identificar las mutaciones en el rRNA 23S, que dan cuenta de la resistencia a Cla, se analizó el DNA de los aislamientos mediante PCR-RFLP encontrándose que la resistencia a Cla se debe principalmente a mutaciones en las posiciones A2142G y A2143G.
Proyecto AMAYOR2/4-2 financiado por el DI de la Universidad de Chile.

 

23. IMPLICANCIAS DE LA ISLA DE PATOGENICIDAD 3 EN LA VIRULENCIA DE Salmonella enterica SEROVAR TYPHI (Involvement of pathogenicity island 3 in the Salmonella enterica serovar Typhi virulence) Retamal, P1. Fuentes, J. 1, Castro D., Castillo, M.1 y Mora, G2.
1Laboratorio de Microbiología, Facultad de Ciencias Biológicas, P. Universidad Católica de Chile. Becarios Conicyt. 2Laboratorio de Microbiología, Facultad de Ciencias de la Salud, Universidad Andrés Bello.

En S. enterica existen regiones del DNA relacionadas a patogenicidad, conocidas como islas de patogenicidad (SPI). Respecto de SPI-3 experimentalmente se ha demostrado en el serovar Typhimurium el papel que cumple el operón mgtCB en el crecimiento a bajas concentraciones de Mg+2 y la persistencia al interior de macrófagos. Con SPI-3 de S. Typhi no existen antecedentes experimentales de su función. El objetivo de este trabajo es determinar el papel de esta isla en la patogenicidad de S. Typhi.
Para ello, se generó la mutante SPI-3 en la cepa STH2370 de S. Typhi. En condiciones in vitro, se comparó la susceptibilidad de la mutante con la cepa parental en distintas condiciones representativas del ambiente al interior del hospedero, incluyendo el crecimiento en presencia de especies reactivas del O2 (H2O2)y del N2 (NaNO2), hiper-osmolaridad (NaCl 2, 5M) y anaerobiosis. Además, se determinó el crecimiento en concentraciones variables de Mg2+ y P.
Resultados: Se aprecian diferencias frente al desafío con NaNO2, existiendo una mayor susceptibilidad de la cepa mutante. Además, en bajas concentraciones de Mg+2 la cepa SPI-3- demuestra un menor crecimiento. Estos resultados sugieren la participación de SPI-3 en la virulencia de S. Typhi.
Financiamiento: Proyecto FONDECYT 1020485.

 

24. ANÁLISIS DE FACTORES DE VIRULENCIA EN CEPAS DE AEROMONAS SPP AISLADAS DEL RÍO LOA, II REGIÓN, CHILE. (Analysis of virulence factors in Aeromonas spp strains isolated from Loa river, II Región, Chile). Cortés I, Lizama C, Espinoza H, Silva J. Depto de Tecnología Médica-INDES, Universidad de Antofagasta.
Email: jsilva@uantof.cl, ivania. cortes@gmail.cl
Financiamiento. Proyecto PROIM 1357, DINV, Universidad de Antofagasta.

La virulencia o patogenicidad es definida como la habilidad de un microorganismo para causar infección y un factor de virulencia es consecuentemente un producto o estrategia de un microorganismo que contribuye a su virulencia o patogenicidad. Se han descrito diferentes determinantes patogénicos en Aeromonas spp. Que incluyen componentes estructurales y productos extracelulares, como hemolisinas, enterotoxinas, lipasas, proteasas y ADNasas. Este trabajo tiene como propósito estudiar factores de virulencia en cepas de Aeromonas spp de origen acuático. Para ello, se seleccionaron 156 cepas de`Aeromonas spp aisladas de 3 sectores del río Loa: A (estaciones 1-6), B (estaciones 7-16) y C (estaciones 17-22), a las cuales se les determinó la presencia de factores de virulencia. Gelatinasa fue hecha en agar con gelatina, proteasas en agar con leche descremada, hemolisinas en agar sangre de cordero, lipasas en agar yema de huevo y ADNasas en agar ADNasa. Un alto porcentaje de la cepas presentaron 1 o más factores de virulencia, encontrándose que 28 cepas presentaban la totalidad de los factores de virulencia ensayados. Las cepas aisladas del sector B presentaron un porcentaje mayor de factores de virulencia que los sectores A y C. La especie de A. hydrophila presentó el mayor número de factores de virulencia, seguido de A. caviae. Los factores de virulencia que se encontraron en mayor proporción correspondieron a lipasa (82 %) y gelatinasa (80 %). La presencia de factores de virulencia en Aeromonas spp que habitan en el río Loa pueden constituir un riesgo potencial para la salud humana.

 

25. Colonización oral, perfiles fenotípicos y diversidad de especies de Candida en pacientes con periodontitis. (Oral colonization, phenotypic profiles and Candida species diversity in patients with periodontitis). Urzúa B1., Hermosilla G2., Cóccola C1., Gamonal J1., Morales I1., Wilton C1. y Cifuentes V3. Facultad de (1)Odontología (2)Medicina (3)Ciencias, Universidad de Chile. Patrocinio: Irene Morales.

Las periodontitis son enfermedades de etiología multifactorial, con un componente infeccioso bacteriano, cuya secuela es la pérdida de piezas dentarias. Actualmente, se ha reportado la presencia de levaduras en sacos periodontales, desconociéndose su rol exacto en esta patología.
El propósito de este trabajo es caracterizar fenotípicamente la microbiota de levaduras en pacientes con periodontitis crónica y agresiva versus sujetos sanos.
Se aisló e identificó levaduras de mucosa, surco gingival y sacos periodontales, de tres profundidades diferentes(sitios a, b y c), de un total de 74 individuos. La identificación se realizó a través de pruebas convencionales, sistemas comerciales y secuenciación de la región ITS1-5. 8S rDNA-ITS2.
Considerando todos los individuos analizados las especies del género Candida encontradas son: C. albicans, C. dubliniensis, C. glabrata, C. guillermondii, C. parapsilopsis, C. lusitaneae, C. sake, C. zeylanoides. La diversidad de especies en sujetos sanos es de 0, 49% en mucosa y cero en surcos gingivales. En cambio la diversidad de especies en sujetos con periodontitis crónica es de 0. 33% en mucosa, 0. 004%, 0. 34% y 0. 19% en los sitios a, b y c respectivamente. En los sujetos enfermos los sacos periodontales estaban colonizados por C. albicans, C. dubliniensis y C. glabrata. De los tres grupos analizados, la diversidad de especies fue mayor en mucosa de sujetos periodontalmente sanos.
Proyecto DID SAL 03/04-2

 

26. CARACTERIZACIÓN MOLECULAR DE CEPAS DE Pseudomonas aeruginosa MULTIRRESISTENTE DE UN HOSPITAL GENERAL (Molecular characterization of multi-resistant Pseudomonas aeruginosa strain from a general hospital) Tapia, C.2, Fernández, K.1, Rivero, D.1 y Corsini, G.1 1Facultad de Ciencias de la Salud, Universidad Diego Portales. 2Laboratorio de Microbiología, Hospital San Juan de Dios.

Pseudomonas aeruginosa es un patógeno causante de infecciones intrahospitalarias, especialmente en pacientes inmunosuprimidos. Es un agente ubicuo que presenta una resistencia intrínseca y/o adquirida a varios antibióticos incluyendo b-lactámicos y carbapenémicos como Imipenem (IMP), lo cual reduce aún más las alternativas terapéuticas. En este trabajo se planteó caracterizar molecularmente cepas de P. aeruginosa multirresistentes (sensibles solo a colistin) que ocasionaron un brote en un hospital general, para determinar si estas cepas poseían un origen clonal.
Se estudiaron 15 cepas provenientes de 13 pacientes adultos y 2 niños de distintos Servicios Clínicos, 9 de los cuales provenían de UCI de adultos y pediátrica. La resistencia a IMP fue confirmada mediante E-test y por el sistema automatizado Vitek. La caracterización molecular fue realizada mediante PCR usando partidores arbitrarios. Empleando los partidores ERIC1/ERIC2 se determinó la existencia de 8 grupos clonales de P. aeruginosa en cambio con el partidor BOX se determinó la existencia de 7 grupos. El análisis con ambos métodos reveló la existencia en UCI adultos de cuatro grupos clonales (A, B, F y H) de los cuales el grupo A y B están cercanamente ligados. Las cepas aisladas en UCI pediátrica no estaban genéticamente relacionadas (grupos E y G). Varias de las cepas analizadas poseen plasmidios, los que se aislaron y traspasaron a E. coli DH5a no transfiriéndose la resistencia a IMP a esta bacteria, lo cual indicaría que la resistencia a IMP en estas cepas se localizaría a nivel cromosomal.

 

27. SEGUIMIENTO epidemiológico de Staphylococcus aureus Meticilino Resistente, aislados de pacientes del hospital base valdivia, mediante genotipificación del gen mecA. (Epidemiological analyses of Staphylococcus aureus methicillin-resistant, isolated of patients from Hospital Base Valdivia, by genotypification assays of gene mecA) Medina. G1, Otth. C1, Fernandez. H1, Gil. M2, von Chrismar. A3, Otth. L1, Arce. M4, Lizama. V4, Zaror. A4 y Wilson, M1.
1Instituto de Microbiología Clínica, Facultad de Medicina, Universidad Austral de Chile; 2Servicio de Salud Valdivia, 3Instituto de Bioquímica, Facultad de Ciencias, Universidad Austral de Chile. Laboratorio Central, Unidad de Microbiología, Hospital Base Valdivia. myrawilson@uach.cl
Financiamiento: DID-UACh 2004-64

Staphylococcus aureus es la especie más aislada en procesos supurativos del hombre, constituye un importante agente de infección intrahospitalaria. Su reservorio comprende la zona nasofaríngea y piel de portadores. S. aureus presenta diferentes mecanismos de resistencia a antibióticos b-lactámicos, siendo el más relevante la resistencia intrínseca a meticilina generada por la síntesis de PBP2a codificada en el gen mecA.
Las cepas de S. aureus meticilino-resistentes (SAMR) presentan una región cromosómica -"gen mecA"- asociada a la resistencia a meticilina. Dicha región presenta variabilidad genética, lo que ha permitido su uso en detección y genotipificación de cepas SAMR.
Se genotipificaron 54 cepas de SAMR provenientes de pacientes del Hospital Base Valdivia, aisladas entre los años 2004-2005.
De las 54 cepas con fenotipo SAMR, 51 fueron mecA positivas, las que se agruparon en 6 genotipos según origen clonal común. Esto permitió realizar un seguimiento de las cepas en los servicios implicados mediante un flujograma de infección.

 

28. SUSCEPTIBILIDAD CUANTITATIVA DE Staphylococcus Aureus FRENTE A DIVERSOS ANTIMICROBIANOS. (Quantitative Antimicrobial susceptibility of Staphylococcus aureus against different drugs). Bustamante, N1. Otth, L1. Fernandez, H1. Otth, C1. Gil, M2. von Chrismar, A3. Arce, M4. Lizama, V4. Zaror, A4. Wilson, M.1 (1Instituto de Microbiología Clínica, Facultad de Medicina, Universidad Austral de Chile; 2Servicio de Salud Valdivia, 3Instituto de Bioquímica, Facultad de Ciencias, Universidad Austral de Chile. 4 Laboratorio Central, Unidad de Microbiología, Hospital Base Valdivia. myrawilson@uach.cl)

 

Staphylococcus aureus, patógeno principal de su género, es capaz de producir diversas infecciones, destacando las de origen nosocomial. Constituye parte de la biota comensal de portadores, siendo su hábitat principal el tercio anterior de las fosas nasales.
En la actualidad se ha reportado un aumento significativo de cepas meticilino resistentes (SAMR), las que además presentan resistencia a los derivados b-lactámicos, a otros antibióticos y metales pesados.
Se determinó la susceptibilidad antimicrobiana de 278 cepas recolectadas durante los años 2004 y 2005: 186 fueron aisladas de diversas muestras de pacientes hospitalizados en el Hospital Clínico Base Valdivia y 92 fueron obtenidas de secreción nasal de alumnos portadores de la Facultad de Medicina de la Universidad Austral de Chile. Se utilizó el método de dilución en agar de Ericsson y Sherris y los antimicrobianos utilizados fueron: penicilina, ampicilina, oxacilina, vancomicina, cefradina, ciprofloxacino, gentamicina, lincomicina y eritromicina.
Se obtuvo un 22% de cepas meticilino resistentes. Los antibióticos mas efectivos in vitro fueron vancomicina y oxacilina y los menos activos penicilina y ampicilina.
Financiamiento: DID-UACh 2004-64

 

29. GENES DE VIRULENCIA EN Enterococcus faecalis RESISTENTES A AMINOGLICOSIDOS. (Virulence genes in aminoglycoside resistant Enterococcus faecalis). Silva J1, del Campo R2, Rodríguez Y1, Araya J1, Kühn I3, Navarro Colque P3, Möllby R3, Baquero F2. 1Depto Tecnología Médica, Universidad de Antofagasta, Chile. jsilva@uantof.cl. 2Depto. Bacteriología, Hospital Ramón y Cajal, Madrid, España. 3Tumor Center an Microbiology, Karolisnka Institute, Estocolmo, Suecia.

Infecciones nosocomiales por Enterococcus han aumentado notablemente, debido a la presencia de genes de virulencia y habilidad para adquirir resistencia a los antibióticos a altas concentraciones (HLR). Enterococcus resistentes a los antibióticos son aislados en forma frecuente en los hospitales de Chile. En este estudio se determinó la presencia de genes de virulencia en cepas de E. faecalis susceptibles y resistentes a los aminoglicósidos. Se incluyeron 80 cepas de E. faecalis aisladas de muestras clínicas (52) y carnes de pollos (28) en Antofagasta. Las cepas fueron identificadas por test bioquímicos y tipificadas por el sistema Ph-PlateMR. La susceptibilidad a los antimicrobianos fue determinada por técnica de dilución seriada en agar. Seis genes de virulencia en 24 cepas fueron ensayados por PCR. La mayoría de las cepas fueron susceptibles a vancomicina y ampicilina y con niveles moderados de resistencia a otros antimicrobianos. Un 8,7% de las cepas fueron resistentes gentamicina y el 6,2% a estreptomicina. El total de las cepas presentaron el gen efaA que parece estar presente solo en E. faecalis. La tipificación reveló una gran diversidad de tipos, sin embargo, un clon con 6 cepas con características idénticas o similares fue encontrado. El gen efaA estaba presente en todas las cepas ensayadas. Un 75% de las cepas presentaron los genes aceI y agg y en 10% de las cepas el gen gelE. Los genes cylA y esp no fueron encontrados. Solamente 5 cepas con resistencia a aminoglósidos (HLR) pertenecientes a un mismo clon exhibieron los genes efaA, aceI, agg y gelE. Se concluye que cepas clínicas de E. faecalis resistentes a aminoglicósidos (HLR) están aumentado en Chile y su resistencia está asociada con la presencia de genes de virulencia.
Financiamiento: Proy. PROIM 1357, DINV, Universidad de Antofagasta y Fundación Andes.

