SciELO - Scientific Electronic Library Online

 
vol.34 número3-4The Bacteriophage lambdaDNA packaging enzyme: Identification of four structural domains of the gpNu1 subunit using limited proteolysisAntiangiogenic effect of betamethasone on the chick cam stimulated by TA3 tumor supernatant índice de autoresíndice de assuntospesquisa de artigos
Home Pagelista alfabética de periódicos  

Serviços Personalizados

Journal

Artigo

Indicadores

Links relacionados

Compartilhar


Biological Research

versão impressa ISSN 0716-9760

Biol. Res. v.34 n.3-4 Santiago  2001

http://dx.doi.org/10.4067/S0716-97602001000300009 

Structure analysis of the endoxylanase A gene from
Penicillium purpurogenum

RENATO CHÁVEZ, CAROLINA ALMARZA, KAREN SCHACHTER*, ALESSANDRA PEIRANO, PAULINA BULL AND JAIME EYZAGUIRRE.

Laboratorio de Bioquímica, Departamento de Genética Molecular y Microbiología, Facultad de Ciencias Biológicas, Pontificia Universidad Católica de Chile, Santiago de Chile

*Current address: Department of Biochemistry, Michigan State University, East Lansing, Michigan 48824, USA

Corresponding author: Dr. Jaime Eyzaguirre. Laboratorio de Bioquímica, Pontificia Universidad Católica de Chile, Casilla 114-D, Santiago. Phone: (56-2) 686-2664. FAX: (56-2) 222-5515. E-mail: jeyzag@genes.bio.puc.cl

Received: July 13, 2001. In Revised Form: September 5, 2001. Accepted: September 20, 2001

ABSTRACT

Penicillium purpurogenum produces several endoxylanases, two of which (XynA and XynB) have been purified and characterized. XynB has been sequenced, and it belongs to glycosyl hydrolase family 11. In this publication we report the structure of the xynA gene. The amino terminal sequence of the protein was determined and this allowed the design of oligonucleotides for use in polymerase chain reactions. Different polymerase chain reaction strategies were used to amplify and sequence the entire cDNA and the gene. The gene has an open reading frame of 1450 base pairs, including 8 introns with an average length of 56 base pairs each. Only one copy of this gene is present in the P. purpurogenum genome as shown by Southern blot. The gene encodes a protein of 329 residues (including the signal peptide), and the calculated molecular mass of the mature protein is 31,668 Da. Immunodetection assays of the expressed gene positively identified it as xynA, and sequence alignments indicate a high degree of similarity with family 10 endoxylanases. It is concluded that P. purpurogenum produces endoxylanases of family 10 and 11. The complementary action of endoxylanases of both families may be important for an efficient degradation of xylan by the fungus. (Biol Res 2001; 34 3-4: 217-226)

Key terms: family 10 endoxylanases; gene structure; Penicillium purpurogenum

INTRODUCTION

Xylan is the principal component of plant hemicelluloses. It is a heteropolysaccharide constituted by linear chains of ß (1 —> 4)-linked D-xylopyranose residues with a number of different substituents which vary depending on the source. Due to its complex structure, the biodegradation of xylan requires the concerted action of a number of glycanases and esterases (collectively called xylanases), which are produced by a variety of bacteria and fungi (27). The main chain is hydrolyzed by the endoxylanases (E.C 3.2.1.8), which liberate oligosaccharides of different lengths.

The soft-rot fungus Penicillium purpurogenum is an active producer of a variety of xylan-degrading enzymes (4, 6, 9). The fungus secretes to the medium several endoxylanases (10), two of which, endoxylanases A and B (XynA and XynB), have been purified and characterized (4). Differences in properties such as molecular weight, pI, pH optimum, lack of antiserum cross-reactivity and lack of similarity of their amino terminal sequences suggest that different genes encode these enzymes. The sequence of the xynB cDNA has been determined (8), and XynB has been found to belong to glycosyl hydrolase family 11 (13).

It is known that a number of xylanolytic fungi and bacteria produce several endoxylanases (29). It is not clear why these organisms produce more than one enzyme form, and the role of each in xylan biodegradation. To help clarify the function of the xylanolytic enzymes in P. purpurogenum, this work analyzes the structure of the xynA gene. The product of this gene (XynA), has been found to belong to glycosyl hydrolase family 10.

