SciELO - Scientific Electronic Library Online

 
vol.15 número4Production of phenolic metabolites by Deschampsia antarctica shoots using UV-B treatments during cultivation in a photobioreactor índice de autoresíndice de materiabúsqueda de artículos
Home Pagelista alfabética de revistas  

Servicios Personalizados

Articulo

Indicadores

  • No hay articulos citadosCitado por SciELO

Links relacionados

  • No hay articulos similaresSimilares en SciELO

Bookmark


Electronic Journal of Biotechnology

versión On-line ISSN 0717-3458

Electron. J. Biotechnol. vol.15 no.4 Valparaíso jul. 2012

 

Plant Biotechnology
  Molecular Biology and Genetics
Electronic Journal of Biotechnology ISSN: 0717-3458 Vol. 15 No. 4, Issue of July 15, 2012
© 2012 by Pontificia Universidad Católica de Valparaíso -- Chile Received March 19, 2012 / Accepted May 25, 2012
DOI: 10.2225/vol15-issue4-fulltext-1  
TECHNICAL NOTE

Development of pollen mediated activation tagging system for Phalaenopsis and Doritaenopsis

Hsin-Sheng Tsay*1,2· Hui-Min Ho1 · Sushim K. Gupta1 · Chang-Sheng Wang2 · Pei-Tsu Chen1 · Emily Chin-Fun Chen*1

1Chaoyang University of Technology, Institute of Biochemical Sciences and Technology, Wufong, Taichung, Taiwan
2National Chung-Hsing University, Department of Agronomy, Taichung, Taiwan

*Corresponding author: argentina@cyut.edu.tw

Financial support: This work was supported by grants from National Science Council of Taiwan (95N-1104 and NSC 100-2324-B-038-001-).

Keywords: activation tagging, Agrobacterium tumefaciens, Doritaenopsis cultivars, Phalaenopsis amabilis, transformation.

Abstract

In the present study, a novel plant transformation system for Doritaenopsis and Phalaenopsis has been developed. The pollen-mediated activation tagging system was established by artificial pollination. The pollens, co-cultured with Agrobacterium tumefaciens strain EHA105 harbouring an activation tagging vector (pTAG-8), were used for pollination. In order to optimize the transformation efficiency, several factors (concentration of A. tumefaciens, concentration of acetosyringone during co-cultivation and the duration of co-cultivation) known to influence Agrobacterium-mediated DNA transfer were examined. A concentration of 0.5-1 x 108 CFU/ml for A. tumefaciens, 0.1 mM acetosyringone, and 6 hrs of co-culture period were found to be the optimal condition for high transformation efficiency. Integration of T-DNA into the genome of putative transgenic plants was confirmed by PCR and DNA blot analyses. Single copy of the transgene was observed in all transgenic plants analyzed. Most of the transgenic plants had a morphologically normal phenotype and the overall capsule formation efficiency was similar to control plant. Our results showed a new approach of genetic transformation in orchids and this method can be employed for genetic improvement of the orchids.

Introduction

Doritaenopsis and Phalaenopsis, an intergenetic hybrid between the orchid genera Doritis and Phalaenopsis, are grown throughout Asia and Pacific Ocean islands. Doritaenopsis often blooms longer and has more colours than the traditional Phalaenopsis. Both of them are cultivated for use as cut flowers or as blooming potted plants. Based on their economic value, genetic improvements with respect to the flower colour, flower shape, disease resistance and flowering time are of considerable importance. This has been achieved through sexual crossing techniques; however, the progress in these respects is slow, due to the long duration of growth and reproductive cycle. One of the effective alternatives to this constraint could be Agrobacterium mediated genetic transformation. Several studies have been reported on Agrobacterium-mediated transformation of Phalaenopsis (Belarmino and Mii, 2000; Chai et al. 2002) and other orchid species (Knapp et al. 2000; Yu et al. 2001; Liau et al. 2003). It is essential to optimize the transformation procedure, since plants exhibit wide variation in susceptibility to Agrobacterium. Since, tissue culture based methods require optimization of the plant regeneration system and often generate somaclonal variations, therefore, direct gene transfer method is an alternative for transformation. Direct transformation through pollen grains co-cultivated with A. tumefaciens has come up as an interesting alternative technique which has been used for transformation in tobacco (Aziz and Machray, 2003) and lily (Kim et al. 2007).