 

30. ACCIÓN PROBIÓTICA DE UN PREPARADO VAGINAL CONTENIENDO UNA CEPA DE Lactobacillus acidophilus, EN MUJERES CON VAGINOSIS(Probiotic activity of a vaginal preparation with a L. acidophilus strain in vaginosis in women). Castro, E1-2., Pérez, L2., Sánchez, M2., Solís, A2., Ferrer, J2-3., Melo, C2-3., Rodríguez, A5., Madariaga, J4., Bórquez, R2-3. Depto. Obstetricia y Puericultura1, Lab. Bacterias Lácticas2, Depto. Ingeniería Química3, Depto. Anatomía Patológica4, U. Concepción. C. S. Ramón Nonato. Chillán5.

La vaginosis (VB) caracterizada por una sobrepoblación de bacterias anaeróbicas puede ser recurrente y resistente a los fármacos de elección. Se evaluó la capacidad de restablecer la microflora vaginal de una cepa de L. acidophilus LVP31. Se diseño un ensayo randomizado doble ciego, caso control, el que incluyó 10 mujeres con consentimiento informado. La mitad recibió placebo y la otra, 5ml durante cinco días de un preparado fresco con 10e8Ufc de la cepa. Se monitorizó hasta un mes post administración, la concentración total de anaerobios y Lactobacillus spp., G. vaginalis y Mobiluncus spp. Los lactobacilos aislados fueron identificados y caracterizados en sus propiedades benéficas. Se monitorizó pH, test de aminas, PAP vaginal y criterio de Nugent. La cepa inoculada logró permanecer hasta un mes en la mucosa vaginal y restauró completamente 3/5 y parcialmente 2/5 mujeres con VB. Se observó también, una evolución positiva en las muestras citológicas. En los controles, 4/5 conservaron su estado vaginótico. Se dispone de un preparado probiótico vaginal con potencial acción curativa de la VB, el que merece futuras investigaciones.
Investigación desarrollada con aportes del Proyecto FONDEF N°DO1I1121.

31. Epidemiología molecular de la enfermedad de Chagas en el ciclo selvático de Chile. (Molecular epidemiology of Chagas disease in the sylvatic cycle of Chile) Coronado, X., Rozas, M., Botto, C., Ortiz, S y Solari, A. Programa de Biología Celular y Molecular. ICBM. Facultad de Medicina. Universidad de Chile. Independencia 1027, Santiago, Chile.

La enfermedad de Chagas y ciclo de silvestre en Chile está compuesto de mamíferos e insectos Mepraia spinolai. En este estudio se analizan los genotipos de Trypanosoma cruzi en la Reserva Nacional "Las Chinchillas", Se colectaron 200 animales (Thylamis elegans, Octodon degu, Phyllotis darwinii, Abrothrix olivaceous y Capra hircus) y 182 insectos. Se estudió presencia de T. cruzi mediante PCR. El DNA amplificado fue caracterizado mediante análisis de Southern con sondas. La detección en animales fue 44%, mientras que en M. spinolai fue 47%. También se analizó la presencia de T. cruzi en M. spinolai mediante microscopía detectándose un 10%. Un genotipo correspondiente al linaje T. cruzi I es prevalente en el ciclo silvestre de transmisión (53%), aunque en menor frecuencia en animales (28. 7%). Otros genotipos correspondientes al linaje T. cruzi IIc y IId se encuentraron en 20. 4% y 21. 2% en insectos, mientras que en 35% y 43% en animales, respectivamente, aunque existen otros aún no identificados. Estos 3 genotipos se pueden encontrar puros o combinados, lo cuál indica que las cepas son mezclas de parásitos. Los genotipos de T. cruzi detectados en cada hospedero varían, lo cual indicaría que estos presentan diferentes capacidades adaptativas.
FONDECYT 104-0762

 

32. IDENTIFICACIÓN Y CARACTERIZACIÓN MOLECULAR DE STREPTOCOCCUS SP. Y VIBRIO SP. AISLADOS DESDE SALMÓNIDOS (Identification and molecular caracterization of Streptococcus sp. and Vibrio sp. isolated from salmonids) Valdés, I., Silva, A., Acevedo, C., Jaureguiberry, B. Veterquímica Ltda. (Patrocinio: Fernandez, J. ISP Chile)

Se realizó un muestreo dirigido en peces con cuadro clínico, en planteles bajo sospecha de infección, en un área que comprendió la IX, X y XI regiones de Chile. La recolección, aislamiento e identificación mediante pruebas bioquímicas de los patógenos, se realizó en laboratorios especializados en salud de peces(ADL, Fundación Chile, Biovac). Se aislaron 65 Vibrio sp. y 41 Streptococcus sp. Con el fin de identificar y caracterizar molecularmente los aislados se realizó: Amplificación y secuenciación 16S rDNA, PCR específico para Streptococcus phocae, amplificación y RFLP de región intergenica 16S-23S, PFGE, patrón proteico y de LPS. Se Identificaron dos especies de Vibrios, Vibrio ordalli y Vibrio anguillarum. Vibrio anguillarum presentó una alta variabilidad en el patrón proteico, además de diferencias moleculares detectadas por PFGE. Por el contrario Las cepas de Streptococcus analizadas, correspondieron a Streptococcus phocae, las cuales presentaron alguna variabilidad entre los aislados incluidos en este estudio. La identificación y caracterización molecular constituyen una herramienta importante, para una adecuada elección de cepas, en futuros estudios de inmunogenicidad, orientados a la preparación de vacunas y vacunas autógenas.

 

33. DETECCIÓN DE ANTICUERPOS ANTI-BRUCELLA EN MÉDICOS VETERINARIOS MEDIANTE DOS PRUEBAS DIAGNÓSTICAS (Detection of Brucella antibodies from veterinaries through two diagnostics test) López Martín J., Latorre A., Riquelme F., Sandoval D., Araya C. Lab. Microbiología Veterinaria. Departamento Patología. Facultad Medicina Veterinaria. Universidad de Concepción. jlopez@udec.cl

Brucelosis, enfermedad-infecto-contagiosa mundialmente difundida, de carácter ocupacional por contacto directo con sangre, fetos, placenta, secreciones uterinas, de diferentes especies animales. En humanos presenta variada manifestación clínica, esto dificulta el diagnóstico. Estudios de prevalencia con distintas pruebas serológicas (SAT, 2-mercaptoetanol, Coombs, ELISA) en zonas enzoóticas fluctúan entre 3-11%. En Chile, la brucelosis animal está bajo programa de Control y Erradicación (prevalencia entre 3-7%) utilizándose Rosa Bengala (RB) como prueba screening, cualitativa, alta sensibilidad detectando IgG1, como prueba confirmatoria, cuantitativa, Fijación de Complemento (FC) ó ELISA de competencia. El objetivo, detectar anticuerpos anti-Brucella en Médicos Veterinarios que trabajan en zonas enzoóticas de brucelosis mediante RB y Brucellacapt (BC), prueba de inmunocaptura-aglutinación que detecta anticuerpos totales anti-Brucella en humanos. Se muestrearon 119 sueros de profesionales acreditados para saneamiento predial PABCO entre Julio-Octubre 2004, detectándose 7, 6% de sueros positivos con RB, 9, 2% con BC. Sensibilidad relativa de BC en relación a RB fue 100%, Especificidad relativa, 98, 2%. Valor predictivo positivo (VPP) fue 81, 8%, VPN, 100%. Ambas pruebas con alto nivel de concordancia (valor kappa cercano a 1). Con BC, 9 sueros fueron positivos 1/320, 2 sueros Título 1/640. Títulos superiores 1/320 indicativo de brucelosis, sin embargo, en zonas enzoóticas, títulos 1/320, incluso inferiores, podrían considerarse positivos.

 

34. SERORREACCIONANTES A SEROVARES DE LEPTOSPIRA EN GRUPO PROFESIONAL DE ALTO RIESGO (Serologics-reactors to Leptospira serovars in high-risk professional group) López Martín J., Latorre A., Riquelme F., Limarí M., Barlaro E. Lab. Microbiología Veterinaria. Departamento Patología. Facultad Medicina Veterinaria. Universidad de Concepción. jlopez@udec.cl

Leptospirosis, enfermedad infectocontagiosa de animales y humanos. Los Médicos Veterinarios están expuestos por manipulación de animales enfermos o portadores. La presentación es variable, desde asintomático hasta forma ictérica con 40% mortalidad. Es notificada mundialmente, mayor incidencia en países tropicales. En Chile se presenta en verano-otoño con una tasa de incidencia de 0, 43%. Desde 2002 es de declaración obligatoria. En bovinos, prevalencia de 59, 2%-91, 7%, caprinos 24, 9%, ovinos 7, 1%, equinos 48, 5%, porcinos 69, 9%. El objetivo, detectar anticuerpos contra serovares de Leptospira spp en Médicos Veterinarios que trabajan en saneamiento predial bovino. Se obtuvieron 94 sueros de profesionales acreditados para saneamiento predial PABCO entre Julio-Octubre 2004, sometidos al MAT con antígenos de referencia, serovar hardjo, pomona, canicola, ballum, grippotyphosa, tarassovi, autumnalis y copenhageni, mantenidos en EMJH, 30ºC/5-7 dias, estandarizados a 70%T (400 nm). La dilución screening, 1: 25 y la titulación seriadas al doble. La reacción Ag-Ac a 37ºC/1 hora y el % de aglutinación por Microscopía Campo Oscuro (160x). Del total, 15(15, 96%) resultaron serorreaccionantes a serovares de Leptospira, con hardjo, 2(13, 33%) titulo 1/25, con pomona y copenhageni, 3(20, 0%) títulos 1/25 en 2 casos y 1/100 en uno. Con canicola, ballum y co-aglutinación hardjo-grippotyphosa, 1(6, 67%) títulos 1/25 en cada caso, y con grippotyphosa, 4(26, 67%) titulo 1/25 en un caso y 3 con 1/50. Se discute la interpretación de resultados.

35. EFECTO DE HORMONAS ESTEROIDES SOBRE EL CRECIMIENTO Y VIABILIDAD DE Entamoeba histolytica. Cervantes-Rebolledo C, Morales-Montor J, Moreno N, Saavedra E*, Laclette JP y Carrero, J.C. (Instituto de Investigaciones Biomédicas, UNAM e *Instituto Nacional de Cardiología. México D. F., México)

La exposición in vitro de trofozoítos Entamoeba histolytica a los esteroides sexuales 17 b-estradiol, progesterona, y dehidrotestosterona, tuvo poco efecto sobre la viabilidad o proliferación del parásito. Sin embargo, el tratamiento con el esteroide adrenal dehidroepiandrosterona (DHEA) inhibió marcadamente su proliferación, adherencia y motilidad, así como indujo lisis de los trofozoítos a altas dosis. El efecto opuesto sobre la proliferación, pero más discreto, se encontró cuando los trofozoítos fueron expuestos a`cortisol. Igualmente, DHEA disminuyó mientras cortisol aumentó la replicación de ADN de los parásitos determinado en ensayos de incorporación de timidina tritiada. Por otra parte, ensayos de tinción con ioduro de propidio y de TUNEL sugieren que los trofozoítos mueren por un proceso de necrosis mas que por apoptosis. Dos posibles mecanismos de acción de la DHEA sobre la amiba se derivaron de experimentos demostrando que la actividad de una enzima de la vía de síntesis del colesterol, 3-hydroxy-3-methyl glutaryl CoA reductasa, fue inhibida en presencia de la hormona, así como que flutamida, un análogo no esteroide de DHEA, revirtió el efecto inhibitorio de la hormona sugiriendo la presencia en la amiba de un receptor para DHEA. Contrario a su efecto inhibitorio in vitro, la administración de DHEA a hámsteres resultó en la exacerbación de abscesos hepáticos amibianos. Este trabajo sugiere que el sistema endocrino del hospedero puede influir en el establecimiento y desenlace de la infección amibiana en humanos.

 

MICROBIOLOGÍA AMBIENTAL

36. ENSAYO "REC" CON Bacillus subtilis USADO PARA EVALUAR LA REMOCIÓN DE LA GENOTOXICIDAD POR EL TRATAMIENTO DE EFLUENTES DE LA INDUSTRIA DE CELULOSA KRAFT. (Bacillus subtilis rec assay in the evaluation of genotoxicity of kraft pulp efluents) Oñate1, E., Xavier1, C., Belmonte1, M., Vidal1, G., Mondaca2, M. A. 1Centro de Ciencias Ambientales EULA-Chile, 2Departamento de Microbiología, Facultad de Ciencias biológicas. Universidad de Concepción. mmondaca@udec.cl

Los efluentes de industria de celulosa Kraft contienen toxicidad debido a la presencia de compuestos extractivos de la madera liberados durante el proceso de pulpaje. El objetivo del presente trabajo fue evaluar la remoción de la genotoxicidad en efluentes de celulosa Kraft tratados por lodo activado (LO) y laguna aireada (LA), utilizando el ensayo "rec" con Bacillus subtilis. Las muestras de efluentes, fueron analizadas antes y después de ser tratadas por LO y LA. El ensayo se realizó utilizando las cepas de B. subtilis PB 1652 (rec+) y B. subtilis PB 1791 (rec-). Se calcularon los valores de eficiencia de placas (A), y se realizaron análisis de varianza (ANOVA-LSD). Los resultados indican que los efluentes no tratados muestran genotoxicidad (A<1). Ambos tratamientos biológicos, LO y LA, reducen la genotoxicidad de tales efluentes. El LO presentó una mayor remoción de esta (A=1, 030) en relación a la LA (A= 0, 979) (p>0, 05). En conclusión, los sistemas de tratamiento biológico, LO y LA, remueven la genotoxicidad de los efluentes de celulosa Kraft entre un 4 y 10 %.
Fondecyt 1040987.

