SciELO - Scientific Electronic Library Online

 
vol.34 issue3-4Comments on Professor Serani's articleThe Bacteriophage lambdaDNA packaging enzyme: Identification of four structural domains of the gpNu1 subunit using limited proteolysis author indexsubject indexsearch form
Home Pagealphabetic serial listing  

Biological Research

Print version ISSN 0716-9760

Biol. Res. vol.34 no.3-4 Santiago  2001

doi: 10.4067/S0716-97602001000300007 

Differential effects of doxorubicin on atrial natriuretic
peptide expression in vivo and in vitro

ASIM RAHMAN,4 MAHMOOD ALAM,1,2,4 SUDHA RAO,5 LIN CAI2, LUTHER T. CLARK,1,4 SAYID SHAFIQ,3 and M.A.Q SIDDIQUI,1,2

1- Center for Cardiovascular and Muscle Research
2- Department of Anatomy and Cell Biology
3- Department of Neurology
4- Division of Cardiology
5- Division of Pediatric Cardiology
State University of New York, Downstate Medical Center, Brooklyn, NY

Corresponding Author: M.A.Q. Siddiqui, Ph.D. Professor & Chair, Department of Anatomy and Cell Biology, State University of New York, Health Science Center at Brooklyn. 450 Clarkson Avenue - Box 5. Brooklyn, NY 11203. Telephone: (718) 270-1014. Fax: (718) 270-3732. E-mail: msiddiqui@netmail.hscbklyn.edu

Received: January 29, 2001. In Revised form: September 7, 2001. Accepted: September 10, 2001

 

ABSTRACT

Doxorubicin (Dox) is a potent anti-cancer agent with cardiotoxic side-effects but the mechanism of its cardiotoxicity and its effect on expression of the vasoactive atrial natriuretic peptide (ANP), an important marker for cardiac hypertrophy, are little understood. The present study examined Dox-induced changes in vivo in hearts of 6 mongrel dogs and 5 Sprague-Dawley rats and in vitro in cardiac cultures of neonatal rats. Quantitative RT-PCR analysis using g32-p labeled primers for ß-actin, phospholamban (PLB) and ANP showed a selective 5-fold increase of ANP mRNA in Dox-treated dog hearts in comparison to controls. Similarly, northern analysis of GAPD, ß-actin, cardiac a-actin and ANP gave a selective 4.5-fold increase in ANP transcripts in Dox-treated rat hearts. On the other hand, there was a selective decrease (approximately 39%) of ANP transcripts in Dox-treated cardiac cultures relative to controls. Immunohistochemistry localized the ANP changes both in tissue sections and in cultures to the cardiomyocytes. The data clearly showed that Dox selectively increases ANP expression in dog and rat hearts in absence of cardiocyte hypertrophy but selectively decreases it in cardiac cultures. This differential effect of Dox on cardiocytes in vivo and in vitro should be a useful parameter for studies of transcriptional control of ANP expression. (Biol Res 2001; 34 3-4: 195-206)

 

Key Terms: Atrial natriuretic peptide, gene expression, adriamycin, heart failure

INTRODUCTION

Doxorubicin (Dox) is one of the most potent anti-cancer agents exerting its cytotoxic effect on rhabdomyosarcoma and other malignant cells by generation of free radicals and subsequent induction of apoptosis (14). Its widespread clinical use is limited because congestive heart failure and cardiomyopathy develop following administration of the drug (16). Over the past several years several animal models have been well established to investigate both in vivo and in vitro the mechanisms of Dox-induced cardiac dysfunction. Recent studies indicate that in the heart, Dox selectively inhibits the expression of tissue specific genes but not of housekeeping genes (10).