Transformation efficiencies of orchids, like those of other plants or fungi, are correlated to the Agrobacterium and AS concentrations and many other factors. Meyer et al. (2003) reported that the excess of A. tumefaciens cause a decreased transformation efficiency. High Agrobacterium concentration (50 x 108 cfu/ml) affected the capsule ratio and the recovery of transgenic seedlings, resulting no transformants in this study. On the other hand, several studies have shown that co-culture periods may affect the transformation efficiency. A prolonged co-cultivation period (3 d) has increased transformation efficiency in rice callus (Mohanty et al. 1999), while overnight co-culture has produced maximum transformants in Phalaenopsis callus (Belarmino and Mii, 2000). Co-culture of pollen with A. tumefaciens and A. rhizogenes have been tested in tobacco (Sanford and Skubik, 1986). However, no transformants have achieved in maize, when, pollens were mixed with plasmid DNA before pollination (Booy et al. 1989). No transformants have achieved in tobacco with mature pollens (Negrutiu et al. 1986). In case of Arabidopsis thaliana, transgenic plants have been generated by vaccum-infiltration of whole inflorescences with A. tumefaciens in MS medium (Bechtold et al. 1993). Moreover, genetic transformations of Petunia hybrid have been generated by pollinating flowers through vacuum-infiltrated with A. tumefacien or by applying a drop of A. tumefaciens to the stigma immediately or prior to pollination (Tjokrokusumo et al. 2000). Several reports have demonstrated that flavonoid compounds from pollen have activated the vir gene in A. tumefaciens (Zerback et al. 1989, Hess et al. 1990), while, ethylene has inactivated vir gene and ultimately effected transformation efficiency (Nonaka et al. 2008).

The activation tagging system is normally used for generating gain-of function or loss-of function in mutants. By random insertion of a binary vector into the genome, it may enhance gene expression or knock-out the gene. This activation tagging approach has been successfully used in plants (Van Der Fits et al. 2001; Mathews et al. 2003; Hsing et al. 2007) and fungi (Chen et al. 2009).

The purpose of the present study was to develop a pollen-mediated activation tagging system (PMATS) for Doritaenopsis and Phalaenopsis, and to analyze their effect on morphological changes (flower colour, flower shape, flower longevity, disease resistance and flowering time). To date no study has been done on PMATS in orchids. To our knowledge, this is the first report on PMATS in orchids.

Materials and Methods

Plant materials

Potted plants of P. amabilis (45 cm in height) with white flowers (10-14 cm in diameter),Dpts. cultivars Sinica Sunday (55-62 cm in height) with pink flowers (10-12 cm), and Dpts. cultivars Taisuco Firebird (57-65 cm in height) with dark pink flowers (10-12 cm) (Figure 1) were grown under greenhouse conditions in Chaoyang University of Technology, Taiwan.

Agrobacterium strain

A. tumefaciens strain EHA105, carrying a binary vector pTAG8 (Hsing et al. 2007, Chen et al. 2009) was used for the transformation. The T-DNA region of the binary vector contained a selectable marker coding for the hygromycin phosphotransferase (hptII) gene under CaMV 35S promoter was kindly provided by Dr. Yu (Academia Sinica). A. tumefaciens was cultured on LB medium containing 100 mg/l kanamycin, and 50 mg/l rifampicin at 28ºC for 2 days.