 

37. BIOAUMENTACIÓN DE s-TRIAZINAS EN SUELOS SIN HISTORIAL PREVIO DE APLICACIÓN DE HERBICIDAS. (Bioaugmentation of s-triazines in soils without previous herbicide application). Flores C.1, Morgante V.1, González M.1, Vásquez M.2 y Seeger M. 1 1Laboratorio de Microbiología Molecular y Biotecnología Ambiental, Universidad Técnica Federico Santa María, Valparaíso, Chile. 2Laboratorio de Biotecnología, INTA, Universidad de Chile, Santiago. cecilia. flores@alumnos. utfsm.cl

Simazina es un herbicida del tipo s-triazinas utilizado para control de malezas en Chile y en el mundo. En suelos tratados con s-triazinas, las comunidades microbianas son las principales responsables de su degradación. La atenuación de simazina en suelos sin historial de aplicación de s-triazinas, se estudió mediante bioaumentación con la bacteria nativa Pseudomonas sp. P41. Simazina fue adicionada en los microcosmos como Gesatop®. Durante 4 semanas Pseudomonas sp. P41 se inoculó inmovilizada en alginato de sodio. El muestreo de suelo se realizó semanalmente para la cuantificación de simazina (HPLC), el recuento en placa de heterótrofos totales y la estimación de la actividad catabólica de simazina (ACS) mediante número más probable en microplacas. Durante las primeras semanas solo se observó ACS en microcosmos bioaumentados. Se evidenciaron diferencias en RHT entre suelos controles e inoculados. La vida media de simazina en los suelos inoculados fue de 15 días. En microcosmos control no se detectó degradación de simazina. Este estudio demuestra que Pseudomonas sp. P41 es una cepa nativa capaz de degradar simazina en suelos sin historial de aplicación de s-triazinas pudiendo ser utilizada en estrategias de biorremediación.
Agradecimientos: proyectos EU-ICA4-CT-2002-10011, Perkin Elmer y USM 30522.

 

38. ANÁLISIS MOLECULAR DE BACTERIAS PARA LA BIORREMEDIACIÓN DE AGROQUÍMICOS EN SUELOS AGRÍCOLAS. (Molecular analysis of bacteria for bioremediation of agrochemicals in agricultural soils). Hernández, M., Villalobos, P., González, M., y Seeger, M. Laboratorio de Microbiología Molecular y Biotecnología Ambiental, Departamento de Química, Universidad Técnica Federico Santa María, Valparaíso. matehg@hotmail. com

El valle de Aconcagua ha sido ampliamente perturbado por la producción agrícola. El masivo empleo de herbicidas tipo s-triazinas, como la simazina, podría ocasionar graves problemas de contaminación de aguas. Se postula que suelos agrícolas tratados con este herbicida poseen una activa microbiota degradadora de este compuesto. Anteriormente, se aislaron 32 cepas con capacidad de utilizar simazina desde suelos de cultivos de palta Persea americana y caqui Diospyros chinensis tratados con este herbicida y suelos control. Mediante PCR se observó que nueve de los aislados presentaron todos los genes (atzA, atzB, atzC, atzD, atzE y atzF) de las rutas catabólicas de s-triazinas. Los restantes aislados poseen al menos un gen de las mencionadas rutas. Se determinó mediante un ensayo con células en reposo, que todas las cepas, que presentaron las vías catabólicas de simazina completas, degradan este herbicida. A través del análisis de fragmentos de restricción de longitud polimórfica (RFLP) del gen ARNr 16S, se diferenciaron distintos patrones de restricción, correspondientes a distintas especies bacterianas. Este estudio indica que bacterias aisladas del valle de Aconcagua capaces de degradar simazina, poseen el potencial para ser utilizadas en la biorremediación de estos agroquímicos.
MS agradece el financiamiento de proyectos EU-ICA4-CT-2002-10011 y USM 130522.

 

39. Soil bioremediation through bioaugmentation with Cupriavidus necator JMP134 is affected by soil protozoa. (Bioremediación de un suelo a través de bioaumentación con c. `necator JMP134 es afectada por protozoos de suelos). Manzano M., Tesser B., and B. González. Depto. de Genética Molecular y Microbiología, and Center for Advanced Studies in Ecology and Biodiversity. Facultad de Ciencias Biológicas. P. Universidad Católica de Chile. Santiago, Chile. mmanzano@bio. puc.cl

One of the potential problems in bioremediation using bioaugmentation with specialized bacteria is low survival. Abiotic and biotic factors have been proposed to explain low survival rates. Cupriavidus necator JMP134 is the best studied strain able to degrade 2, 4-D, an herbicide widely used in agriculture. We studied the effect of abiotic and biotic factors in the catabolic performance of C. necator in soil microcoms exposed to 2, 4-D. In microcosms with irradiated soil, C. necator survived well and efficiently degraded the herbicide. However, in normal soils the survival and catabolic performance of the strain strongly decreased. The inoculation of this strain did not affect the structure of the bacterial community as judged by the terminal restriction fragment length polymorphisms analysis of the rRNA genes in soil microbial DNA. However, the eukaryotic microbial fraction transiently changed, suggesting that the presence of C. necator stimulated a fraction of these microorganisms. Further support for this idea was obtained from the isolation, after continuous feeding of a soil extract with C. necator JMP134, of a protozoan whose 18S rRNA has high identity (92%) to the colpodid ciliate group.
This work was supported by FONDAP-FONDECYT (grant 1501-0001, program 7), and by the ICA4-CT-2002-10011 (ACCESS) grant of the European Union.

 

40. THE BACTERIAL COMMUNITY OF AN AGRICULTURAL SOIL AND THE DIVERSITY OF TFDA GENES ARE IMPACTED BY PHENOXYALKANOIC HERBICIDES. (La comunidad bacteriana de un suelo agrícola y la diversidad de genes tfdA son impactadas por herbicidas fenoxialcanoicos). Gazitúa, M. C., & González, B. Depto. de Genética Molecular y Microbiología, and Center for Advanced Studies in Ecology and Biodiversity (CASEB). Facultad de Ciencias Biológicas. P. Universidad Católica de Chile. Santiago, Chile. consuelo_gazitua@yahoo. com

Phenoxyalkanoic herbicides such as 2, 4-dichlorophenoxyacetate (2, 4-D), 2, 4-dichlorophenoxybutyrate (2, 4-DB) or mecoprop are widely used to control broad-leaf weeds. Several bacteria have been reported to degrade these herbicides, being the a-ketoglutarate-dependent, 2, 4-dichlorophenoxyacetate dioxygenase encoded by the tfdA gene, the enzyme catalyzing the first step in the catabolic pathway. In this work, the effects of continuous exposure to different herbicides in the bacterial community and the tfdA genes diversity were assessed using agricultural soil microcosms. Total community bacterial DNA was analyzed by terminal restriction fragment length polymorphisms and detection and cloning of tfdA sequences using degenerate PCR primers. After four months of exposure to herbicides, significant changes in the bacterial community structure were detected in soils treated with mecoprop, 2, 4-DB and a mixture including 2, 4-D. An impressive variety of tfdA sequences was also found in these treated soils. More than 40 new sequences clustered in five new groups were determined, which are unequally distributed in soil depending on the specific herbicide treatment.
This work was supported by FONDAP-FONDECYT (grant 1501-0001, program 7), and the ICA4-CT-2002-10011 (ACCESS) grant from the European Union.

 

41. RELACIÓN ENTRE SEIS MALEILACETATO REDUCTASAS INVOLUCRADAS EN EL CRECIMIENTO DE CUPRIAVIDUS NECATOR JMP134 EN VARIOS COMPUESTOS XENOBIÓTICOS. (Interplay between six maleylacetate reductases involved in growth of Cupriavidus necator JMP134 on several xenobiotic compounds.) Sánchez MA, & González B. Depto. Genética Molecular y Microbiología, Facultad de Ciencias Biológicas, P. Universidad Católica de Chile. masanche@puc.cl

Maleylacetate reductases (MAR) have been involved in the degradation of aromatic compounds carrying unusual substituents such as halogen atoms or nitro groups. Two MAR genes (tfdF1 and tfdF2) encoded in specialized gene clusters of the plasmid pJP4 from Cupriavidus necator JMP134, have been involved in the turnover of chlorocatechols. The complete genomic sequence of C. necator JMP134 has revealed the presence of four additional sequences putatively encoding MAR (tcpD, pnpD, tftE and mnpE). We generated mutant strains in each of these six sequences by insertional inactivation, and evaluated their abilities to grow on different substrates which are degraded through maleylacetate. In addition, specific MAR transcripts were detected by RT-PCR in the wild type and mutant strains. The results show that tfdF1 is the most important gene when the strains are exposed to compounds that produce substituted chlorocatechols as intermediates in their transformation (2, 4-dichlorophenoxyacetic acid, 3-chlorobenzoate and 2-methyl-4-chlorophenoxyacetic acid). In turn, tcpD is involved in 2, 4, 6-trichlorophenol degradation, but it is not essential. Despite that tfd2, pnpD, tftE and mnpE are expressed in several cases they do not contribute significantly to maleylacetate turnover because the corresponding mutants grow normally on several compounds.
This work was financed by a FONDECYT 1030493 grant and a CONICYT PhD fellowship.


42. VARIOS REGULADORES TRANSCRIPCIONALES TIPO LYSR CONTROLAN A LOS GENES TFD QUE CODIFICAN POR LA DEGRADACIÓN DE CLOROAROMÁTICOS EN C. NECATOR JMP134. (Several LysR transcriptional regulators control the tfd genes encoding chloroaromatic degradation in Cupriavidus necator JMP134.) Trefault, N. Pérez-Bollweg, H. & González, B. Depto. de Genética Molecular y Microbiología, Facultad de Ciencias Biológicas, P. Universidad Católica de Chile. nntrefau@puc.cl

Bacteria play a key role in chloroaromatic degradation. Cupriavidus necator JMP134, one of the best studied models, grow on 2, 4-dichlorophenoxyacetate (2, 4-D) or 3-chlorobenzoate (3-CB) using two isofunctional but not identical gene clusters, tfdI and tfdII, located in the pJP4 plasmid. Two identical genes, tfdR and tfdS belonging to the LysR transcriptional regulators family control the expression of tfd genes. The role of a third LysR regulator encoded in pJP4, tfdT, is unclear because its C-end is interrupted by ISJP4. In addition, two other LysR type gene regulators, catR1 and catR2, control the expression of chromosomal genes involved in degradation of the non chlorinated analogue, benzoate. It has been proposed that regulatory cross-talk can occur in (chloro)aromatic degradation. We studied the role of tfdT, catR1 and catR2 constructing mutants or overexpressing the genes. The tfdT mutant could grow on 3-CB at higher concentrations than the wild type, whereas the effect on 2, 4-D was much less pronounced, suggesting that tfdT acts as a transcriptional repressor. Overexpression of catR1 or catR2 increased the degradation of 3-CB, but the effect with 2, 4-D depended on each regulator. In addition, expression profiles of tfd genes using RT-PCR, showed that both tfd gene clusters are differentially expressed during growth in 2, 4-D or 3-CB.
This work was supported by FONDECYT 1030493. N. T. is a DIPUC Ph. D. fellow.

 

43. ANALYSIS OF PLASMID RECOMBINATION IN CUPRIAVIDUS NECATOR JMP134 (PJP4) DUE TO SELECTIVE PRESSURE IN 3-CHLOROBENZOATE AND 2-METHYLPHENOXYACETATE. (Análisis de recombinación plasmidial en Cupriavidus necator JMP134 (pJP4) por presión selectiva en 3-clorobenzoato y 2-metilfenoxiacetato) Larraín-Linton, J., De la Iglesia, R. Melo, F., & González, B. Dpto. de Genética Molecular y Microbiología, Facultad de Ciencias Biológicas, P. Universidad Católica de Chile. jlarraie@puc.cl

Cupriavidus necator JMP134 (pJP4) is known for its ability to grow on xenobiotic compounds such as 2, 4 dichlorophenoxyacetate (2, 4-D), 3-chlorobenzoate (3-CB) and 2-methylphenoxyacetate (2-MPA), as a sole carbon source. These pathways are encoded in the catabolic plasmid pJP4. The detection, after a prolonged exposure to 3-CB or 2-MPA, of C. necator derivatives that lose their ability to grow on 2, 4-D, or on 3-CB, respectively, has been explained hypothetically by a double homologous recombination between copies of pJP4 that led to the formation of two rearranged plasmid forms, pJP4-F3 and pJP4-FM, respectively. However, the precise molecular mechanisms and kinetics of this recombination remain unknown. The pJP4 plasmid has been recently sequenced, allowing the design of a multiplex PCR that includes key sequences such as genes that are presumably lost during recombination and possible recombination sites, that may provide a more refined explanation of the molecular transition from pJP4 to its recombined forms. The results of monitoring of the recombination process using multiplex PCR are discussed within the framework of double homologous recombination model.
This work was financed by the FONDECYT grant 1030493.