MATERIALS AND METHODS

Fungal strain and general recombinant DNA techniques

Penicillium purpurogenum ATCC Nº MYA-38 (4) was kept in potato agar plates. Agarose gel electrophoresis, Southern blots, and genomic DNA isolation were carried out by standard procedures (2, 3).

Amino terminal sequence

Purified XynA (4) was used for the determination of a 40-residue sequence by automated Edman degradation. The N-terminal was found to be blocked, and deblocking was performed as follows: 33 mg (1 nmole) of protein was dissolved in 29µl of 50 mM sodium phosphate buffer pH 7 containing 10 mM DTT. Two µg (0.3 mU) of pyroglutamate amino peptidase were added and the mixture was incubated for 5 h at 37º C.

Primer design and conditions used in PCR

Table I shows the sequence and orientation of the primers used in this work. Degenerate primer JE-47 was designed from the amino terminal sequence of XynA. Degenerate primer JE-48 was devised by comparison between a highly conserved nucleotide sequence from endoxylanase P from Penicillium chrysogenum (12) and endoxylanase A from Aspergillus kawachii (14). Oligonucleotides JE-53, JE-82, JE-84, JE-85, JE-95 and JE-96 were deduced from known sequences. Oligonucleotides were synthesized by Synthaid Biotechnologies Inc. (Ontario, Canada) or by Oligopéptido (Santiago, Chile). Abridged Universal Amplification Primer (AUAP) and 5' RACE Abridged Anchor Primer (AAP), used in RACE reactions (see below), were provided by the kit manufacturer (GIBCO-BRL).

PCR reaction mixtures (25µl) contained 20 mM Tris-Cl (pH 8.75), 10 mM KCl, 10 mM (NH4)2SO4, 2 mM MgSO4, 0.1% Triton X-100, 100µg/ml BSA, dATP, dCTP, dGTP and dTTP (50 µM each), 5 pmoles of each primer, 0.625 U of Taq polymerase (GIBCO-BRL) and 0.0375 U of Pfu polymerase (Stratagene) to ensure accuracy of the amplified product. The amount of template used was 0.5-0.6 ng except for IPCR and RACE (indicated below). Amplification conditions (performed in a MJ Research MiniCycler) were: 1 minute at 98ºC followed by 35 cycles of 1 minute at 94º, 1 minute at 54ºC and 1 minute at 72ºC and a final elongation of 10 minutes at 72ºC. This protocol was the same for all PCR-based strategies except for RACE.

RNA preparation

107 spores were pre-grown in 100 ml of Mandels' liquid medium (18) containing 1% fructose for 17 hours at 200 rpm and 28ºC in a rotatory shaker. The mycelium was filtered, washed with PBS (137 mM NaCl, 2.7 mM KCl, 10 mM Na2HPO4, 1.8 mM KH2PO4, pH 7.4) and transferred to the same medium containing 0.1% oat spelts xylan as inducer. Induction was carried out for 14 hours at the same temperature and aeration conditions. The collected mycelium was washed in PBS, frozen in liquid nitrogen and stored at -70ºC until used. The mycelium was homogenized with Trizol (GIBCO-BRL) (1 ml Trizol / g mycelium) in a Potter homogenizer with Teflon pestle. 0.2 ml chloroform were added to 1 ml of homogenate, vortexed and kept for 5 min at 4ºC. The aqueous phase was separated by centrifugation (4ºC/14000g/15 min). One volume of acid phenol was added, mixed, and kept for 15 min at 4ºC. Then 0.2 volumes of chloroform/isoamyl alcohol (24:1) were added, mixed, and after 5 min at 4ºC, the mixture was centrifuged as above. The resulting aqueous phases were phenol-extracted two more times. Total RNA was precipitated with 0.5 volumes of 1.2 M NaCl /0.8 M sodium citrate and 0.5 volumes of isopropanol, kept for 15 min at 4ºC, and recovered by centrifugation at 14,000 g for 10 min at 4 ºC. The pellet was washed with 1 ml of 70% ethanol and dissolved in 100 µl of TE (10 mM Tris-HCl, 1 mM EDTA, pH 7.5) for storage at -70 ºC.

cDNA preparation and Rapid Amplification of cDNA Ends (RACE) reactions

Purified total RNA (2.5 µg) were reverse transcribed using SuperScript II RT (GIBCO-BRL) according to the manufacturer's instructions. 5' and 3' RACE reactions (GIBCO-BRL kits) were carried out according to the manufacturer's instructions. For 3' RACE, 2 µl from the first strand cDNA product were directly used as template, and PCR was performed with primers JE-82 (gene specific primer) and AUAP. One µl from a 1/10 dilution of this first PCR reaction was used as template for a second nested PCR, with primers JE-84 (gene specific nested primer) and AUAP.