Atrial natriuretic peptide (ANP) is a hormonal regulator of water and salt excretion due to its potent diuretic and natriuretic activities (5). Its expression is tissue specific limited primarily to cardiac atria in the adult stage, but during fetal and neonatal periods its expression is also high in cardiac ventricles (27). In animal models of cardiac hypertrophy there is induction of fetal program of gene expression in ventricular cells such that several fetal genes e.g., skeletal a-actin, ß-myosin heavy chain, and particularly ANP are up-regulated. There is previous evidence that Dox modulates ANP expression but its precise effect on ANP expression in ventricular cells has been little studied. Because of the importance of the ANP gene in cardiac pathophysiology, in this report we investigate the effects of Dox on ANP expression in hearts of dogs and rats in vivo, as well as in rat ventricular cells in tissue culture.

 

MATERIALS AND METHODS

Animals

Six mongrel dogs received intracoronary infusions of Dox at 0.25 mg/kg weekly for 4 weeks to reach a cumulative dose of 1 mg/kg body weight. This dose regimen of intracoronary Dox infusion has been shown to reliably produce Dox cardiomyopathy in dogs over the course of 12 weeks while minimizing its systemic effects (20). Open myocardial biopsies were taken from the dogs by mini-thoractomy before injecting Dox (week 0), which served as controls. The surgical interventions and the hemodynamic measurements given below were performed under anesthesia, its induction was with intravenous pentobarbital (10-20 mg/kg), and maintenance with oxygen/halothane mixture. At the end of the protocol (week 16), the animals were killed by a euthanizing dose of intravenous sodium pentobarbital i.e., 100 mg/kg body weight. The details of the operative techniques used have been described previously (20).

Twelve male Sprague-Dawley rats (body weight, approx. 250 g) were divided into two groups: Dox-treated and control. Dox dissolved in normal saline was administered intraperitoneally in six equal injections (each containing Dox at 2.5 mg/kg body weight) to six rats. The other six rats served as controls and received injections of normal saline. Both treated and control animals were observed for their appearance, behavior, and mortality for a period of 4 weeks after the last injection. At the end of this period, animals were assessed by 2D echocardiograms and killed by a euthanizing dose of intravenous sodium pentrobarbital i.e., 100 mg/kg body weight.

Tissue Culture

Cardiac myocytes were isolated from rat neonatal hearts by using the method of Toraason et al. (25). In brief, newborn rats were anesthetized with dry ice, and their hearts were quickly removed and immersed in ice cold calcium- and magnesium-free Hank's Balanced Salt Solution (CMF HBSS) adjusted to pH 7.4. The blood from the excised hearts was thoroughly washed out with CMF HBSS and either whole hearts, or the ventricles cut out from the hearts were used for initiating the tissue cultures. The appropriate tissue was minced in CMF HBSS and incubated overnight in trypsin in the same saline solution. The next morning, the tissue was treated with trypsin inhibitor and digested with collagenase in Leibovitz L-15 medium for 45 min. at 37°C. The cells released were pelleted and suspended in Leibovitz L-15 medium containing 10% horse serum, 10% fetal calf serum, fungizone, and penicillin and streptomycin antibiotics. To reduce the fibroblast population preplating of the cell suspension was done for 1-2 hours at 37°C in a humidified incubator without carbon dioxide. After preplating, the cells were counted using a hemocytometer and cultures were set up at a seeding density of 4X104 cells / cm2. Cultures were then treated with Dox (0.5 and 1.0 µM concentrations) following the protocol of Ito et al. (10).

Echocardiograms

For dogs: Two-dimensional echocardiographs were obtained using a 1500 echocardiographic system (Hewlett-Packard, Andover, MA) with 2.5 - mHz transducer. Long- and short-axis views were obtained at the apex, left sternal border and subcostal margin. The calculated parameters included left and right ventricular end-diastolic diameter, length and ejection fraction. Left ventricular volumes were calculated using Simpson's rule (28).

For Rats: Echocardiographic studies were performed using a phased array system (Acuson 128XP / 10C). A 7.5-mHz transducer was used to obtain optimal images from the parasternal short axis projection. M-mode echocardiograms were obtained with the M-mode cursor angled through the center of the left ventricular cavity just below the mitral leaflets. Assessment of left ventricular cavity measurements and systolic function in control as well as Dox-treated rats was performed using the guidelines of Devereux et al. (6).