 

44. BIODEGRADACIÓN DE POLICLOROBIFENILOS EN MICROCOSMOS DE SUELO (Biodegradation of polychlorobiphenyls in soil microcosmos). Acevedo, F., González, M. y Seeger, M. Laboratorio de Microbiología Molecular y Biotecnología Ambiental, Departamento de Química, Universidad Técnica Federico Santa María, Valparaíso. michael.seeger@usm.cl

Los policlorobifenilos (PCBs) son contaminantes orgánicos persistentes ampliamente distribuidos en el medio ambiente. Se evaluó la biodegradación de PCBs, en microcosmos de suelo, adicionando la bacteria nativa Burkholderia xenovorans LB400 o una bacteria modificada genéticamente Wautersia eutrophus X34. La cepa X34 es capaz de mineralizar PCBs en medios acuosos. Los microorganismos se siguieron por recuento en placas selectivas y los PCBs en suelo se cuantificaron mediante GC-MS. Asimismo, se evaluó la mineralización de PCBs en ensayos de respirometría.
En microcosmos no estériles, la cepa X34 degradó más rápidamente los PCBs que la cepa LB400. En una semana la cepa X34 degradó completamente los monoclorobifenilos y un 80% de 2, 4´-CB. En estas condiciones, la cepa LB400 degradó entre un 50-70% de estos PCBs. La flora bacteriana no afectó la degradación de PCBs por la cepa X34, pero afectó el catabolismo de LB400. En suelos estériles la diferencia de degradación de los PCBs por las dos cepas fue menor. La producción neta acumulada de CO2 en los respirómetros tiene semejante comportamiento para ambas cepas, indicando mineralización de los PCBs. Este estudio demuestra que la cepa recombinante X34 es eficiente en la mineralización de PCBs en suelos, por lo que se podría emplear para procesos de biorremediación.
MS agradece los proyectos Fondecyt 1020221 y USM 130522.

 

45. CARACTERIZACIÓN MOLECULAR Y MICROSCÓPICA DE BIOPELÍCULAS ANAERÓBICAS ENRIQUECIDAS CON ARQUEAS PRODUCTORAS DE METANO METILAMINOTRÓFICAS (Molecular and microscopy characterization of anaerobe biofilm enriched with methylaminotrofic methane producing archaea) Cárcamo, G1. Ruiz-Tagle2, N. Sossa, K2. Aspe, E3. Urrutia, H2
1
Facultad de Farmacia, Universidad de Concepción 2Facultad de Ciencias Biológicas, Universidad de Concepción3Facultad de Ingeniería, Universidad de Concepción

La degradación anaeróbica de vertidos industriales ricos en sulfato favorece la génesis de H2S por bacterias reductoras de sulfato (BRS), conocido inhibidor de la metanogénesis.
Para resolver el problema se propone limitar la reducción de sulfatos enriqueciendo la biopelícula con arqueas productoras de metano (APM) que consumen metilaminas (fuente de carbono), sustrato no asimilable por las BRS.
Experimentalmente, se enriqueció un reactor de filtro anaerobio con APM metilaminotróficas usando cerámica como soporte. Se alimentó con medio emulado de efluente pesquero con metilamina (0. 2%, p/v) en forma semicontinua por 6 meses. Se analizó morfotipos (MEB), grupos microbianos (hibridación de ARNr 16s), número de grupos (S, por DGGE) y metanizacion (CG).
Los resultados muestran una biopelícula con morfotipos sarcinas, cocos y bacilos. El análisis de ARNr 16s mostró predominio de Methanococcaceae (40%) y una baja fracción de BRS (<5%). El DGGE reveló S=1 para arqueas y S>9 para bacterias. La metanización promedio del reactor fue 75%. Estos resultados son concordantes con lo esperado para una comunidad anaeróbica enriquecida con APM metilaminotróficas.
Finalmente, se obtuvo una biopelícula enriquecida con APM y baja proporción de BRS, relación que se mantuvo estable en el tiempo.

 

46. Análisis de la Comunidad de Bacterias Amonio-oxidantes Pertenecientes la Subclase b-proteobacterias, presente en los sedimentos del Salar de Punta Negra II Región de Chile (Analysis of b-ammonia-oxidizing bacterial community from sediments of an Andean Chilean lake: Salar de Punta Negra, on basis of 16S rRNA sequences). Díaz P. 1, Pozo P. 1, Stegen S1., Alucema A. 1, Leinenweber, G1 y Witzel, K-P2. 1Dpto. Ciencias Químicas y Farmacéuticas, Universidad Católica del Norte Sede Antofagasta 2MaxPlanck Institut für Limnologie Plön, Alemania

En muestras de sedimentos del Salar de Punta Negra (II Región), se analizó la composición de bacterias amonio-oxidantes, pertenecientes a la subclase b-proteobacterias a través del análisis de un fragmento específico del gen del 16S- rRNA. Se observaron escasos representantes del grupo de bacterias autotróficas amonio-oxidantes (AOB), comparativamente con un número mayor de clones de bacterias heterotróficas nitrificantes. Utilizando partidores específicos para la subclase b de las proteobacterias amonio-oxidantes, se determinó la presencia de secuencias del tipo Nitrosomonas y Nitrosospira, como únicos miembros del grupo de las AOB. Junto con esto, las secuencias de heterotróficos amonio-oxidantes, estuvieron dominadas por la presencia de Alcaligenes faecalis. Se observaron diferencias en la composición de clones encontrados, las cuales fueron asociadas a diferencias fisicoquímicas de los sedimentos, tales como los niveles de salinidad y nitratos y con otros factores, como la presencia de avifauna autóctona (flamencos). Una hipótesis para explicar la baja abundancia del grupo AOB en los sedimento, se basa en la rápida depleción del oxígeno en los primeros milímetros del sedimento del salar.

 

47. ESTRUCTURA DE LA COMUNIDAD DE BACTERIA AMONIO-OXIDANTE EN SEDIMENTOS IMPACTADOS POR LA INDUSTRIA SALMONERA. (Community structure of ammonia-oxidizing bacteria in salmon farm sediment) 1Campos, V., 1Valenzuela, C., 1Mondaca, M. A. (1)Departamento de microbiología. Facultad de Ciencias Biológicas. Universidad de Concepción. vcampos@udec.cl.

El crecimiento de la salmonicultura a transformado a Chile en el principal productor mundial de truchas y salmones, lo que ha traído consigo una serie de efectos ambientales debido a la introducción de materia orgánica, nutrientes y sustancias químicas al ambiente durante el proceso productivo. En este estudio se investigó el efecto de la incorporación de sustancias orgánicas y químicas sobre la estructura de comunidades bacterianas oxidantes de amonio (OA) en sedimentos de un centro de cultivo de salmones. Se analizaron 2 sedimentos provenientes de centros de cultivo de salmones altamente impactados y un sedimento pristino. La estructura de comunidades bacterianas OA, fue estudiada mediante la amplificación por PCR del rARN 16S (rDNA). Los productos de PCR fueron analizados por la electrofóresis en gel de gradiente denaturante (DGGE). Los análisis de DGGE demostraron diferencias en la composición bacteriana de los tres sedimentos en estudio, detectando, solo en los sedimentos impactados, la presencia de dos grupos bacterianos OA relacionadas filogenéticamente con especies tipo-Nitrosomonas. y tipo-Nitrosospira. Estos resultados demuestran que la alta carga orgánica proveniente de fecas y alimento no consumido por los peces, estaría alterando la composición de la comunidad de bacterias OA, seleccionando nuevas comunidades en sedimentos impactados por centros de cultivo.

 

48. CHARACTERIZATION OF EPIPHYTIC BACTERIAL COMMUNITIES ASSOCIATED WITH ULVA COMPRESSA AND LESSONIA NIGRESCENS IN COPPER CONTAMINATED COASTAL AREAS. (Caracterización de comunidades bacterianas epifíticas asociadas a Ulva compressa y Lessonia nigrescens en zonas costeras contaminadas con cobre). Hengst MB1, González B1 & Correa JA2. 1Depto. Genética Molecular y Microbiología, 2Depto. Ecología and Center for Advanced Studies in Ecology and Biodiversity (CASEB). Facultad de Ciencias Biológicas, P. Universidad Católica de Chile. mbhengst@puc.cl

Bacterial communities are associated with practically all surfaces in marine environments, including seaweeds, which are key structural components of the rocky intertidal zones. The ecological role of seaweeds can be modified by anthropic activities, such as the release of mining or industrial wastes. Ulva compressa (Chlorophyta) and Lessonia nigrescens (Phaeophyta) are common species occurring along the intertidal rocky shores in Chile. We analyzed the structure of bacterial communities associated with algae from control and from copper-impacted sites using terminal restriction fragment length polymorphisms, a culture independent, molecular approach. Ulva compressa and L. nigrescens presented different epiphytic bacterial communities when both species from the same site were compared. On the other hand, when copper-impacted and control sites were compared using the same algal species as substratum, it was found that copper changed the structure of bacterial communities. The effect of copper, however, was modified by the algal species involved: U. compressa or L. nigrescens.
Support was provided by FONDAP-FONDECYT (grant 1501-0001, program 7) and Marine Genomics -CONICYT. FUNDACION ANDES C-13851. M. B. Hengst is a CONICYT fellowship recipient.

 

49. DIVERSITY OF CYANOBACTERIA IN BIOFILMS OF INTERTIDAL ROCKY SHORES EXPOSED TO HIGH LEVELS OF COPPER. (Diversidad de cianobacterias en las biopelículas del intermareal rocoso expuesto a altas niveles de cobre). De la Iglesia, R.1 Valenzuela, D.1, Correa, J.2, González, B1. 1Depto. Genética Molecular y Microbiología, 2Depto. Ecología and Center for Advanced Studies in Ecology and Biodiversity. Facultad de Ciencias Biológicas, P. Universidad Católica de Chile. rdelaigl@bio. puc.cl.

In marine environments of the north of Chile (Chañaral area), copper contamination has a strong effect in the sessile macroorganisms that live associated to the intertidal rocky zone. However, the effect of high levels of copper exposure in microbial communities is not well understood. For example, high levels of copper could affect cyanobacteria, the most diverse groups of photosynthetic microorganisms found in a wide variety of ecosystems, resulting in a decrease in the photosynthetic rate. To understand if copper has an effect in the diversity and number of taxa of cyanobacteria, a culture independent molecular approach, the RFLP analysis of the 16S rDNA genes, was applied on samples from two exposed sites and two control sites. A similar analysis (T-RFLP) was performed targeting the total bacterial community. The results show a clear effect of copper in the structure of the cyanobacteria group, and in lesser degree, in the structure of the total bacterial community. Experiments carried out with microcosms exposed at high levels of copper confirmed the results obtained with natural samples.
Financial support was from
FONDAP 1501 0001/CASEB Program 7, Marine Genomics-CONICYT, FUNDACION ANDES C-13851.

50. EFECTO DE LA FUENTE DE CARBONO SOBRE LA DIVERSIDAD DE MORFOTIPOS MICROBIANOS EN UNA BIOPELÍCULA ANAEROBIA (Effect of carbon source on the microbial morphotype's diversity on an anaerobic biofilm) Andrades, D1. Ruiz-Tagle, N2. Urrutia, H2.
1Facultad de Ciencias Naturales y Oceanográficas.
2Facultad de Ciencias Biológicas, Universidad de Concepción. Casilla 160-C, Concepción, Chile.

Ambientes anaerobios ricos en sulfato y acetato, favorecen el crecimiento de bacterias reductoras de sulfato (BRS), y ciertas fuentes de carbono de la vía metanogénica (metilaminas) estimulan a arqueas productoras de metano metilaminotróficas (APM), alterando la diversidad microbiana. Considerando que las biopelículas microbianas son resistentes a estrés ambiental, el objetivo de este trabajo fue determinar cambios en la diversidad de la población morfológica de una biopelícula anaerobia, sometida a distintas fuentes de carbono. Para responder esto, se cultivó una biopelícula anaerobia sobre cerámica en medio emulado de efluente pesquero proteico (30 días), previo al cambio de la fuente de carbono. Se usó colina, betaína, glicina, trimetilaminas y metilamina al 1%, p/v. Se muestreó cuadrantes de 1024µm2 sobre cerámica usando microscopía electrónica de barrido. Con los datos obtenidos (por morfotipos) se determinó la diversidad (índice de Shannon-Weaver (H), y sus respectivos índices derivados: riqueza (d) y equidad (e). Resultados muestran diversos morfotipos (cocos, sarcinas, bacilos, bacilos esporulados) y diferencias significativas en la diversidad de biopelículas expuestas a colina y betaína. Esto permite demostrar que diferentes fuentes de carbono intermediarios de la degradación anaeróbica afectan el desarrollo y estructura comunitaria de una biopelícula anaeróbica en formación.

 

51. PRODUCCION DE METILAMINAS Y FORMACIÓN DE BIOPELÍCULAS DE BACTERIAS CONSUMIDORAS DE COLINA, AISLADAS DESDE REACTORES ANAERÓBICOS DE BIOMASA RETENIDA (Methylamine production and biofilm development by methylaminogenic choline consumer strains) 1Aguayo, P., 2Jopia, P., 2Urrutia, H. 2Lab. Biopelículas y Microbiología Ambiental, Fac. Ciencias Biológicas, Universidad de Concepción, 1Universidad Católica de la Ssma. Concepción.

Las bacterias reductoras de sulfato no pueden usar metilamina como fuente de carbono. Por ello estos sustratos estimulan selectivamente la metanogénesis en biopelícula enriquecidas con arqueas productoras de metano metilaminotróficas (APMm). El objetivo de trabajo fue aislar una cepa capaz de producir metilamina a partir de colina. La cepa aislada fue identificada mediante el sistema RapidTM ONE. La determinación cualitativa y cuantitativa de aminas producidas se realizó por espectrometría infrarroja y cromatografía líquida de alta resolución (HPLC). La formación de biopelículas sobre cerámica fue observada por microscopía electrónica de barrido y los parámetros cinéticos se estimaron mediante el modelo de crecimiento de Gompertz. Los resultados indicaron la presencia de un bacilo Gram negativo, fermentador, catalasa y oxidasa negativo, del Dominio Bacteria, Phylum Proteobacteria, Clase b-Proteobacteria. La biopelícula fue capaz de producir 3. 13[ag *día-1 cél-1] de monometilamina, alcanzando una tasa de crecimiento máxima específica de formación de biopelículas (mm) de 0, 985 día-1, el valor de recuento máximo por cm2 de superficie (A) fue 25. 2*107 cél/cm2. Los resultados demuestran la capacidad metilaminogénica de la cepa aislada adherida a soportes de cerámica, lo que aseguraría la producción de monometilamina a partir de sustratos intermediarios de la degradación de proteínas.
Fondecyt 1020999.