For 5' RACE a poly-C tail was added to the first strand cDNA products using terminal deoxynucleotidyl transferase previous to the PCR rounds. Five µl from this tailed cDNA mixture were used as template, and PCR was performed with primers JE-53 (gene specific primer) and AAP. Five µl of a 1/10 dilution from this first PCR reaction was used as template for a second nested PCR, with primers JE-85 (gene specific nested primer) and AUAP.

DNA sequencing strategy for xynA

The strategy used to obtain the complete sequence of the cDNA was as follows: using degenerate primers JE-47 and JE-48 and the previously synthesized cDNA (see above), a fragment containing part of the cDNA of XynA (500 bp in length) was produced by PCR. This fragment was sequenced and used to design non-degenerate primers JE-53, 82, 84 and 85. Using RACE 3´ and RACE 5´ the complete cDNA sequence was obtained. The gene was sequenced as follows: PCR amplification was performed with primers JE-95 and JE-96 and genomic DNA as template. A fragment containing all introns was thus obtained.

Table I
Oligonucleotides used in this work


Primer

Sequence (5' to 3') Locationa Orientation

JE-47b

TTCAAGGCTCACGGWAA 109 to 124 sense

JE-48b

TTGTARTCGTTGATGTA 811 to 827 antisense

JE-53

TGTAACGGGTCATCACG 589 to 606 antisense

JE-82

CCGTGATGACCCGTTACA 589 to 606 sense

JE-84

CTACGTCCGCATTGCTT 756 to 772 sense

JE-85

GGTCACCAATGGTACCA 135 to 151 antisense

JE-95c

AGACTCGGATCCTTCAAG
GCCCACGGCAA
109 to 124 sense
JE-96c AGACTCAAGCTTGCGAAG
CCAATGATGGT
1607 to 1623 antisense

AUAPd

GGCCACGCGTCGACTAGTAC

AAPe

GGCCACGCGTCGACTAGTAC
GGGIIGGGIIGGGIIG

a Sequence numbering starts at the A of the initiation codon and includes introns.
b W: A or T; R: A or G.
c Primers JE-95 and JE-96 carry a BamHI or HindIII restriction site, respectively.
d Supplied by both 3' and 5' RACE kits.
e Supplied by 5' RACE kit.

 

In all cases, PCR products were purified from low-melting point agarose gels (GIBCO-BRL) using the Concert Rapid Gel Extraction System (GIBCO-BRL), and they were cloned using pGEM-T (Promega) in Escherichia coli DH5a. Plasmid DNA was prepared using the Plasmid Mini Kit (Qiagen) and sequencing was performed on both strands using an Applied Biosystems ABI PRISM 310 DNA sequencer.

Southern blot assays

Twenty µg of P. purpurogenum genomic DNA were cut using several restriction enzymes, electrophoresed in 0.8% agarose gel, stained with ethidium bromide and transferred onto nylon membranes (Hybond) using standard methods (2). The 500 bp of xynA cDNA described above was used as probe. This probe was purified from agarose gels using the Concert Rapid Gel Extraction System (GIBCO-BRL) and labeled with [a-32P]dCTP using the Random Primers DNA Labeling System (Life Technologies). Southern blots were carried out by standard methods (2). Briefly, transferred membranes were prehybridized for 2 hours and then hybridized overnight with the respective probe at 42 ºC. After hybridization, membranes were washed twice with 2x SSC for 15 minutes at room temperature and twice with 1x SSC, 0.1% SDS for 15 minutes at 65ºC and exposed for detection on films.

Bacterial expression of xynA

xynA was expressed as a fusion protein with anthranilate synthase (17). The xynA cDNA was amplified by PCR using primers JE-95 and JE-96 which contain restriction sites for BamHI and HindIII respectively, and the product was cut using these restriction enzymes. The digested cDNA was purified and cloned into the pATH-3 vector previously cut with the same restriction enzymes, obtaining pGM1 which contains xynA's cDNA in frame with the anthranilate synthase gene. E. coli RR1 was transformed with pGM1 and expression of the hybrid protein was induced by tryptophan starvation followed by addition of indoleacrylic acid. Hybrid protein was detected from bacterial lysates by western blot (5) using antisera prepared as described previously (4).