Optimization of transformation conditions and pollination of flowers with pollen co-cultured with Agrobacterium

A. tumefaciens cells were harvested by centrifugation at 2500 x g for 10 min and their OD600 was determined in resuspended liquid inoculation medium consisting of MS medium supplemented with 50 g/l sucrose, with or without acetosyringone (AS) at different concentrations (0, 0.1, 1, 10 mM). The cultures were then diluted to different concentrations (0.5 x 108, 1 x 108, 5 x 108, 50 x 108 cfu/ml) and used for the transformation. At full bloom, pollen from the flowers of recipient Doritaenopsis or Phalaenopsis plant to be pollinated was collected individually in 1.5 ml-centrifuge tubes. To each pollen sample, 100 μl A. tumefaciens in different concentrations was added without or with AS. The mixture of pollen grains and Agrobacterium was pasted either immediately (0 hr) or after different co-culture periods (3, 6, 12, 24 or 48 hrs), onto the stigmas of the same recipient plant, thus facilitating self-pollination. Flowers without A. tumefaciens treated pollen served as control. Four months after the pollination, number of capsules formed under each treatment was recorded. The capsule ratio represents number of capsules divided by the number of flowers pollinated under each treatment.

Screening of orchid seedlings for hygromycin resistance

The optimum concentration of selection pressure for transformants was determined by using non-transformed orchid seeds. Capsules from both control and treatments were surface sterilized by immersion in 70% ethanol for 30-60 sec, followed by soaking in 0.5% sodium hypochlorite for 20-30 min, and then rinsed with sterile water. After disinfected capsules were cut open in a sterile chamber, all seeds were scooped out and inoculated in Petri-dishes containing 1/2X MS basal medium (Murashige and Skoog, 1962) supplemented with different concentrations of hygromycin (0, 0.125, 0.625, 1.25, 2.5, 5 and 10 mg/l). All transformants were selected on 1/2X MS basal medium with optimized concentration of hygromycin (5 mg/l, data not shown) 2 months after culture. The putative seedlings which survived on hygromycin were transferred to growth chamber for 3 weeks and later to green house for further growth.

Identification of activation-tagged Doritaenopsis and Phalaenopsis

To confirm the transformation, hygromycin-resistant transformants were randomly selected for genomic DNA extraction and PCR analysis. Total genomic DNA from the leaves of these putative transformants was extracted by CTAB method (Doyle and Doyle, 1987). Integration of the foreign gene into the genome was confirmed by PCR using gus gene specific primers (GUSF: 5’GAAAGGTTGGGCAGGCCAGC3’ & GUSR: 5’TCGCCTGTAAGTGCGCTTGCT3’). The PCR was performed by using 50 ng of genomic DNA, 200 μM of each dNTP, 0.5 μM of each gus primer and one unit of Taq polymerase. Reactions were carried out with hot-started at 94ºC for 5 min and subjected to 35 cycles of denaturation at 94ºC for 30 sec, annealing at 60ºC for 30 sec, and elongation at 72ºC for 40 sec. The final extension phase was prolonged for 10 min at 72ºC. The amplified 950 bp fragment from a control plant and different transgenic lines were electrophoresed on 1% agarose gel and visualized under UV after staining with ethidium bromide.

DNA blot analysis

Six putative transformants were selected and their genomic DNA (15 μg) was digested with EcoRI and HindIII, the digested DNA was size-fractionated on 1% agarose gel. The gel was treated with dupurination, denaturation and neutralization buffers and DNA was transferred onto positively charged nylon membranes (Bio-Rad) as described by Sambrook et al. (1989). A PCR-amplified gus gene fragment was labelled with digoxigenin-9-dUTP using Dig High Prime Labeling and Detection Starter Kit I (Roche, USA). This labelled probe was used for hybridization at 52ºC and later passed through series of stringency washes (high stringency at 56ºC) to eliminate unspecific binding. The hybridized probes were immune-detected with anti-digoxigenin-AP, Fab fragments and visualized with the colorimetric substrates NBT/BCIP according to manufacturers instruction.