 

52. DISEÑO Y ESTUDIO DE UNA BIOPELÍCULA ANAEROBIA MIXTA, CONSTITUIDA POR ARQUEAS METANOGÉNICAS METILAMINOTRÓFICAS Y BACTERIAS METILAMINOGÉNICAS (Design and study of a mixed anaerobic biofilm constituted by methylaminotrophic methanogenic archaea and methylaminogenic bacteria) Jopia, P. 1, Aguayo, P. 2, Urrutia, H.1 1Lab. Biopelículas y Microbiología Ambiental, Fac. Ciencias Biológicas, Universidad de Concepción. 2Universidad Católica de la SSma Concepción. Fondecyt 1020999.

Las metilaminas son una fuente de carbono que favorece el crecimiento de arqueas productoras de metano (APM) por sobre bacterias reductoras de sulfato. Se postula que al enriquecer una biopelícula anaerobia con bacterias metilaminogénicas se estimularía la metanogénesis aun en presencia de vertidos ricos en sulfato. Se aislaron cepas bacterianas metilaminogénicas usando betaína (0. 5%) y colina (0. 5 %) como precursor de monometilamina, caracterizándolas fenotípica, molecular y cinéticamente durante la formación de biopelículas tempranas. Se formaron biopelículas anaerobias mixtas entre estas cepas y una cepa arquea metanogénica metilaminotrófica, evaluando los resultados mediante la formación de biopelículas por microscopía electrónica de barrido y la producción de monometilaminas y de metano mediante cromatografía líquida y gaseosa. Luego de 30 días de incubación, los resultados indicaron la formación de biopelículas tempranas sobre el soporte, registrándose la presencia de metano (5% del biogás) en fase gaseosa, concluyéndose que el cultivo entre ambas cepas, bacterianas metilaminogénicas y arquea metanogénica metilaminotrófica, permitiría el acoplamiento del consumo de colina/betaína con la producción de metano. Se postula que enriquecer biopelículas anaeróbicas con bacterias metilaminogénicas es una eficiente estrategia para estimular la metanogénesis en el tratamiento de residuos ricos en sulfato.

 

53. Efecto del cloramfenicol y la arginina sobre la producción de toxinas paralizantes en Cylindrospermopsis raciborskii D9. (Effect of chloramphenicol and arginine on paralytic toxin production in Cylindrospermopsis raciborskii). Soto, K.1, Stucken, K.1, Méndez, M. A.2, Lagos, N.3 y Vásquez, M.1
1
Laboratorio de Biotecnología, Instituto de Nutrición y Tecnología de los Alimentos, Universidad de Chile.
2Laboratorio de Bioinformática y Expresión Génica, Instituto de Nutrición y Tecnología de los Alimentos, Universidad de Chile.
3Laboratorio de Bioquímica de Membrana, ICBM, Universidad de Chile

C. raciborskii D9 es una cianobacteria filamentosa de agua dulce, proveniente de Brasil, productora de saxitoxina (STX) y gonyautoxina (GTX2 y GTX3). Estas toxinas son producidas también por dinoflagelados marinos (ejemplo: Alexandrium catenella). Los precursores de estas toxinas, tanto en cianobacterias como en dinoflagelados son, 3 moléculas de arginina, 1 de metionina y 1 de acetato.
Con el propósito de estudiar las vías metabólicas involucradas en la síntesis de VPM, se evaluó el efecto de cloramfenicol (CAM), inhibidor de la síntesis proteica, y la arginina. El crecimiento celular fue estimado mediante cuantificación de clorofila y proteínas. La producción intracelular de VPM fue cuantificada por HPLC y derivatización post-columna.
El CAM (1 µg•ml-1) inhibe tanto el crecimiento como la síntesis de STX y GTX 2, 3 desde las 24 h de cultivo. En cambio, la suplementación con arginina (10 mM) produce, a las 48 h, de cultivo una disminución en los niveles de STX de un 78%, pero los niveles de GTX no se ven afectados.
Estos resultados indican un comportamiento diferente al descrito para la cepa T3 (productora de STX, y C1, C2), lo que sugiere vías metabólicas diferentes entre ambas cepas.
Agradecimientos: Proyecto Fondecyt 1050433; Núcleo Milenio EMBA.

 

54. USO DE ELECTROFORESIS DE CAMPO PULSADO PARA GENO-TIPIFICAR Y ESTIMAR LAS RELACIONES FILOGENÉTICAS DE LA CIANOBACTERIA Cylindrospermopsis raciborskii. (Use of pulse field gel electrophoresis for genotyping and assessment of the phylogenetic relationships of the cyanobacteria Cylindrospermopsis raciborskii) Stucken, K. 1, Soto, K. 1, Méndez, M. A. 2, Lagos, N. 3, Vásquez, M1.
1 Laboratorio de Biotecnología, Instituto de Nutrición y Tecnología de los Alimentos, Universidad de Chile.
2 Laboratorio de Bioinformática y Expresión Génica, Instituto de Nutrición y Tecnología de los Alimentos, Universidad de Chile.
3 Laboratorio de Bioquímica de Membrana, ICBM, Universidad de Chile

En nuestro país las toxinas paralizantes asociadas a Mareas Rojas son saxitoxina (STX) y sus análogos, producidos por dinoflagelados y por cianobacterias de agua dulce. Los genes responsables de la síntesis de STX se desconocen, por lo tanto no es posible identificar molecularmente a organismos productores.
Cylindrospermopsis raciborskii es una especie de cianobacteria cuyas cepas pueden o no, producir STX o cilindrospermopsina (CYL). Según antecedentes previos, la similitud de la secuencia del RNA ribosomal 16S entre cepas es superior al 99, 1% y no permite asociar el fenotipo toxigénico a un grupo particular.
El objetivo de este estudio es identificar a nivel molecular las cepas toxigénicas.
Nuestros resultados muestran que el análisis de restricción del ADN ribosomal 16S no presenta diferencias cuando se compara con la especie Anabaena circinalis (productora de STX). Las regiones espaciadoras (ITS) entre los genes 16S y 23S presentan polimorfismos y permiten distinguir entre cepas, sin embargo no permiten asociar un fenotipo toxigénico a un patrón particular. Es necesario por lo tanto, encontrar un método para genotipificar y establecer relaciones filogenéticas entre cepas de C. raciborskii.
El análisis de restricción de genoma completo mediante electroforesis en gel de campo pulsado permitió establecer diferencias entre cepas de C. raciborskii, lográndose estimar: tamaño de genoma (rango de 1, 8 a 2, 2 Mpb); patrón genotípico característico (distingue entre cepas productoras de STX y CYL). Se discuten las relaciones filogenéticas entre cepas.
Agradecimientos: Proyecto Fondecyt 1050433, Núcleo Milenio EMBA.

 

55. DIFERENCIACIÓN DE CLONAS DE Vibrio parahaemolyticus POR LOS PATRONES OBTENIDOS CON ENZIMAS DE RESTRICCIÓN EN FORMA DIRECTA. (Identification of clonal isolates of Vibrio parahaemolyticus by direct restriction enzyme analysis of their genomes (DGREA)). Fuenzalida L., J. Romero y R. T. Espejo. Instituto de Nutrición y Tecnología de los Alimentos, Universidad de Chile. e-mail: loretoffi@hotmail.

Vibrio parahaemolyticus es una especie bacteriana que habita en las aguas costeras. Algunas cepas de esta especie pueden localizarse en mariscos y causar fuertes diarreas en humanos al ser ingeridas. Por su modo de reproducción las poblaciones bacterianas están constituidas por grupos clonales y solo algunos clones son patógenos. Por esta razón la comprensión de la propagación y conservación de V. parahaemolyticus patógeno requiere distinguir los clones patógenos y no patógenos. Esta distinción resulta imprescindible para estudiar los brotes de diarrea producidos por V. parahaemolyticus en Chile, en los últimos dos veranos, porque han sido generados por un clon particular de esta especie, conocido como el clon O3: K6 del Sudeste Asiático.
Una de las técnicas más comunes para distinguir clones bacterianos es la comparación de los patrones de fragmentos del DNA generados al hidrolizarlo con enzimas de restricción. Sin embargo, los protocolos utilizados hasta ahora para digerir genomas bacterianos generan un conjunto de fragmentos que son difíciles de analizar a menos que se utilicen procedimientos adicionales, tales como hibridación o electroforesis en campo pulsado. Aquí presentamos un método directo, sin procedimientos adicionales, para la obtención de patrones del DNA genómico bacteriano con enzimas de restricción, que permite distinguir clones de V. parahaemolyticus, incluyendo la clon O3: K6 del Sudeste Asiático. Este método incorpora las siguientes etapas: digestión del DNA bacteriano con endonucleasas de restricción con blanco de seis pares de bases, separación de los fragmentos con tamaño entre 2500 a 500 bp por electroforesis en gel de poliacrilamida, y visualización de los fragmentos con la tinción de nitrato de plata, altamente sensible. Presentamos los resultados y mostramos que tiene el mismo índice de discriminación que RFLP-PFGE. Finalmente, discutimos el uso de este método para la tipificación de cepas de otras especies bacterianas así como algunas de sus posibles aplicaciones en epidemiología y ecología.
Proyecto FONDECYT 1040875

 

56. TRANSPORTE DE Salmonella enteritidis POR Alphitobius diaperinus: ENSAYO BAJO CONDICIONES DE LABORATORIO. (Carriage of Salmonella enteritidis by Alphitobius diaperinus: assay in laboratory conditions). Retamales, J., Robeson, J.
Pontificia Universidad Católica de Valparaíso, Instituto de Biología, Laboratorio de Interacciones Microbianas. Av. Brasil 2950 Valparaíso, Chile.

Alphitobius diaperinus es un coleóptero comúnmente presente en la industria avícola y Salmonella enteritidis es un agente infeccioso importante en este contexto. Por tanto, es relevante examinar la capacidad de A. diaperinus de actuar como foco de dispersión de dicha bacteria, problema que se abordó en este trabajo. Se usaron insectos propagados en el laboratorio y para las infecciones se utilizó una cepa rifampicina-resistente de S. enteritidis ATCC 13076. Grupos experimentales de 30 insectos fueron infectados con 5 x 104 y 5 x 106 ufc/ml en la dieta. Los controles no recibieron bacterias. Muestras de 5 insectos cada una, con superficie desinfectada e intactos, fueron maceradas para detectar S. enteritidis a las 24, 48y 72h post infección. También se realizaron infecciones de insectos individuales empleando 1 x 103 ufc por ejemplar. La detección de S. enteritidis fue por enriquecimiento en caldo Rappaport-Vassiliadis y siembra en agar XLD selectivo. Los resultados indicaron la presencia de S. enteritidis a las 24 y 48 horas de exposición, tanto en la superficie externa como en el interior del insecto. Además, determinamos una tasa de infección del 86. 6%, mantenida al menos por 24h después de una dieta sin bacterias. Concluimos que A. diaperinus sirve de reservorio temporal para S. enteritidis. Además, constituye un modelo experimental útil para estudios de interacción Salmonella-invertebrado.
Tutoría: Dra. Inés Contreras
Financiamiento: PUCV

57. COMPARACIÓN DE TRES MEDIOS SELECTIVOS PARA EL AISLAMIENTO DE ESPECIES DE Arcobacter (Comparison of three culture media for the isolation s. f. Arcobacter species). Ruiz L., Mansilla I., Villanueva M. P., Fernández H.
Instituto de Microbiología Clínica, Facultad de Medicina, Universidad Austral de Chile.
Financiamiento: Proyecto FONDECYT 1030245.

El género Arcobacter esta formado por bacilos Gram negativos curvos considerados como patógenos emergentes, que tienen un hábitat muy diverso.
Se determinó la presencia y frecuencia de las especies del género Arcobacter en 40 muestras de porcinos, 40 muestras de bovinos, 50 muestras de gallinas y 20 muestras de jilgueros, en la Décima Región de los Lagos, Chile, las cuales fueron sembradas simultáneamente en los medios de Houf, de Boer modificado, Arcobacter medium y agar sangre con filtro.
Solamente de las muestras de porcinos y bovinos fue posible aislar Arcobacter. De las 40 muestras fecales de porcinos se aislaron 24 cepas de Arcobacter, siendo A. butzleri la especie más frecuente (91, 7%), seguida de A. cryaerophilus (8, 3%). De las 40 muestras fecales de bovinos se aislaron 21 cepas de Arcobacter, siendo A. butzleri la especie más frecuente (81%), seguida de A. cryaerophilus (19%). Ambas especies fueron aisladas con mayor frecuencia a partir del medio selectivo de Houf y la técnica de filtrado en AS.
El método más efectivo y de mejor rendimiento para el aislamiento de Arcobacter fue el caldo de enriquecimiento de Houf con posterior resiembra en el medio selectivo de Houf.

 

58. EVALUACIÓN DE MUTANTES DE Trichoderma harzianum PARA EL CONTROL BIOLÓGICO DE PATÓGENOS DEL TOMATE (Evaluation of Trichoderma harzianum mutants for the biological control of tomato pathogens). Ríos, J. C., Polanco, R. y Pérez, L. M. Lab. de Bioquímica. Dpto. de Ciencias Biológicas, U. Andrés Bello.

Trichoderma harzianum es un hongo que crece a nivel de la rizósfera y actúa como antagonista de numerosos fitopatógenos del sistema radical del tomate. Un aislado silvestre de este hongo, Th650, biocontrola in vitro y a nivel de campo a patógenos de tomate tales como Rhizoctonia solani, Pyrenochaeta lycopersici y Phytophthora nicotianae. Esta característica permite considerar a este aislado como una alternativa al uso de fungicidas químicos. Para mejorar las características biocontroladoras de Th650 (por ej. secreción de enzimas hidrolíticas, de metabolitos volátiles y difusibles) este hongo fue tratado con nitroso de guanidina. Se obtuvieron 12 mutantes de las cuales NG 6, NG-7, NG-10 y NG-11 se seleccionaron por su mayor desarrollo y capacidad para secretar enzimas biocontroladoras. Su caracterización permitió establecer que NG-7 y NG-11 inhiben más efectivamente el desarrollo de R. solani in vitro a través de metabolitos volátiles y difusibles. Adicionalmente, el nivel de endoquitinasas secretadas por estas mutantes también se correlaciona con el mayor control de R. solani.
Financiamiento: Proyecto FONDECYT 1040531-04, UNAB DI23-02.