Sequence alignment of XynA and similar proteins

A search for proteins showing > 50% sequence similarity to XynA was made using BLASTP. Alignment of these sequences was carried out using MATCHBOX. This program identifies boxes of greatest similarity (7). Location of the regions of highest and lowest similarity in the tertiary structure of fungal family 10 xylanases was accomplished using the Penicillium simplicissimum xylanase structure (25) by means of RASMOL.

Nucleotide sequence accession number

The P. purpurogenum xynA sequence described in this work has been deposited in the DDBJ/EMBL/GenBank nucleotide sequence database under accession Nº AF249328.

RESULTS

Amino terminal sequence of XynA

After deblocking, it was possible to sequence the amino terminal end of the protein, obtaining the following sequence: ASVSIDAKFKAHGKKYLGTI(G or K)DQYT(L or A)tKNSKNPAIIKADF

The t in position 27 is shown in lower case because the result is uncertain.

Characterization of the P. purpurogenum xynA gene

The sequence of the xynA gene is presented in Figure 1. The open reading frame of the gene consists of 1450 bp; when compared to the cDNA sequence, 8 introns were detected with an average length of 56 bp. All introns except intron 6 show the consensus sequence GT.....AG for splicing (see Discussion). The typical polyadenylylation signal AATAAA (21) was found 151 bp downstream of the stop codon and 16 bp upstream of the polyadenylylation site. This signal is not frequently found in fungal genes, but is present in some xylanolytic genes (20).

To determine the number of copies of this gene present in the genome of P. purpurogenum, Southern blots using digested genomic DNA were carried out (Fig 2). One hybridizing band was detected using BamHI, EcoRI, HindIII, KpnI, PstI, SacI and XmnI; as expected, two bands were observed using BglII, because this enzyme cuts the sequence in the region of the gene corresponding to the probe used. These results indicate that only one copy of the gene is present in P. purpurogenum genome; this was confirmed by Southern blots of genomic DNA digested using combinations of these restriction enzymes (not shown).

 

Figure 2. Southern blot of digested P. purpurogenum DNA hybridized with xynA probe.
Lane 1: BamHI. Lane 2: EcoRI. Lane 3: HindIII. Lane 4: BglII. Lane 5: KpnI. Lane 6: PstI. Lane 7: SacI. Lane 8: XmnI. l/HindIII molecular weight standards are indicated (Kbp).

Since P. purpurogenum produces several endoxylanases (10), it was important to confirm that the sequenced gene codes for XynA and not for another xylanase. Therefore, its cDNA was cloned in an E.coli expression vector (pATH-3; (17)) and the protein product (expressed as a fusion protein with anthranilate synthase) was detected with antibodies raised against purified native XynA (4). Western analysis showed a fusion protein of the expected size (about 70 Kda) present only in cultures of E. coli transformed with constructs harboring the xynA cDNA and induced for expression, but not in the controls (Fig 3).

 

Figure 3. Western blot analysis of E.coli transformed with cDNA of XynA.
Lane 1: E. coli RR1 cell extract. Lane 2: extract of E. coli transformed with pATH-3 and grown without tryptophan. Lane 3: extract of E. coli transformed with pATH-3 and grown with tryptophan. Lane 4: extract of E. coli transformed with pGM1 and grown without tryptophan. Lane 5: extract of E.coli transformed with pGM1 and grown with tryptophan. Lane 6: molecular weight standards. The cultures lacking tryptophan were added indoleacrylic acid as inducer for the expression of the fusion protein. An arrow indicates the fusion protein.

Characteristics of the deduced protein sequence of XynA

The sequence of the XynA protein is shown in Figure 1. The protein comprises 329 residues including the signal peptide. The deduced N-terminal of the mature protein agrees well with the N-terminal obtained from Edman degradation of purified XynA. The mature protein comprises 302 residues, with a calculated molecular mass of 32,538 KDa, similar to the value estimated from SDS-PAGE (33,000 (4)). Only one potential N-glycosylation site at N 285 can be identified. The protein possesses two cysteines at positions 283 and 289, which may be forming an S-S bridge (see Discussion); residues E159 and E265 may be postulated as catalytic, as judged by comparison with other endoxylanases (see Discussion).