Statistical analysis

Data were analyzed statistically by using Fisher’s protected least significant difference (LSD) test at the 5% probability level.

Results

Optimal conditions for high activation-tagged transformation efficiency in both Doritaenopsis and Phalaenopsis

In order to obtain the highest number of pollen-mediated activation-tagged transformants of Doritaenopsis and P. amabilis cultivars, a series of studies on Agrobacterium concentration, AS concentration, and co-culture period were carried out. Out of several Agrobacterium concentrations tested, 0.5 x 108 cfu/ml to 1 x 108 cfu/ml was the best for the co-culture. High concentration (50 x 108 cfu/ml) of Agrobacterium produced no transformants, under different concentration of AS, an inducer of the vir gene expression of A. tumefaciens (Figure 2a). Higher concentration of AS had negative effect on the capsule ratio while lower concentrations promoted capsule ratio. Thus, capsule ratio was used as one of criteria to select transgenics and with lower concentration of AS (0.1 mM) and A. tumefaciens (0.5 x 108 cfu/ml to 1 x 108 cfu/ml), the capsule ratio increased significantly. Optimizing the co-cultivation time with A. tumefaciens to 6 hrs yielded the highest transformation frequency (Figure 2b). These experiments demonstrated that 0.5 x 108 cfu/ml to 1 x 108 cfu/ml of A. tumefaciens, 0.1 mM AS, and 6 hrs of co-culture period are the optimum conditions for the transformation of P. amabilis and Doritaenopsis cultivars. The seeds obtained from the capsule of putative transformants were germinated on hygromycin (5 mg/l) 2 months after culture (Figure 3b and c), while no germination was observed from the seeds obtained from non transformed capsule (Figure 3a). A total of 30 transformants of P. amabilis, 7 transformants of Dpts. cultivars Sinica Sunday, and 15 transformants of Dpts. cultivars Taisuco Firebird were obtained after selection in 5 mg/l hygromycin.

Identification of T-DNA insertion by PCR

Although the most widely used method for the generation of transgenic plants is the Agrobacterium-mediated transformation which precisely delimited DNA sequences with a single integration (Lawrence and Koundal, 2001), the structure of the inserted T-DNA varies widely to include single or multiple copies, at a unique or several loci in the plant genome. Total DNA isolated from the putative transformants was tested for the presence of the transgene. PCR amplification confirmed that the gus genes were present in plants grown in hygromycin selection medium. The PCR results of expected 950 bp fragments in four randomly selected (two from P. amabilis, one from Dpts. cultivars Sinica Sunday and one from Dpts. cultivars Taisuco Firebird) putative transgenic orchids are displayed in Figure 2 . In this experiment, no amplification was observed in the untransformed control (Figure 4).

DNA blot for transformants

DNA blot analysis were carried out to evaluate further the transfer and insertion of foreign gene lies between left and right border in the genome of the transformed Phalaenopsis and Dpts. cultivar. Hybridization of gus gene to EcoRI and HindIII digested genomic DNA from the transgenic plantlets is shown in Figure 5 (transformant of Dpts. cultivars Sinica Sunday shown inlane 1, transformant of P. amabilis in lane 2, and transformants of Dpts. cultivars Taisuco Firebird in lane 3-6) respectively. The results confirmed that all six selected transgenic plantlets, contained bands with sizes larger than the gus gene fragment (950 bp) and were indicative of integration of the introduced plasmid part into the host plant genome. The results confirmed the transgenic nature and showed a uniform insertion pattern with only single insertion. No bands were detected in the wild type (Data not shown). The presence of calcium oxalate in the tissues of these species makes it difficult to isolate DNA. Thus, only few transgenic were analyzed through Southern blots.