59. CARACTERIZACIÓN POR ERIC-PCR DE CEPAS DE Acetobacter aceti ASOCIADAS CON PUDRICIÓN ÁCIDA EN VIDES (Characterization of Acetobacter aceti associated to sour rot in grapes by ERIC-PCR) Rivas P, Troncoso M, Figueroa A y Figueroa G.
privas@inta.cl
Laboratorio de Microbiología, INTA, Universidad de Chile.

Las Bacterias acéticas se asocian con la pudrición ácida (PA) de vides. Acetobacter aceti fue reportado como especie predominante (50/70, 71%) en uvas con PA provenientes de distintas regiones de Chile durante 2003-2004. Objetivo: caracterizar mediante ERIC-PCR cepas de A. aceti aisladas de uvas con y sin pudrición acida. Metodología: Se analizaron 17 cepas de A. aceti, 13 provenientes de uva enferma y 4 de uva sana, de las regiones Metropolitana, IV y V, mediante ERIC-PCR empleando los partidores ERIC1R y ERIC2 según Versalovic et al. Resultados: Se detectaron 13 perfiles diferentes. En aislados de la RM, 2/8 cepas provenientes de uva con PA presentaron un mismo patrón de bandas, mientras los 6 restantes resultaron diferentes. Las cepas de uva afectada de la V región, 3/7 reprodujeron un mismo patrón, pero distinto al de uva sana. En la IV región los perfiles fueron diferentes para las dos cepas de uva sana estudiadas. El mismo patrón se repitió en la RM y V y solo fue detectado en cepas provenientes de uvas con pudrición ácida. En conclusión, existe gran diversidad de cepas de `A. aceti y el uso de ERIC-PCR como herramienta genética sugiere alguna asociación entre determinadas cepas de A. aceti y pudrición acida. Proyecto DI MULT 04-5-2

 

60. DETECCIÓN DE POTENCIALES BIOCONTROLES PARA BACTERIAS ACÉTICAS DE LA PUDRICIÓN ÁCIDA. (Detection of potencial biocontrols for acetic bacteria involved in sour rot.) Abaca P., Figueroa A., Troncoso M., Rivas P., Figueroa G. Laboratorio de Microbiología, INTA, Universidad de Chile.

La Pudrición ácida (Pa) causó un fuerte impacto económico a los productores de uva cv. Red Globe y Thompson Seedless, durante las temporadas 2003-2004, de regiones comprendidas entre la IV y VI. En su origen participan hongos, bacterias y levaduras, entre las especies bacterianas están las del género Acetobacter cuyo control podría contribuir a disminuir el daño que la patología provoca. El objetivo de este trabajo fue detectar in vitro potenciales Biocontroles provenientes de la microbiota nativa de uvas sanas y parras frente a bacterias acéticas provenientes de uvas con síntomas de Pa. El estudio determinó el efecto antagónico de 10 cepas bacterianas provenientes de la microbiota nativa de uvas y parras sanas, frente a 3 bacterias acéticas aisladas de uvas con síntomas de Pa. El sistema de detección empleó dos cepas indicadoras, una de Bacillus subtilis (BGA) y otra de E. coli (ATCC 25922). En los ensayos se usó el método del spot en placas petri. Los resultados mostraron que dos de las cepas evaluadas poseían un fuerte efecto inhibitorio frente a las dos de las tres cepas de Acetobacter aceti (Ac102-5 y Ac130-2) evaluadas. En conclusión, si este resultado se replica "in vivo" ello podría representar una alternativa para el control de los patógenos asociados a la Pa.
Proyecto DI MULT 04/05-2

61. SUSCEPTIBILIDAD A ANTIBIÓTICOS EN BACTERIAS DE LA BIOFLORA NATURAL DE VIDES (Antibiotic susceptibility of the natural vineyard bioflora). Lopez L., Romero S., Figueroa A., Figueroa G.
Facultad Ciencias Químicas y Farmacéuticas e INTA Universidad de Chile.

La aplicación de agentes agroquímicos en la agricultura intensiva parece participar en el incremento de los niveles de resistencia en el ecosistema bacteriano ambiental. Ello constituye un riesgo que pudiera diseminarse a especies fitopatógenas o zoonóticas presentes en el ambiente. Objetivo: Evaluar la susceptibilidad a antimicrobianos en cepas bacterianas obtenidas del ecosistema natural de vides. Métodos: Se evaluó mediante test de difusión en agar la susceptibilidad a 9 antimicrobianos en 52 cepas aisladas de uvas, hojas, sarmientos y el suelo de viñedos ubicados entre la IV y VI Región. Las cepas incluyeron cocos Gram + (15), bacilos Gram+ (31) y cocobacilos Gram + y _ (6). Resultados: Del total de cepas solo 6 (12%) fueron susceptibles a los 9 antimicrobianos evaluados y 4 (8%) presentaron resistencia simultanea a 3 o mas antibióticos. La mayor resistencia se observó para Ac. nalidíxico (29%), estreptomicina, tetraciclina y eritromicina (10%). niveles menores de resistencia fueron detectadas para ampicilina (8%), cefalotina (6%), cloranfenicol (4%), gentamicina y ciprofloxacino (2%). En conclusión, las bacterias del ambiente que rodea a las vides tienen niveles importantes de resistencia a drogas antibióticas que nunca han sido usadas en el campo, algunas de última generación. Esto sugiere que el estrés asociado al uso de agroquímicos pudiera ser la causa de este fenómeno. Proyecto DI MULT 04/05-2

 

MICROBIOLOGÍA ALIMENTOS

62. PROPIEDADES TECNOLÓGICAS DE CEPAS DE ENTEROCOCCUS AISLADOS DE QUESOS DE CABRA ARTESANAL (Technological properties of Enterococcus strains isolated from goat cheese) Rivas P, Troncoso M, Figueroa A. y Figueroa G. privas@inta.cl
Laboratorio de Microbiología, INTA, Universidad de Chile,

Quesos artesanales de cabra de la IV Región son altamente valorados por el consumidor pero no cumplen los criterios de inocuidad. Estos quesos poseen una rica flora láctica que determinan su aroma y sabor. Entre ellos destacan los Enterococcus en quesos de 15 (11x107UFC/g) y 30 días (57x106 UFC/g) de maduración, flora que es eliminada con los procesos de pasteurización. Objetivo: Evaluar mediante técnicas de screening actividad lipolitica, producción de diacetilo y exopolisacáridos en cepas de enterococos provenientes de quesos de cabra. Metodología: La actividad lipolítica se evaluó en 83 cepas en agar crema-Tween 20 y agar tributirina. Los halos de actividad fueron observados a las 48 horas de incubación. La producción de exopolisacárido se evaluó en 53 cepas en TSA glucosa 5% y TSA sucrosa 5%. La presencia de filancia se determinó a las 48 horas de incubación. La producción de diacetilo se analizó en 84 cepas mediante la reacción de Vogues-Proskauer. Resultados: Los resultados mostraron que 23/83 (28%) cepas poseían actividad lipolítica, mientras 3/53 (6%) expresaron filancia en agar sucrosa y solo una cepa mostró ambas propiedades. La producción de diacetilo fue detectada en 66/84 (79%) de las cepas estudiadas. Conclusión: Las cepas de Enterococcus evaluadas pueden encontrar potencial aplicación en la producción de quesos de cabra pasteurizados mejorados. Proyecto FIA-PI-C 2004-1

 

63. PROPIEDADES TECNOLÓGICAS DE Lactobacillus sp. AISLADOS DE LECHE Y QUESO DE CABRA. (Thechnological properties of Lactobacillus sp isolated from goat cheese). Vega N., M. Troncoso, Figueroa G.
Lab. Microbiología, INTA, Universidad de Chile.

Las Bacterias Acido Lácticas participan en procesos fermentativos y de maduración del queso, entre ellas destacan las especies del género Lactobacillus ya que contribuyen al desarrollo de las características organolépticas y reológicas deseables del producto, además de contrarrestar el crecimiento de microorganismos patógenos, sin embargo al pasteurizar la leche son eliminados. Objetivo. Seleccionar cepas de Lactobacillus de leches y quesos artesanales de cabra que posean propiedades tecnológicas para aplicación industrial. Métodos. Se realizó un screening de la actividad lipolítica, producción de exopolisacárido (EPS) y producción de diacetilo en 143 cepas de Lactobacillus mesófilos provenientes de leches y quesos de cabras artesanales de la IV Región. La actividad lipolítica se evaluó en agar MRS con tributirina y tween 20. La producción de EPS se evaluó en agar MRS 5% de sucrosa y MRS 5% de glucosa. La producción de diacetilo se realizó mediante el método Voges _ Proskauer en caldo MRS. Resultados. 80 de las 143(56%) cepas resultaron productoras de diacetilo; 30 (21%) y 24 (17%) mostraron filancia en medio con glucosa y sucrosa, respectivamente. Actividad lipolítica se detectó en solo 2 cepas (1%). En general, 16 cepas (11%) de las 143 probadas fueron capaces de producir al menos dos de las propiedades tecnológicas deseables. Estas cepas serán luego probadas como fermentos en la producción de quesos. Proyecto FIA-PI-C-2004-1

 

64. EVALUACIÓN POR PCR DE GENES DE VIRULENCIA sefA y pefA EN CEPAS DE S. enteritidis DE DIFERENTES FAGOTIPOS DE CHILE PARA IDENTIFICACIÓN EN ALIMENTOS. (Evaluation for PCR of virulence genes sefA and pefA in S. enteritidis strains of different fagotypes of Chile for identification in foods). Araya R.1, Homazábal JC.2, Fernández A.2, Lizama C.1, Araya JE.1, Silva J.1 y Aravena C 1. caaravena@uantof.cl
1FACSA, Universidad de Antofagasta. 2Laboratorio Referencia Enterobacterias. Instituto de Salud Pública de Chile.

Salmonella enteritidis es agente etiológico de enteritis en humanos relacionados con el consumo de productos avícolas. En Chile, S. enteritidis emerge en los 80` con los fagotipos FT8 y FT28 pero, en el brote de 1994-1996 son desplazados por el FT4 y FT1. Actualmente, es un patógeno endémico en el mundo, estudios de fagotipo muestran alta diversidad biológica en períodos no epidémicos. La comunidad científica, en la tarea de dar respuestas en materias de salud e inocuidad de los alimentos, proponen desarrollar técnicas rápidas y específicas para la detección y control de patógenos. En este estudio, proponemos que los genes sefA y pefA son estables en el serotipo Enteritidis y pueden usarse como marcadores de identificación. Para ello, determinamos la presencia de sefA y pefA por PCR en 47 cepas de S. enteritidis incluyendo 13 diferentes fagotipos aislados en Chile (ISPCH). El gen sefA estaba en todas las cepas estudiadas. pefA varió según los partidores utilizados, no obstante la mayoría de los fagotipos son pefA+ excepto una cepa FT20a de baja frecuencia epidemiológica y 1 cepa de 3 del FT4. sefA y pefA son excelentes candidatos como marcadores de identificación para S. enteritidis. (DINV-Universidad de Antofagasta PEI-1307-04).

 

65. DESARROLLO DE PCR MÚLTIPLE PARA IDENTIFICACIÓN DE SEROTIPOS DE SALMONELLA EN ALIMENTOS (Development of multiplex PCR for identification of serotypes of Salmonella in foods). Vilo C., Lizama C.1, Araya JE.1, Silva J.1 y Aravena C. 1caaravena@uantof.cl 1FACSA, Universidad de Antofagasta.

El género Salmonella es agente etiológico de intoxicaciones alimentarias y fiebre tifoidea en humanos, algunos serotipos causan enfermedades en animales de importancia en la industria de alimentos, causando grandes pérdidas económicas. Las aves son un reservorio del serotipo Enteritidis, Pullorum y Gallinarum, en cerdos Choleraesuis, en ganado vacuno Typhimurium, en verduras contaminadas S. typhi, S. paratyphi A y B. La comunidad científica en la tarea de dar respuestas a la salud, a la inocuidad de los alimentos, y a las posibilidades de abrir los mercados, proponen desarrollar técnicas rápidas y específicas que sirvan en la detección y control de patógenos. Por la importancia que tiene en la salud humana como en la industria de alimentos controlar las contaminación por Salmonella proyectamos el desarrollo de PCR múltiple (PCR-m) basándose en genes específicos del género Salmonella, que permita la identificación por serotipo. Se construyeron 4 pares de partidores utilizando secuencias de genes disponibles en genBank (NCBI) utilizando el programa DNASTAR. Como control de género se uso la amplificación del gen inv. Los resultados indican que con los partidores utilizados por PCR-m es posible caracterizar con un determinado perfil los serotipos: Enteritidis, Typhimurium y Typhi, Paratyphi A y Paratyphi B. Sin embargo, S. pullorum y S. gallinarum dan un mismo perfil por PCR-m. La sensibilidad del PCR-m fue de 1000-10000 UFC/mL.
Financiamiento: DINV-Universidad de Antofagasta PEI-1307-04.

 

BIOTECNOLOGÍA

66. DESARROLLO DE ENSAYOS DE DIAGNÓSTICO DE PATÓGENOS DE PECES (Development of diagnostic assays for fish pathogens). Aguayo, J., Bustamante, J., Miquel, A., Seguel, J., Fuentes, V., Valenzuela, P. D. T. y Burzio, L. O. BiosChile I. G. S. A., Zañartu 1482, Santiago.

La industria salmonera sufre importantes pérdidas económicas debida, entre otros, a la enfermedad de la boca roja producida por Yersinia ruckeri, la enfermedad bacteriana del agua fría producida por Flavobacterium psychrophilum, la enfermedad de columna de agua producida por Flavobacterium columnare, la vibriosis producida por Vibrio ordalii y la enfermedad producida por Aeromonas salmonicida atipica. Dentro de este contexto nuestro laboratorio ha desarrollado ensayos de inmunodiagnóstico de aglutinación de partículas de látex e inmunofluorescencia. Para desarrollar estos ensayos fue necesario producir anticuerpos monoclonales contra los diferentes patógenos, los cuales fueron caracterizados por ELISA, inmunofluorescencia, Western blot, y comparando inmunoreactividad con otras patógenos incluido virus. Con los anticuerpos producidos se desarrollaron ensayos de inmunofluorescencia para detectar individualmente los diferentes patógenos en muestras de tejidos de peces infectados. Paralelamente, se activaron partículas de latéx con los anticuerpos específicos para los distintos patógenos y se desarrolló un ensayo aglutinación que permite identificar colonias aisladas en placas de Petri, como un método de confirmación de la identidad del patógeno. Estos ensayos permitirán realizar diagnósticos más rápidos específicos y confiables que aporten a la industria nacional un mejor control de las enfermedades.