Immunohistochemistry

Cardiac samples from control and Dox-treated dogs and rats were frozen in isopentane chilled with liquid nitrogen and stored at -70°C. Some of these samples were embedded in M1 embedding medium (Lipshaw, Pittsburgh, PA) and sections (15µm thick) were prepared on a cryostat and picked on Probe-on slides (Fisher, Springfield. N.J.). Also cardiac myocytes from neonatal rat hearts, grown on sterile cover slips were fixed in 1:1 mixture of methanol and acetone at -20°C. All tissue samples were treated with TNB (0.1 M Tris HCI, pH 7.5, 0.15 M NaC1, 0.5% Dupont blocking reagent) and then with anti-myosin heavy chain (MF-20) (2), anti-ANP (Peninsula, Belmont, CA) or anti-SERCA-2 antibodies. In each case the antibody dilutions were done in TNB and the antibody treatment was for one hour at room temperature. The slides were then washed with TNT (0.1 M Tris HC1, pH 7.5, 0.15 M NaC1, 0.05% Tween-20) and treated with appropriate anti-IgG antibodies coupled with fluorescein isothiocyanate (FITC). A Leitz photomicroscope (Wild Leitz CmbH, Wetzlar, Germany) equipped with epifluorescence optics was used for observation and photomicrography. For effective comparison of control and Dox-treated samples all procedures for immunohistochemical staining and photography were done under strictly identical conditions.

Electron Microscopy

Adult dog heart tissue was fixed for 2 hrs in 2.5% glutaraldehyde in 0.1 M phosphate buffered saline (pH 7.4), washed in buffer, and post-fixed in 2% osmium tetroxide for 1 hr. The samples were dehydrated in a graded ethanol series and embedded in 100% epoxy resin. Thick sections (1µm) stained with toluidine blue were surveyed by light microscopy. Thin sections (50-60 nm), prepared from selected areas were mounted on uncoated grids, stained with lead citrate, and examined with an electron microscope.

Northern Blot Analysis

Cardiac muscle samples from all six control and all six Dox-treated rats were immediately frozen in liquid nitrogen and stored at -70°C. Control and Dox-treated cardiac cultures from four different experiments were washed in phosphate buffered saline (PBS), scraped from the culture plates, pelleted and also stored at -70°C. Total cellular RNA was extracted from the frozen samples after homogenization in RNAzol B solution (Biotecx Laboratories, Friendsville, TX) with a few strokes in a glass-Teflon homogenizer following the manufacturer's protocol. The extracted RNA was precipitated with 1 volume of isopropanol at 4°C for 15 min. and washed once with 70% ethanol and re-suspended in 100µl of diethylpyrocarbonate (DEPC) treated water. Equal amounts (approximately 20µg) of each RNA sample, as determined by ethidium bromide staining of formaldehyde agarose gels, were transferred to nitrocellulose filters by capillary elution. Blotted RNA was cross-linked to the filters by baking at 80°C in a vacuum oven. It was then hybridized overnight at 42°C in the presence of 50% formamide, 5x SSC (1x SSC is 0.15 M NaC1, 0.015 M sodium citrate), 1x Denhardt's, 0.1% SDS and 0.5x106 cpm/ml of 32P-labeled probes. The filters were washed in 0.1x SSC / 0.1% SDS at 55°C for 20 minutes and were exposed to X-ray film from 6 hours to 2 days at -70°C with intensifying screens. The cDNA probes used were: 1300 bp human glyceraldehyde-3-phosphate dehydrogenase (GAPDH), 1.8 Kb cardiac (a-actin and 900 bp rat ANP, a kind gift from Dr. K. Pandey. Results from all 12 rats and the four different tissue culture experiments were quantitated by scanning densitometry.