By means of BLAST P, a search was made in the databases for proteins similar to XynA. Those endoxylanases with more than 50% identity to XynA (14 sequences of proteins, all fungal endoxylanases belonging to family 10) were aligned with XynA using MATCHBOX (Fig 4). It was found that the endoxylanase from P. simplicissimum has 97% identity with XynA. Four boxes of very high similarity can be detected from the alignment, and a total of 77 residues are conserved in all sequences, including the putative catalytic glutamates and the cysteines. The regions of highest and lowest similarity were identified in the tertiary structure of the xylanase of Penicillium simplicissimum (25) and are shown in Figure 5.

 

DISCUSSION

This work presents the sequence of the xynA gene, its cDNA, and the deduced amino acid sequence of XynA. The sequencing strategy used was based on the determination of the amino terminal sequence of the mature protein, which was performed by automated Edman degradation. It was found that the amino terminal was blocked; therefore the protein was treated with pyroglutamate amino peptidase. Similar blocking has been described for other endoxylanases of family 10 (P. chrysogenum (12), A. kawachii (14)). In the case of P. chrysogenum, the N terminal was assigned theoretically by the method of von Heijne (28) as G24; however, since the sequence is blocked, the N terminal is more likely to be Q31 which also matches better with the mature sequence of the enzymes from P. purpurogenum and A. kawachii. In a previous publication (4) we erroneously reported the amino terminal sequence of XynA as GPXDIYSSGGTPPVANH; it was later found that this sequence corresponds to an arabinofuranosidase (6). The error may be attributed to a trace protein contaminating the blocked XynA present in the sample.

The structure of the xynA gene was inferred from sequence information of cDNA and genomic amplifications using PCR techniques. The gene (Fig 1) consists of 1450 bp including 8 introns, 50 to 67 bp long (average 56 bp); all the introns have the consensus sequence GT.....AG for splicing, except intron 6, which contains a splicing sequence AT.....AC. This `deviation' of the consensus has been described as an example of intron sliding; this sequence could be an ancestral consensus which shifted to GT.....AG in more recently evolved fungi, like A. kawachii (23). This `deviated' intron is found in several family 10 fungal endoxylanase genes, including P. chrysogenum (12) and P. simplicissimum (25). It is interesting to note that the xynB gene from P. purpurogenum (coding for a family 11 xylanase) contains just one intron, 49 bp long with the expected GT.....AG sequence for splicing (see GenBank Nº AF 359553). Other fungal family 11 endoxylanase genes also have only one or two introns (1, 11, 15, 24). The significance of this difference between the genes of the two endoxylanase families is unknown.

P. purpurogenum produces multiple endoxylanases (5), and the expression and Southern blot experiments carried out here confirms that the sequenced gene encodes for the previously purified XynA protein (4), and that only one copy of this gene is present in this fungus. It remains to be elucidated if the other endoxylanases are the product of other different genes or corresponds to different forms of the genes sequenced so far (xynA and xynB).

A large number of sequences with a high degree of identity (over 50%) to XynA was found using BLASTP, all of them fungal endoxylanases belonging to family 10. The alignment performed with MATCHBOX of the 15 sequences shows the presence of four highly conserved boxes. The two cysteine residues, present in all the sequences compared, are probably forming disulfide bridges, as it is found in the structure of P. simplicissimum endoxylanase (25). The postulated catalytic glutamic acids (E159 and E265 in XynA) are also conserved in all the sequences. A putative N-glycosylation site (N 285) is present in XynA, but is not conserved in the other endoxylanases. As expected from their taxonomic relationships, XynA is closest to the endoxylanases from the other Penicillium species and to the enzymes from Aspergillus and Trichoderma. The structure of family 10 endoxylanases, as shown in Figure 5 for the P. simplicissimum enzyme (25), corresponds to an (a/ß) barrel. The regions of highest similarity (shown in black in Fig. 5) are located mainly in the center of the barrel and around the active site glutamates, while the variable regions (displayed as thin strands in Fig. 5) are found in the periphery of the structure, preferentially in the a-helices.