 

67. COMPORTAMIENTO DE SUBSTRATO Y OXÍGENO EN Enterobacter Cloacae ENCAPSULADA EN HIDROGELES DE ALGINATO (Substrate and oxygen behaviour in Enterobacter cloacae encapsulated in alginate hydrogels). Acevedo, C., Albornoz, F., Villalobos, P., Valdés, E., Suárez, A., Galindo, R. & Young, M. E. Universidad Técnica Federico Santa María. Patrocinado por Michael Seager.

La encapsulación de células se ha convertido en una solución industrial a un variado tipo de aplicaciones, desde la producción de fármacos (Orive et al., 2002), alimentos (Gibbs, et al., 1999) y biosensores (Arikawa, 1996). A partir del trabajo de Kiertan y Bucke (1977) con geles de alginato se ha detectado el efecto del transporte de metabolitos desde el ambiente a las células dentro de la cápsula, en algunos casos, afectando la viabilidad mientras que en otros generando una barrera protectora.
Los efectos difusionales generan dificultades en el escalamiento necesario para una producción industrial, haciendo necesario conocerlos en términos de parámetros de diseño. En la mayoría de las situaciones el factor limitante es el oxígeno, sin embargo no siempre es así, en particular cuando se utilizan bacterias encapsuladas en reactores con alta aireación y agitación, en cuyo caso la carencia de sustrato orgánico es el fenómeno dominante.
En este trabajo nos enfocamos en relaciones de consumo de substrato y demanda de oxígeno, difusión de glucosa y oxígeno y su efecto en cápsulas de alginato para hacer factible el diseño y escalamiento en términos de biomasa inicial de Enterobacter cloacae y tamaño de cápsula.
Agradecimientos:
Proyecto FONDEF D00I1091, Beca Doctorado CONICYT D-21050588.

68. PROTEÍNA G DEL VIRUS DE LA RABIA, UNA ALTERNATIVA PARA EL DESARROLLO DE VACUNAS. (G protein of rabies virus, an alternative for vaccine development). 1Alarcón, S.; 1González, P.; 1Riveros, B.; 2Favi, M.; 2Yung, V.; 1Vásquez, A. 1Centro de Investigación y Desarrollo, 2Sección de diagnóstico de rabia. Instituto de Salud Pública de Chile.

La rabia es una enfermedad zoonótica causada por el virus de la rabia. El reservorio natural del virus son perros, gatos, zorros y murciélagos.
La proteína G la principal proteína inmunogénica y la más conservada en los distintos serotipos del virus.
El gen de la proteína G fue amplificado por RT-PCR desde la cepa nacional L51 y clonado en el plasmidio pET21a para su expresión heteróloga en E. coli, y luego fue subclonado en el plasmidio pcDNA3. 1(-) para ser utilizado como vacuna de DNA e inmunizar intramuscularmente ratones BALB/c en 2 dosis de 25 mg.
Para evaluar parcialmente la respuesta inmune humoral, se determinaron los niveles de IgG mediante ELISA y los anticuerpos neutralizante de los sueros mediante RFFIT (Test rápido de Inhibición de focos fluorescentes) prueba estándar de referencia.
El gen de la proteína G amplificado fue de 1572 pb con un 99% de identidad con el descrito para la cepa CVS. La proteína expresada en E. coli fue de 68 kDa.
El esquema de inmunización ensayado generó anticuerpos neutralizantes para el virus rábico.
Los resultados a la fecha nos permitirán formular y evaluar un nuevo prototipo de vacuna antirrábica.
Patrocinio: Dr. Alejandro Venegas.

 

GENÓMICA

69. GENÓMICA FUNCIONAL EN LA LEVADURA CAROTENOGÉNICA Xanthophyllomyces dendrorhous (Functional genomics in the carotenogenic yeast Xanthophyllomyces dendrorhous) Marcoleta, A.; Barahona, S.; Lozano C.; Niklitschek M.; Sanhueza M.; Sepulveda D.; Baeza M. y Cifuentes, V. Depto. Cs. Ecológicas, Facultad de ciencias, Universidad de Chile.

X. dendrorhous es una levadura basidiomicete capaz de sintetizar carotenoides, entre los cuales destacan b-caroteno y astaxantina, siendo este último responsable de la coloración de los salmónidos. Su potencial desarrollo como fuente natural y económicamente viable de astaxantina, ha motivado la realización de diversos estudios en la levadura. En este trabajo se estudia la biosíntesis de carotenoides como un proceso global, enmarcado dentro del metabolismo fermentativo de la levadura. Bajo este prisma se construyó una genoteca de cDNA a partir de los mRNAs aislados en condiciones de fermentación. Usando la genoteca se está generando un número creciente (sobre cien) ESTs (expressed sequence tags), los cuales fueron comparados con bases de datos, identificándose aproximadamente 40 genes, de los cuales 15 están relacionados con el metabolismo fermentativo. Paralelamente, se aisló aquellos que pudiesen tener alguna relación con el proceso de carotenogénesis o bien un potencial interés biotecnológico. Las secuencias obtenidas han sido usadas para construir una tabla de uso de codones, y determinar si en los genes que participan en la biosíntesis de carotenoides existe uso preferencial de codones, o bien, elementos de secuencia comunes; situaciones que podrían dar algunas luces sobre los aún desconocidos mecanismos de regulación de la vía.
Agradecimientos: FONDECYT Nº 1040450 y Convenio U. de Chile C. S. I. C. de España.

 

70. ESTUDIO COMPARATIVO DE DOS MÉTODOS DE GENOTIPIFICACIÓN PARA Arcobacter butzleri, Arcobacter cryaerophylus Y Arcobacter skirrowii AISLADOS DE DIVERSOS RESERVORIOS BIOLÓGICOS. (Comparative study of two genotyping methods for Arcobacter butzleri, Arcobacter cryaerophylus and Arcobacter skirrowii isolated from diverse biological reservoirs) Mansilla I., Ruiz L., Villanueva M. P., Otth L., Wilson M., Otth C. y Fernández H. Instituto de Microbiología Clínica, Facultad de Medicina, Universidad Austral de Chile. hfernand@uach.cl
Financiamiento: Fondecyt 1030245; DID 200401

El género Arcobacter (Superfamilia VI de rRNA de Proteobacteria) presenta tres especies de importancia clínica para el hombre. Arcobacter butzleri y A. cryaerophilus, han sido identificados como agentes de bacteremia y diarrea en el ser humano. La especie A. skirrowii, se ha aislado recientemente de diarrea humana.
Se compara por PCR-Múltiplex un método de extracción de DNA que se basa en la lisis bacteriana por calor descrito por Houf, y el propuesto en este trabajo utilizando directamente la colonia bacteriana en la reacción de amplificación, sin necesidad de extracción previa de DNA.
Fueron analizadas 241 cepas sospechosas de Arcobacter aisladas de muestras alimentarias de origen aviar, filtrado de mariscos bivalvos y fecas de ganado bovino y porcino. Del total de cepas analizadas 82% de los casos fueron positivas para A. butzleri, 10% A. cryaerophilus y 8% mezcla de las cepas ya mencionadas. No se observó la presencia de A. skirrowii en los casos estudiados.
Este método permitiría identificar en forma rápida y a bajo costo los reservorios y rutas de transmisión de estos patógenos emergentes.

 

71. IDENTIFICACIÓN IN SILICO E IN VIVO DE VIAS METABÓLICAS DE COMPUESTOS AROMÁTICOS EN Burkholderia xenovorans LB400. (Identification in silico and in vivo of metabolic pathways of aromatic compounds in Burkholderia xenovorans LB400). Latorre-Reyes, V., Agulló, L., Gómez, L., Córdova, M., González, M., Calderón, F., Avarias, J., Dombrovskaia, L., y Seeger, M. Laboratorio Microbiología Molecular y Biotecnología Ambiental. Universidad Técnica Federico Santa María, Valparaíso, Chile. valeria. latorre@gmail. com

Burkholderia xenovorans LB400 es una bacteria capaz de degradar una gran variedad de policlorobifenilos (PCBs). Dado que actualmente se dispone de la secuencia completa de su genoma, se realizó la búsqueda de vías metabólicas de algunos compuestos aromáticos y de enzimas antioxidantes en base a predicciones bioinformáticas y su posterior validación experimental.Para la identificación y localización de los genes de las rutas metabólicas se utilizaron las siguientes herramientas bioinformáticas: Kegg, Swiss-Prot/TrEMBL, Blast, Artemis y Vector NTI. Las validaciones experimentales se realizaron mediante el crecimiento de la bacteria en compuestos aromáticos como fuente de carbono y estudios de biodegradación. Se encontraron vías del metabolismo central: catecol (cat), clorocatecol (clc) y benzoil-CoA(boxABCR, pnbB, aldA, badA y lactonasa) y del metabolismo periférico: mandelato (mdlABC), bifenilo (bph), PCBs (bph), benzoato (benABCD) y 3-CBA. Además, se identificaron enzimas de defensa frente al estrés oxidativo como ahpCF, sodB, sodC, katG y katE.Las vías metabólicas encontradas demuestran la gran variedad de compuestos aromáticos potencialmente capaces de ser degradados por Burkholderia xenovorans LB400.
MS agradece proyectos Fondecyt 1020221 y USM 130522. VL-R becaria Mecesup Universidad de Magallanes del Doctorado en Biotecnología PUCV-UTFSM.

 

72. ANÁLISIS IN SILICO DE VÍAS CENTRALES PARA EL CATABOLISMO DE COMPUESTOS AROMÁTICOS EN Burkholderia xenovorans LB400. (In silico analysis of central pathways for catabolism of aromatic compounds in Burkholderia xenovorans LB400). Agulló, L., Latorre-Reyes, V., Córdova, M., Gómez, L., González, M., Candel, D., Muñoz, F., Arredondo, T. y Seeger, M. Laboratorio de Microbiología Molecular y Biotecnología Ambiental, Departamento de Química, Universidad Técnica Federico Santa María, Valparaíso. loreineagullo@gmail. com

La bacteria aerobia Burkholderia xenovorans LB400 debido a sus propiedades metabólicas ha sido ampliamente utilizada para investigar la biorremediación de policlorobifenilos. La reconstrucción in silico de rutas metabólicas del genoma secuenciado de B. xenovorans LB400 constituye el punto de partida para un análisis sistemático del metabolismo de compuestos aromáticos.
Mediante herramientas bioinformáticas (Kegg, Swiss-Prot/TrEMBL, Blast, Artemis, Vector NTI) se realizó la búsqueda de genes que codifican enzimas de rutas centrales de compuestos aromáticos tales como p-cumato, 2-aminophenol y 3-hydroxyfenilpropionato presentes en organismos cercanos a B. xenovorans como Pseudomonas y Cupriavidus necator JMP134. Se encontró que Burkholderia xenovorans LB400 posee los genes`cmt, amn y`mhp que codifican para las vías metabólicas de p-cumato, 2-aminophenol y 3-hydroxifenil-propionato. Adicionalmente se encontró la vía periférica del p-cymeno codificada por los genes cym organizada en un operón con la vía del p-cumato.
En este trabajo se descubrieron nuevas rutas metabólicas de compuestos aromáticos en Burkholderia xenovorans LB400. Estas rutas deberán ser confirmadas por estudios genéticos y fisiológicos in vivo.
MS agradece a Rodrigo de la Iglesia y a los proyectos Fondecyt 1020221 y USM 130522.

 

73. Búsqueda de Proteínas que Ligan Cobre en especies del Orden Lactobacillale MEDIANTE ANÁLISIS BIOINFORMÁTICO. (Search of copper binding protein in species of Lactobacillale order by bioinformatics analysis). Latorre, M, Leiva, A., Reyes, A., González, M. Laboratorio de Expresión Génica y Bioinformática, INTA-Universidad de Chile. Patrocinante: Figueroa. G, Laboratorio de Microbiología, INTA.

En bacterias, proteínas que unen cobre (Cu) cumplen un papel esencial. Si bien, en la actualidad, contamos con 139 genomas anotados, desconocemos el número de proteínas que presentan patrones de unión a Cu. En este trabajo, se adaptó el protocolo propuesto por (Andreini y cols, 20041) para construir una Base de Datos de Cu-Proteínas (Cu-BDP) con sus respectivos patrones de unión a Cu a partir de la información disponible en el protein-data-bank. Nuestra Cu-BDP contiene 118 proteínas con 147 patrones no redundantes provenientes de 37 genomas bacterianos y 39 eucariontes. Mediante PHI-Blast, los 147 patrones fueron rastreados en 7 genomas de especies del orden Lactobacillale. 161 proteínas con dominios de unión a Cu fueron identificadas, de las cuales 43 presentaron un E-value <1. Las más representativas fueron transportadores y chaperonas de Cu. Al examinar la presencia de: 1) ortólogos de estas 43 proteínas, y 2) las 57 proteínas de nuestro Cu-BDP (provenientes de procariontes) en el genoma de E. faecalis (vía Blastp) se recuperaron 11 nuevas proteínas. Ninguna de ellas presentó el patrón de unión a Cu del templado. Este resultado sugiere que descontando el operón tipo-cop, E. faecalis presenta una estrategia de utilización y manejo de cobre basado en proteínas que poseen nuevos patrones de unión al metal.
1Andreini, C et al. 2004. Bioinformatics. 20: 1373-80.
Fondecyt Nº 1030618

 

74. ANÁLISIS COMPARADO DEL OPERÓN COP EN BACTERIAS DEL ORDEN Lactobacillale. (Comparative analysis of cop operon in bacteria of Lactobacillale order). Leiva. A, Reyes. A, González. M. Laboratorio de Bioinformática y Expresión Génica. INTA-Universidad de Chile. Patrocinante: Figueroa. G, Laboratorio de Microbiología, INTA.