Phenotypic characterization of dominant mutant in Doritaenopsis and Phalaenopsis

The selected T1 transformants of Phalaenopsis and Dpts. cultivars were transferred to green house for acclimation to ex vivo conditions and their phenotypic characteristics were analyzed in two years of their growth. Most of transformants are morphologically similar to wild types. A small number of T1 transformants showed distinct phenotypic variations. Stunted growth was observed in the transformants of P. amabilis and of Dpts. cultivars (22 cm, one half of the wild type; Figure 6a, 6b and 6f) among the selected 30 transgenic P. amabilis (3%), 7 transformants of Dpts. cultivars Sinica Sunday (14%) and 15 transformants of Dpts. cultivars Taisuco Firebird (6%). Small size flowers were observed in two of the 15 transformants of Dpts. cultivars Taisuco Firebird (Figure 6c and 6e) and delayed flowering was observed in another selected transgenic Dpts. cultivars Taisuco Firebird (Figure 6d).

Discussion

Activation tagging has been used as a powerful tool to discover gene functions as well as to identify promoter regions. Many transgenic plants (Tani et al. 2004) or fungi (Chen et al. 2009) have been generated by this method. In the present study, a successful activation-tagged system was established in Doritaenopsis and Phalaenopsis via pollen-mediated Agrobacterium transformation. P. amabilis, Dpts. cultivars Sinica Sunday, and Dpts. cultivars Taisuco Firebird were used as the starting material for establishing PMATS because of their remarkable economic values.

The pollen grains were co-cultured with Agrobacterium for different time periods and maximum transformation efficiency were obtained 6 hrs after co-cultivation, the possible reason for maximum transformants after 6 hrs could be the counterfeit effect of flavonoids over ethylene which enhanced vir gene activation and ultimately total transformation efficiency. When co-culture period extended further the ethylene accumulation might have surpassed the flavonoid thus, reduced transformation efficiency. Flavonoids itself act as a chemical inducer and due to the presence of these flavonoid compounds in pollen required low levels of AS (0.1 mM) sufficient for good transformation efficiency in P. amabilis, and Dpts. cultivars. In the present study, a pollen-mediated transformation system with 0.1 mM AS, 0.5 x 108 cfu/ml to 1 x 108 cfu/ml of A. tumefaciens and co-culture for 6 hrs was established in P. amabilis, and Dpts. cultivars.

Integration of the T-DNA (from pTAG8) into the putative transgenic plant genomes was further confirmed by PCR and Southern blot analyses. Plants grew in selective media were randomly selected for molecular analysis. PCR analyses were conducted using the primer set for the gus gene and showed the expected size bands of 950 bp, in all randomly selected plants (Figure 4). The amplified bands were not detected with gus primer set in untransformed plants. Southern blot analysis was carried out using the gus gene as probe. Genomic DNA from six putative transgenic plants was digested with EcoRI and HindIII, which only cut gus gene once and allowed to hybridize with the gus probe. Single copy insertion was observed in all six T1 transformants: one from Dpts. cultivars Sinica Sunday (Figure 5a, lane1; Figure 5b, lane 1), one from P. amabilis (Figure 5a, lane 2; Figure 5b, lane 2) and four from Dpts. cultivars Taisuco Firebird (Figure 5a, lane 3-6; Figure 5b, lane 3-6). Single or low-copy-number integration of transgenes through Agrobacterium have been observed in several plant species (Fu et al. 2000; Ming et al. 2000; Frame et al. 2002). Although a single-copy insertion may facilitates the recovery of DNA sequences of the affected gene in most fungal genomes (Michielse et al. 2005), it is very difficult to isolate the flanking sequence of T-DNA in orchids by using TAIL-PCR or inverse PCR.

Without knowing the sequence of the affected gene, the PMATS developed in the present study is very useful in improving flower phenotypes or flowering time. Among 52 transformants (30 transformants of P. amabilis, 7 transformants of Dpts. cultivars Sinica Sunday and 15 transformants of Dpts. cultivars Taisuco Firebird) obtained, a small number of T1 transformants showed distinct phenotypic variations: stunted growth, small size flowers and delayed flowering. The occurrence of these changes might be caused by the integration of transgene or due to somaclonal variations. These variations frequently occur in in vitro culture of orchids (Chen et al. 2005). These variations are more frequent when culture goes through prolonged sub-culturing and longer duration of induction (Thorpe, 1994).