Reverse Transcription - Polymerase Chain Reaction (RT-PCR)

Total cellular RNA from dog cardiac samples was extracted as described in the previous section and used for quantitative RT-PCR (12). Two µg of each RNA sample dissolved in 20µl of DEPC-treated water was reverse-transcribed by random priming in a total volume of 40 µl by addition of a master mix containing 4 µl of 10 x PCR buffer (500 mM KC1, 100 mM Tris, pH 8 and 25 mM MgC12), 0.4 µl of 0.1 mM dithiothreitol, 40 units of RNasin, 1 µg of random hexamer, 400 units of Maloney murine leukemia virus reverse transcriptase (Gibco / BRL, Grand Island, NY), a final concentration of 1 mM dATP-dGTP-dTTP, 0.03 mM dCTP and 1 µCi of 3000 Ci / mM (a-32P) dCTP (NEN, Boston, MA). The reaction was incubated at 37°C for 1 hr. The quantitation of cDNA was done by trichloroacetic acid precipitation (18).

PCR amplification were done for ß-actin, phospholamban (PLB) and ANP using the following primers; (ß-actin: 5'GTGGGCCGCTCTAGGACCA3' and 5'CGGTTGGCCTTAGGGTTCAGGGGGG3';PLB:5'AATCATCACAAGAGAGCCAAGG3' and 5'AGTATTATTTTCCCCTCTTC3'; ANP: 5'CATCGCCGCCGCAAGCTTCCT3' and 5'GGCCATTATCTTCAGTACCGGA3'.

For PCR reaction the primers were end-labeled with (g-32P) ATP (>3000Ci/mM) by T4 polynucleotide kinase (Gibco / BRL). Each 100 µl reaction contained 30 ng of cDNA, 1 x PCR buffer, 0.5 mM dNTPs, 50 pmol of each primer, 2 µCi of 32P - labeled primer and 1 unit of Taq DNA polymerase (Perkin-Elmer, Norwalk, CT). The amplifications were carried out in Triometra PCR machine (Biometra, Tampa, FL).

Reactions were hot started with initial denaturation at 95°C for 5 min. followed by 30 programmed cycles at 95°C for 1 min., 50-55°C for 1 min. and 72°C for 1 min. with a final incubation at 72°C for 7 min. The authenticity of the amplified product was verified by electrophoresis on 1.5% agarose gels and by sequence determination. PCR amplified bands from agarose gels and identical-sized blank areas of gels (for background radioactivity) were cut out for Cerenkov counts and quantitation. All gel photographs were computer scanned, edited by `canvas' software program and laser printed.

Statistical Analysis

Data are reported as mean ± SEM. Student's t- test was used to compare groups and a P value of <0.05 was considered significant.

RESULTS

Using previously established protocols, in this study we examined the effects of Dox treatment on both dogs and rats in vivo as well as on rat cardiocytes in tissue culture.

ANF in Dox-treated Dogs

In all six dogs receiving Dox, cardiac function was evaluated by 2D - echocardiography weekly until the end of the experiments at week 16. In comparison to week 0, the hearts became markedly dilated at week 16 (LVDV from 59 ± 3.6 ml at week 0 to 76 ± 6.0 ml at week 16, p<0.01) and there was a progressive fall in ejection fraction (from 57 ± 4.5% at week 0 to 34 ± 2.5% at week 16, p<0.01), but there was no significant change in wall thickness.

Open myocardial biopsy samples obtained from the anterior left ventricular free wall at week 0 and samples collected at week 16 were used for histology, electron microscopy and quantitative RT-PCR analysis for ß-actin (control), PLB and ANF.

 

Light and Electron Microscopy : By histological examination, the general architecture of hearts in Dox-treated dogs was well preserved. The cardiocytes were slightly reduced in size but there were no gross necrotic changes and no inflammatory reaction. Sections 1 µm thick, stained by toluidine blue and examined by light microscopy, showed that the majority of cardiocytes in Dox-treated dogs had normal structure (Fig. 1A, B). There were well-defined myofibrils with a normal striation pattern and numerous interspersed globular mitochondria. Intercalated discs at the contact regions of the cardiocytes appeared well preserved. Interspersed with normal-appearing cardiac fibers were cardiocytes that showed clear pathological changes (Fig. 1C, D). Some cardiocytes showed dense bodies (presumably representing Z band material) and contraction clots (Fig. 1C), whereas others had marked diminution of myofibrillar material such that sarcoplasmic areas devoid of myofibrils and the nuclei therein became more prominent (Fig. 1D). There was also a loss of striation pattern in the surviving myofibrils (Fig. 1D).