En bacterias, el operón cop de E. hirae es uno de los sistemas mejor caracterizados en el estudio del metabolismo de cobre (Cu). Codifica para 2 ATPasas transportadoras de Cu (CopA y CopB), una chaperona (CopZ) y un represor que responde al metal (CopY). Previamente, hemos identificado en ocho especies del orden Lactobacillale, la presencia de un operón tipo-cop que contiene copA, copY y el sitio de unión de CopY en la región promotora del operón. Esto sugiere la presencia del operón cop en un ancestro común de las especies del orden. En este trabajo, se determinó: %GC, uso de codones y se construyó un árbol de similitud para cada uno de los miembros del operón los cuales fueron contrastados con la filogenia del grupo. Los resultados indican que por especie: A) el %GC varía para la mayoria de los genes del operón tipo-cop, B) con la excepción de CopA, el uso de codones de los genes del operón no muestra una relación obvia con los indices del genoma, y C) ninguno de los genes del operón despliega una topología equivalente a la del árbol filogenético. En su conjunto, los resultados permiten proponer la hipotesis de transferencia horizontal de genes del operón tipo-cop entre especies del orden Lactobacillale.
Fondecyt Nº 1030618

 

VIROLOGÍA

75. La ProteÍna viral REV modula la traducciÓn del mRNA no procesado de HIV-1. (Translation of unspliced HIV-1 mRNA is regulated by Rev) 1Holzmann, C., 2Dangerfield, J., 1López-Lastra, M.
(1)Laboratorio de Virología Molecular, Centro de Investigaciones Médicas, Facultad de Medicina, Pontificia Universidad Católica de Chile. (2) Institute of Virology and Biomedicine, University for Veterinary Sciences, Vienna, Austria.

El mecanismo de iniciación de traducción dependiente de la estructura 5'Cap es utilizado por la mayoría de los mRNA celulares para iniciar el proceso de síntesis de proteína. El virus de la inmunodeficiencia humana de tipo 1 (HIV-1) se encuentra entre los patógenos humanos que poseen un sitio interno de entrada de ribosomas (IRES). Los IRESes se definen como estructuras de RNA capaces de reclutar la maquinaria necesaria para la iniciación de traducción de manera independiente a la estructura 5'Cap. Por tanto, HIV-1 puede utilizar este mecanismo alternativo para así asegurar la síntesis de sus proteínas estructurales, en condiciones en las cuales la síntesis de proteína Cap-dependiente está inhibida. El mecanismo mediante el cual la maquinaria traduccional celular reconoce al IRES-1 de HIV-1 no está dilucidado. Utilizando ensayos de traducción in vitro basado en la complementación de lisados de reticulocitos de conejo con extractos celulares, hemos generado resultados que sugieren que la proteína viral Rev es capaz de modular la actividad del IRES de HIV-1. Estos resultados sugieren que Rev participa en el proceso de iniciación de la síntesis de proteína cap-independiente, a Rev.
Financiamiento: Proyecto DIPUC 2005/14PI.

76. El mecanismo de iniciación de la síntesis de proteína de HIV-1 requiere proteínas del hospedero durante la etapa G2/M del ciclo celular. (Host factor regulates HIV-1 translation initiation in cell cycle dependent fashion). 1Rivas, A., 2León, O., 3Darlix, J-L., y 1López-Lastra, M.
(1)Laboratorio de Virología Molecular, Centro de Investigaciones Médicas, Pontificia Universidad Católica de Chile. (2)Programa de Virología, ICBM, Facultad de Medicina, Universidad de Chile. (3) Unité de Virologie Humaine, INSERM-U412, Ecole Normale Supérieure de Lyon, Francia.

El mRNA completo del virus de la inmunodeficiencia humana de tipo 1 (HIV-1), que codifica para las proteínas estructurales Gag y Gag-Pol, es capaz de reclutar el complejo de iniciación de la traducción de manera independiente al extremo 5'Cap, a través de un sitio interno de entrada a ribosomas, IRES. El mecanismo mediante el cual la maquinaria de síntesis de proteínas celular reconoce al IRES de HIV-1 no está dilucidado. Utilizando ensayos de traducción in vitro basado en la complementación de lisados de reticulocitos de conejo con extractos celulares, hemos generado resultados que sugieren que la actividad traduccional del IRES de HIV-1 es regulada por proteínas celulares (factores trans-activadores de IRES, ITAF). Además, se establece que los ITAFs del IRES de HIV-1 se expresan de manera dependiente del ciclo celular.
Financiamiento: Proyecto DIPUC 2005/14PI, Beca DIPUC a AR.

 

77. El mRNA del virus del tumor mamario de ratón (MMTV) posee un sitio interno de entrada a ribosomas en su región 5'no traducida. (Mouse mammary tumor virus mRNA harbors an IRES in it 5'untranslated region). Tapia, K y López-Lastra, M. (1)Laboratorio de Virología Molecular, Centro de Investigaciones Médicas, Pontificia Universidad Católica de Chile.

MMTV, miembro de la familia Retroviridae, es transmitido de forma horizontal a la descendencia a través de la leche materna. La primera etapa de la infección viral ocurre en linfocitos B, células utilizadas por el virus como reservorio y vehículo para acceder a las células blanco de la infección secundaria, ubicadas en la glándula mamaria. En las células de la glándula mamaria MMTV permanece en estado de latencia hasta que el hospedero alcanza la pubertad. Las hormonas esteroidales inducen la proliferación viral, lo cual conlleva a la formación de tumores en el epitelio mamario. En este estudio se determina que el mRNA de MMTV posee un sitio interno de entrada a ribosomas (IRES) en su región 5' no traducida. El IRES de MMTV permite reclutar a la maquinaria necesaria para la iniciación de la síntesis de proteína de manera independiente de la estructura 5'Cap.

78. ANÁLISIS DE LA REACCIÓN DE INTEGRACIÓN CONCERTADA CATALIZADA POR LA INTEGRASA DEL VIRUS MOLONEY MuLV. (Analysis of the concerted integration reaction catalyzed by Moloney MuLV integrase.) Gajardo H., Valenzuela B. y León O. Programa de Virología, ICBM, Facultad de Medicina, U. de Chile.

La integración del DNA viral en el genoma del huésped es una etapa fundamental en el ciclo replicativo de los retrovirus. Esta reacción es catalizada por la integrasa codificada en el genoma viral, la cual in vivo se asocia a un complejo de preintegración compuesto por proteínas virales y celulares. Para el estudio de la organización del complejo de integración y su interacción con componentes celulares, es necesario disponer de un sistema in vitro que asemeje el proceso de integración retroviral. Para estos fines, se construyó un sustrato de integración concertada de 1200 pb que contiene el gen de resistencia a cloranfenicol flanqueado por 30 pb de la secuencia terminal U5 LTR de Moloney MuLV y el sitio de restricción NdeI. El clonamiento en pGEM-T seguido de la digestión con NdeI del vector genera un sustrato de integración similar al genoma viral procesado, el cual puede ser monitoreado por marcaje radiactivo o por selección con cloranfenicol. Mediante este ensayo se analizó la capacidad de la integrasa de Moloney MuLV de integrar concertadamente este sustrato en un DNA plasmidial aceptor, obteniéndose 2 productos de integración. En este trabajo se presentan los resultados de la caracterización de ambos productos de integración.
Financiado por proyecto FONDECYT 1040409.

 

79. ESTUDIOS EN LA DIMERIZACIÓN DEL DOMINIO N-TERMINAL DE LA INTEGRASA DEL VIRUS MOLONEY-MuLV (Dimerization studies of the N-terminal domain of M-MuLV integrase). Henríquez D.1, Toledo H.2, Vargas, D1. y León O1. Programas de Virología1 y Biología Celular2, ICBM, Facultad de Medicina, U. Chile.

La integrasa es una de las enzimas claves en el ciclo replicativo de Moloney-MuLV, la cual cataliza la integración coordinada de ambos extremos del DNA viral en el genoma del hospedero. Estructuralmente, está constituida por un dominio N-terminal, un "core" central catalítico y un dominio C-terminal. La enzima posee una baja solubilidad y no ha sido posible obtener información cristalográfica de la enzima completa o de sus dominios por separado.
El dominio N-terminal de la integrasa es altamente conservado y varios estudios indican que participaría en procesos de multimerización y unión a DNA. En este trabajo se muestran los resultados de la purificación de este dominio utilizando un procedimiento de autoinducción basado en la utilización de lactosa en lugar de IPTG. Con este procedimiento el rendimiento aumentó en más de 10 veces, obteniéndose una proteína con un 95% de pureza.
Por otra parte se ha descrito que el dominio N-terminal aislado, es capaz de agregarse formando dímeros y otras especies oligoméricas. Sin embargo utilizando cromatografía de exclusión en Superdex S-200, hemos observado que a bajas concentraciones de sal se favorece la forma monomérica.
Se discute el significado de estas observaciones en relación a la multimerización de integrasa en el complejo de integración.
Financiado por proyecto FONDECYT 1040409.

 

80. EFECTO DE INHIBIDORES DEL INICIO DE LA TRADUCCIÓN SOBRE LA SÍNTESIS DE PROTEÍNAS DEL VIRUS IPN (Effects of translation initiation inhibitors on IPNV protein synthesis) Jorquera, P; Soto-Rifo, R; Mlynarz, G; Sandino, AM. Laboratorio de Virología, Facultad de Química y Biología, Universidad de Santiago de Chile, Casilla 40, Correo 33, Santiago, Chile.

El virus de la necrosis pancreática infecciosa (IPNV) pertenece a la famila Birnaviridae. Posee una cápside icosahédrica sin envoltura y dos segmentos genómicos de RNA doble hebra. Se ha sugerido que no posee actividad guanilil transferasa por lo que no utilizaría el mecanismo de inicio traducción dependiente de una estructura cap en el extremo 5´ del mRNA. Con el fin de determinar si los mRNA de IPNV poseen cap se aislaron y analizaron los mensajeros virales obtenidos desde células infectadas. Para determinar si IPNV inicia su traducción de forma independiente de cap, se analizó el efecto de rapamicina sobre la traduccion IPNV en condiciones donde solo se inhibe la traducción cap dependiente. Se analizó su efecto a diferentes tiempos de infección, con y sin privación de suero. Además se utilizaron diferentes concentraciones de amantadina. Se encontró que la síntesis de proteínas virales disminuye drásticamente en presencia de rapamicina cuando esta es mantenida en el medio de cultivo, mientras que la privación de suero y amantadina no muestran un efecto significativo sobre la traducción de IPNV. Aparentemente la síntesis de los polipéptidos virales depende considerablemente de la presencia de algunos factores de traducción celulares.
Financiado por FONDECYT # 1040282

 

81. estudio de Inhibidores del ciclo replicativo del Virus de la Anemia Infecciosa del Salmón, ISAV. (Study of inhibitors on replicative cycle of Infectious Salmon Anaemia virus, ISAV) Núñez-Aguilera L.(1), Chandía P.(2), Matsuhiro B.(2), Sandino A. M.(1). (1)Laboratorio de Virología, (2)Laboratorio de Química Orgánica, Facultad de Química y Biología, Universidad de Santiago de Chile.

La anemia infecciosa del salmón (ISA) es una enfermedad de considerable importancia económica en Noruega, Escocia y Canadá, que también ha sido reportada en Chile. Su agente etiológico, el virus ISAV, pertenece a la familia Orthomyxoviridae. Es una partícula con envoltura membranosa cuyo genoma consiste en 8 segmentos de RNA de simple hebra y polaridad negativa. Los brotes de ISAV en países exportadores de salmones han alcanzado una mortalidad de hasta el 80% de la producción, haciendo necesario el desarrollo de una forma de control de la enfermedad. Debido a la alta tasa de recombinación de los Orthomyxovirus el uso de vacunas no es el método más efectivo para su control. Por este motivo, la evaluación del efecto inhibitorio de la replicación viral de compuestos con actividad antiviral podría ser fundamental para ser utilizados en terapias. Numerosos estudios, realizados con otros virus con envoltura membranosa, reportan a las algas pardas como fuente de compuestos con actividad antiviral. En este trabajo se utilizaron extractos de un alga parda chilena como posibles inhibidores de la infección de ISAV. Los ensayos mostraron una disminución de la infección de ISAV en la línea celular SHK-1, en la cual no se observan efectos citotóxicos.

82. Detección simultánea de virus de vides usando microarreglos (Simultaneous detection of grapevine viruses using microarrays). Engel, E. 1, 3 y Valenzuela, P. D. T. 1, 2, 3 Fundación Ciencia para la Vida1, BiosChile IGSA2 e Instituto MIFAB3 Av Zañartu 1482, Santiago - Chile.

Un problema clave que enfrenta la producción vitivinícola, es el alto grado de infecciones causadas por virus. Estos producen daños severos a los cultivares y no se dispone actualmente de tratamientos para erradicar el patógeno de plantas ya infectadas. Por lo anterior, es de vital importancia contar con sistemas de diagnóstico viral que determinen la presencia de virus en el material vegetal que será propagado. Adicionalmente, los mercados receptores de la fruta chilena exportada, tienen regulaciones rigurosas sobre el estado sanitario del material vegetal que ingresa.
Debido a esto, se decidió producir un sistema novedoso de detección que en forma simultánea determine la presencia de cualquier virus de la vid que haya sido total o parcialmente secuenciado. Esto otorga una gran ventaja comparativa con respecto a los sistemas de detección tradicionales, rastreando en forma simultánea el material vegetal en busca de los virus de interés en desmedro de realizar ensayos individuales e independientes para cada virus. Mediante herramientas bioinformáticas, se diseñaron más de 500 sondas de ADN complementarias a secuencias virales, estas se imprimieron mediante un robot en un portaobjeto. Este arreglo discrimina y determina con gran sensibilidad el agente viral presente en la muestra analizada. Adicionalmente se está ampliando este sistema a las principales especias frutales de nuestro país. Financiado parcialmente por proyecto FONTEC 204-4040.

 

Creative Commons License Todo el contenido de esta revista, excepto dónde está identificado, está bajo una Licencia Creative Commons