An efficient, rapid and simple PMATS was developed in P. amabilis, Dpts. cultivars Sinica Sunday, and Dpts. cultivars Taisuco Firebird. This is the first report on PMATS in orchids and it can be used for genetic improvement in both Phalaenopsis and Doritaenopsis.

References

AZIZ, N. and MACHRAY, G.C. (2003). Efficient male germ line transformation for transgenic tobacco production without selection. Plant Molecular Biology, vol. 51, no. 2, p. 203-211. [CrossRef]        [ Links ]

BECHTOLD, N.; ELLIS, J. and PELLETIER, G. (1993). In planta Agrobacterium-mediated gene transfer by infiltration of adult Arabidopsis thaliana plants. CR Academics of Science Paris Life Sciences, vol. 316, no. 10, p. 1194-1199.         [ Links ]

BELARMINO, M.M. and MII, M. (2000). Agrobacterium-mediated genetic transformation of a phalaenopsis orchid. Plant Cell Reports, vol. 19, no. 5, p. 435-442. [CrossRef]        [ Links ]

BOOY, G.; KRENS, F.A. and HUIZING, H.J. (1989). Attempted pollen-mediated transformation of maize. Journal of Plant Physiology, vol. 135, no. 3, p. 319-324. [CrossRef]        [ Links ]

CHAI, M.L.; XU, C.J.; SENTHIL, K.K.; KIM, J.Y. and KIM, D.H. (2002). Stable transformation of protocorm-like bodies in Phalaenopsis orchid mediated by Agrobacterium tumefaciens. Scientia Horticulturae, vol. 96, no. 1-4, p. 213-224. [CrossRef]        [ Links ]

CHEN, Y.H.; TSAI, Y.J.; HUANG, J.Z. and CHEN, F.C. (2005). Transcription analysis of peloric mutants of Phalaenopsis orchids derived from tissue culture. Cell Research, vol. 15, p. 639-657. [CrossRef]        [ Links ]

CHEN, E.C.-F.; SU, Y.-H.; KANAGARAJAN, S.; AGRAWAL, D.C. and TSAY, H.-S. (2009). Development of an activation tagging system for the basidiomycetous medicinal fungus Antrodia cinnamomea. Mycological Research, vol. 113, no. 3, p. 290-297. [CrossRef]        [ Links ]

DOYLE, J.J. and DOYLE, J.L. (1987). A rapid DNA isolation procedure for small quantities of fresh leaf tissue. Phytochemistry Bulletin, vol. 19, no. 1, p. 11-15.         [ Links ]

FRAME, B.R.; SHOU, H.; CHIKWAMBA, R.K.; ZHANG, Z.; XIANG, C.; FONGER, T.M.; PEGG, S.E.K.; LI, B.; NETTLETON, D.S.; PEI, D. and WANG, K. (2002). Agrobacterium tumefaciens-mediated transformation of maize embryos using a standard binary vector system. Plant Physiology, vol. 129, no. 1, p. 13-22. [CrossRef]        [ Links ]

FU, X.; DUC, F.L.; FONTANA, S.; BONG, B.B.; TINJUANGJUN, P.; SIDHAKAR, T.; TWYMAN, R.M.; CHRISTOU, P. and KOHLI, A. (2000). Linear transgene constructs lacking vector backbone sequences generate low-copy-number transgenic plants with simple integration patterns. Transgenic Research, vol. 9, no. 1, p. 11-19. [CrossRef]        [ Links ]

HESS, D.; DRESSLER, K. and NIMMRICHTER, R. (1990). Transformation experiments by pipetting Agrobacterium into the spikelets of wheat (Triticum aestivum L.). Plant Science, vol. 72, no. 2, p. 233-244. [CrossRef]        [ Links ]