In conclusion, P. purpurogenum possesses at least one endoxylanase from family 10 (XynA) and one from family 11 (XynB). These enzymes may complement each other in the biodegradation of xylan, either by acting on different bonds of the xylan structure or by being expressed under different conditions.

We are currently working to determine whether there are differences in the expression patterns of both endoxylanase genes and their possible functional implications.

 

Figure 5. Regions of high and low similarity between fungal family 10 xylanases as seen in the structure of P. simplicissimum endoxylanase.
The structure, obtained from the Protein Data Bank, was displayed using RASMOL. Regions of highest similarity (as detected with MATCHBOX) are shown in black. The catalytic glutamates are filled. Variable regions are depicted as thin strands.

 

ACKNOWLEDGEMENTS

This work was supported by grants from FONDECYT-CHILE 2990078 (R.C.) and 9800004 (Líneas Complementarias). We thank Drs. Carlos George-Nascimento and Scott Chamberlain, Chiron Corp., Emeryville, California, for performing the amino terminal sequence determination by Edman degradation. The collaboration of Pamela Sandoval and Gabriela Morales in this work is gratefully acknowledged.

REFERENCES

1 APPEL-BIRKHOLD PC, WALTON JD (1996) Cloning, disruption and expression of two endo-ß1, 4 xylanase genes XYL2 and XYL3 from Chochliobolus carbonum. Appl Environ Microbiol 62: 4129-4135         [ Links ]

2 AUSUBEL FM, BRENT R, KINGSTON RE, MOORE DD, SEIDMAN JG, SMITH JA, STRUHL K (1990) Current protocols in Molecular Biology. John Wiley and Sons Inc., New York         [ Links ]

3 BAINBRIDGE BW, SPREADBURY CL, SCALISE FG, COHEN J (1990) Improved methods for the preparation of high molecular weight DNA from large and small-scale cultures of filamentous fungi. FEMS Microbiol Lett 66: 113-118         [ Links ]

4 BELANCIC A, SCARPA J, PEIRANO A, DÍAZ R, STEINER J, EYZAGUIRRE J (1995) Penicillium purpurogenum produces several xylanases: purification and properties of two of the enzymes. J Biotechnol 41: 71-79         [ Links ]

5 BOLLAG DM, EDELSTEIN SJ (1991) Protein Methods, New York: John Wiley and Sons Inc.         [ Links ]

6 DE IOANNES P, PEIRANO A, STEINER J, EYZAGUIRRE J (2000) An a-L-arabinofuranosidase from Penicillium purpurogenum: production, purification and properties. J Biotechnol 76: 253-258         [ Links ]

7 DEPIEREUX E, FEYTMANS E (1992) MATCHBOX: a fundamentally new algorithm for the simultaneous alignment of several protein sequences. CABIOS 8: 501-509         [ Links ]

8 DÍAZ R, SAPAG A, PEIRANO A, STEINER J, EYZAGUIRRE J (1997) Cloning, sequencing and expression of the cDNA of endoxylanase B from Penicillium purpurogenum. Gene 187: 247-251         [ Links ]

9 EGAÑA L, GUTIÉRREZ R, CAPUTO V, PEIRANO A, STEINER J, EYZAGUIRRE J (1996) Purification and characterization of two acetyl xylan esterases from Penicillium purpurogenum. Biotechnol Appl Biochem 24: 33-39         [ Links ]

10 EYZAGUIRRE J, SCARPA J, BELANCIC A, STEINER J (1992) The xylanase system of Penicillium purpurogenum. In VISSER J, BELDMAN G, KUSTERS-VAN SOMEREN MA, VORAGEN AGJ (eds.) Xylans and Xylanases. Amsterdam: Elsevier Science Publisher B.V. pp: 505-510         [ Links ]

11 GIESBERT S, LEPPING HB, TENBERGE KB, TUDZYNSKI P (1998) The xylanolytic system of Claviceps purpurea: cytological evidence for secretion of xylanases in infected rye tissue and molecular characterization of two xylanase genes. Phytopathol 88: 1020-1030         [ Links ]

12 HAAS H, FRIEDLIN E, STÖFFLER G, REDL B (1993) Cloning and structural organization of a xylanase-encoding gene from Penicillium chrysogenum. Gene 126: 237-242         [ Links ]

13 HENRISSAT B, BAIROCH A (1993) New families in the classification of glycosyl hydrolases based on amino acid sequence similarities. Biochem J 293: 81-788         [ Links ]