HSING, Y.-I.; CHERN, C.-G.; FAN, M.-J.; LU, P.-C.; CHEN, K.-T.; LO, S.-F.; SUN, P.-K.; HO, S.-L.; LEE, K.-W.; WANG, Y.-C.; HUANG, W.-L.; KO, S.-S.; CHEN, S.; CHEN, J.-L.; CHUNG, C.-I.; LIN, Y.-C.; HOUR, A.-L.; WANG, Y.-W.; CHANG, Y.-C.; TSAI, M.-W.; LIN, Y.-S.; CHEN, Y.-C.; YEN, H.-M.; LI, C.-P.; WEY, C.-K.; TSENG, C.-S.; LAI, M.-H.; HUANG, S.-C.; CHEN, L.-J. and YU, S.-M. (2007). A rice gene activation/knockout mutant resource for high throughput functional genomics. Plant Molecular Biology, vol. 63, no. 3, p. 351-364. [CrossRef]        [ Links ]

KIM, S.-S.; SHIN, D-II. and PARK, H.-S. (2007). Transient β-glucuronidase expression in lily (Lilium longflorumL.) pollen via wounding-assisted Agrobacterium-mediated transformation. Biotechnology Letters, vol. 29, no. 6, p. 965-969. [CrossRef]        [ Links ]

KNAPP, J.E.; KAUSCH, A.P. and CHANDLEE, J.M. (2000). Transformation of three genera of orchid using the bar gene as a selectable marker. Plant Cell Reports, vol. 19, no. 9, p. 893-898. [CrossRef]        [ Links ]

LAWRENCE, P.K. and KOUNDAL, K.R. (2001). Agrobacterium tumefaciens-mediated transformation of pigeon pea [Cajanus cajan (L.) Millsp.] and molecular analysis of regenerated plants. Current Science, vol. 80, no. 11, p. 1428-1432.         [ Links ]

LIAU, C.-H.; YOU, S.-J.; PRASAD, V.; HSIAO, H.-H.; LU, J.-C.; YANG, N.-S. and CHAN, M.-T. (2003). Agrobacterium tumefaciens-mediated transformation of an Oncidium orchid. Plant Cell Reports, vol. 21, no. 10, p. 993-998. [CrossRef]        [ Links ]

MATHEWS, H.; CLENDENNEN, S.K.; CALDWELL, C.G.; LIU, X.L.; CONNORS, K.; MATHEIS, N.; SCHUSTER, D.K.; MENASCO, D.J.; WAGONER, W.; LIGHTNER, J. and WAGNER, D.R. (2003). Activation tagging in tomato identifies a transcriptional regulator of anthocyanin biosynthesis, modification, and transport. The Plant Cell, vol. 15, no. 8, p. 1689-1703. [CrossRef]        [ Links ]

MEYER, V.; MUELLER, D.; STROWIG, T. and STAHL, U. (2003). Comparison of different transformation methods for Aspergillus giganteus. Current Genetics, vol. 43, no. 5, p. 371-377. [CrossRef]        [ Links ]

MICHIELSE, C.B.; HOOYKAAS, P.J.J.; VAN DEN HONDEL, C.A. and RAM, A.F.J. (2005). Agrobacterium-mediated transformation as a tool for functional genomics in fungi. Current Genetics, vol. 48, no. 1, p. 1-17. [CrossRef]        [ Links ]

MING, X.; WANG, L.; AN, C.; YUAN, H. and CHEN, Z. (2000). Resistance to rice blast (Pyricularia oryzae) caused by the expression of trichosanthin gene in transgenic rice plants transferred through Agrobacterium method. Chinese Science Bulletin, vol. 45, no. 19, p. 1774-1778. [CrossRef]        [ Links ]

MOHANTY, A.; SARMA, N.P. and TYAGI, A.K. (1999). Agrobacterium-mediated higher frequency transformation of an elite indica rice variety Pusa Basmati 1 and transmission of trangenes to R2 progeny. Plant Science, vol. 147, no. 2, p. 127-137. [CrossRef]        [ Links ]

MURASHIGE, T. and SKOOG, F. (1962). A revised medium for rapid growth and bio assays with tobacco tissue culture. Physiologia Plantarum, vol. 15, no. 3, p. 473-497. [CrossRef]        [ Links ]

NEGRUTIU, I.; HEBERLE-BORS, E. and POTRYKUS, I. (1986). Attempts to transform for kanamycin-resistance in mature pollen of tobacco. In: MULCAHY, D.L.; MULCAHY, B.G. and OTTAVIANO, E. eds. Biotechnology and Ecology of Pollen. Berlin Heidelberg, New York, Springer. p. 65-70.         [ Links ]

NONAKA, S.; YUHASHI, K.-I.; TAKADA, K.; SUGAWARE, M.; MINAMISAWA, K. and EZURA, H. (2008). Ethylene production in plants during transformation suppresses vir gene expression in Agrobacterium tumefaciens. New Phytologist, vol. 178, no. 3, p. 647-656. [CrossRef]         [ Links ]

SAMBROOK, J.; FRISCH, E.F. and MANIATIS, T. (1989). Molecular cloning: A laboratory manual (2th ed). Cold Spring Harbor Press, New York. 2344 p. ISBN 0-87969-136-0.         [ Links ]

SANFORD, J.C. and SKUBIK, K.A. (1986). Attempted pollen mediated transformation using Ti-plasmids. In: MULCAHY, D.L.; BERGAMINI-MULCAHY, H. and OTTAVIANO, E. eds. Biotechnology and Ecology of Pollen. Berlin Heidelberg, New York, Springer, p. 71-82.         [ Links ]

TANI, H.; CHEN, X.; NUMBERG, P.; GRANT, J.J.; SANTAMARIA, M.; CHINI, A.; GILROY, E.; BIRCH, P.R.J. and LOAKE, G.L. (2004). Activation tagging in plants: A tool for gene discovery. Functional & Integrative Genomics, vol. 4, no. 4, p. 258-266. [CrossRef]        [ Links ]

THORPE, T.A. (1994). Morphogenesis and regeneration. In: VASIL, I.K. and THORPE, T.A. eds. Plant Cell and Tissue Culture. Netherlands, Kluwer Academic Publishers, p. 17-36.         [ Links ]

TJOKROKUSUMO, D.; HEINRICH, T.; WYLIE, S.; POTTER, R. and MCCOMB, J. (2000). Vacuum infiltration of Petunia hybrida pollen with Agrobacterium tumefaciens to achieve plant transformation. Plant Cell Reports, vol. 19, no. 8, p. 792-797. [CrossRef]        [ Links ]

VAN DER FITS, L.; HILLIOU, F. and MEMELINK, J. (2001). T-DNA activation tagging as a tool to isolate regulators of a metabolic pathway from a genetically non-tractable plant species. Transgenic Research, vol. 10, no. 6, p. 513-521. [CrossRef]        [ Links ]

YU, H.; YANG, S.H. and GOH, C.J. (2001). Agrobacterium-mediated transformation of a Dendrobium orchid with the class 1 knox gene DOH1. Plant Cell Reports, vol. 20, no. 4, p. 301-305. [CrossRef]        [ Links ]

ZERBACK, R.; DRESSLER, K. and HESS, D. (1989). Flavonoid compounds from pollen and stigma of Petunia hybrida: Inducers of the vir region of Agrobacterium tumefaciens Ti plasmid. Plant Science, vol. 62, no. 1, p. 83-91. [CrossRef]        [ Links ]

Note: Electronic Journal of Biotechnology is not responsible if on-line references cited on manuscripts are not available any more after the date of publication.