14 ITO K, IKEMASU T, ISHIKAWA T (1992) Cloning and sequencing of the xynA gene encoding xylanase A of Aspergillus kawachii. Biosc Biotechnol Biochem 56: 906-912         [ Links ]

15 KIMURA T, KITAMOTO N, KITO Y, KARITA S, SAKKA K, OHMIYA K (1998) Molecular cloning of xylanase gene xynG1 from Aspergillus oryzae KBN 616, A shoyu koji mold, and analysis of its expression. J Ferment Biotechnol 85: 10-16         [ Links ]

16 KITAMOTO N, YOSHINO S, ITO M, KIMURA T, OHMIYA K, TSUKAGOSHI N (1998) Repression of the expression of genes encoding xylanolytic enzymes in Aspergillus oryzae by introduction of multiple copies of the xynF1 promoter. Appl Microbiol Biotechnol 50: 558-563         [ Links ]

17 KOERNER TJ, HILL HE, MYERS AM, TZAGOLOFF A (1991) High-expression vectors with multiple cloning sites for construction of trpE fusion genes: pATH vectors. Methods Enzymol 194: 477-490         [ Links ]

18 MANDELS M, WEBER J (1968) The production of cellulases. Adv Chem Ser 95: 391-414         [ Links ]

19 MACCABE AP, FERNÁNDEZ-ESPINAR MT, DE GRAAFF LH, VISSER J, RAMÓN D (1996) Identification, isolation and sequence of the Aspergillus nidulans xlnC gene encoding the 34-kDa xylanase. Gene 175: 29-33         [ Links ]

20 PÉREZ- GONZÁLEZ JA, VAN PEIJ NNME, BEZOEN A, MACCABE AP, RAMÓN D, DE GRAAFF LH (1998) Molecular cloning and transcriptional regulation of the Aspergillus nidulans xlnD gene encoding a ß-xylosidase. Appl Environ Microbiol 64: 1412-1419         [ Links ]

21 PROUDFOOT NJ, BROWNLEE GG (1976) 3´Non-coding region sequences in eukaryotic messenger RNA. Nature 263: 211-214         [ Links ]

22 RUIZ-ROLDÁN MC, DIPIETRO A, HUERTAS-GONZALEZ MD, RONCERO MIG (1999) Two xylanase genes of the vascular wilt pathogen Fusarium oxysporum are differentially expressed during infection of tomato plants. Mol Gen Genet 261: 530-536         [ Links ]

23 SATO Y, NIIMURA Y, YURA K, GO M (1999) Module-intron correlation and intron sliding in family F/10 xylanase genes. Gene 238: 93-101         [ Links ]

24 SCHLACHER A, HOLZMANNN K, HAYN M, STEINER W, SCHWAB H (1996) Cloning and characterization of the gene for the thermostable xylanase XynA from Thermomyces lanuginosus. J Biotechnol 49: 211-218         [ Links ]

25 SCHMIDT A, SCHLACHER A, STEINER W, SCHWAB H, KRATKY C (1998) Structure of the xylanase from Penicillium simplicissimum. Protein Sci 7: 2081-2088         [ Links ]

26 SRINIVASA BR, SWAMINATHAN KR, GANAPATHY C, ROY RP, MURTHY SK, VITHAYATHIL PJ (1991) The primary structure of xylanase from Thermoascus aurantiacus. Protein Seq Data Anal 4: 15-20         [ Links ]

27 SUNNA A, ANTRANIKIAN G (1997) Xylanolytic enzymes from fungi and bacteria. Crit Rev Biotechnol 17: 39-67         [ Links ]

28 VON HEIJNE G (1986) A new method for predicting signal sequence cleavage sites. Nucleic Acids Res 14: 4683-4690         [ Links ]

29 WONG KKY, TAN LUL, SADDLER JN (1988) Multiplicity of ß-1,4 xylanases in microorganisms: function and applications. Microbiol Rev 52: 305-317         [ Links ]

30 WU SC, KAUFFMANN S, DARVILL AG, ALBERSHEIM P (1995) Purification, cloning and characterization of two xylanases from Magnaporthe grisea, the rice blast fungus. Mol Plant Microbe Interact 8: 506-514         [ Links ]

Creative Commons License Todo o conteúdo deste periódico, exceto onde está identificado, está licenciado sob uma Licença Creative Commons