Fig. 1. Phase contrast micrographs of 1.0 µm thick plastic sections stained with toluidine blue of adult dog cardiac muscle. As in control (A), most fibers of Dox-treated ventricles appeared normal (B) but in others there were pathological changes such as formation of dense bodies (C) and myofibrillar loss (D).

By electron microscopy pathological changes appeared only in scattered fibers. In some cardiocytes, there was marked swelling of sarcoplasmic reticulum (Fig. 2A) and prominent dense bodies were present (not shown). In others myofibrils with excessively shortened sarcomeres and mitochondria of reduced size were seen (Fig. 2B). The majority of fibers, however, retained normal fine structure.

Fig. 2. Ultrastructural changes in adult dog cardiac muscle cells treated with Dox. Sarcotubular swelling indicated by arrows (A) and heavily contracted fibrils with condensed mitochondria (B) are seen.

Immunofluorescence Staining: The immunofluorescence patterns with antibodies against myosin (MF-20) and against SERCA-2 were examined. It could be seen that the cardiocytes in general were thinner in Dox-treated samples compared to controls, but with respect to immunofluorescence, there was no clear difference (not shown). The overall histological, fine structural and immunofluorescent features indicated that the pathological changes were relatively mild and consistent with an apoptotic process.

Quantitative RT-PCR: Quantitative RT-PCR done on equal amounts of cDNA (30 ng) from representative control (biopsy samples taken at week 0, i.e., before Dox treatment) and Dox treated hearts (at week 16) are all illustrated in Figure 3. The values of ß-actin mRNA levels were very similar in control (9616 ± 880 cpm) and Dox-treated (9830 ± 527 cpm) hearts. There was also no significant (p>0.05) quantitative difference in the PLB message (17120 ± 1558 cpm in controls versus 17910 ± 1200 cpm in Dox-treated hearts). However, there was a 5-fold elevation in ANP mRNA in Dox-treated hearts (2136 ± 181 cpm in controls versus 11620 ± 1618 cpm in Dox-treated hearts).

Fig. 3. RT-PCR assay of equal amounts of cDNA (30ng) made from total RNA extracted from control and Dox-treated dog hearts. After 30 cycles of amplification aliquots were removed and analyzed on 1.5% agarose gel. Quantitation of mRNA was done by scintillation counts of incorporated radiolabeled primers into PCR product. M, 1kb marker; C1 - C2, control left ventricle; D1 - D6, Dox-treated left ventricle.

ANF in Dox-treated Rats in vivo

At the time of sacrifice the echocardiograms of all six Dox-treated rats showed distinct dilatation of cardiac chambers. The ejection fraction was also reduced but there was no change in wall thickness indicating that the rats had developed a dilated cardiomyopathy during the 4 - week period. All Dox-treated rats showed accumulation of ascitic fluid.

Immunocytochemistry : As in the dog hearts, the rat cardiac tissue examined at sacrifice showed well-preserved histology. The ventricular cardiocytes were minimally atrophic with some myofibrillar loss and disarray. Hypertrophic fibers (which represent compensatory growth) were not seen. Also, as in dog hearts, no striking differences between Dox and control rat hearts were seen by immunofluorescence staining with anti-myosin antibody. However, when treated with ANP antibody, immunohistochemistry showed increased staining in ventricles of Dox treated rats than in controls (Fig. 4). The increased ANP reactivity was found to be diffusely present in all ventricular cardiocytes and not limited to a subpopulation of cardiocytes (Fig. 4A -D). Non-myocyte cells of the heart gave no positive staining.

Northern Blots : RNA was examined under identical conditions as Dox-treated and control rat hearts by northern blot hydridization using ANP cDNA as probe (see Materials and Methods). There was a significant increase of ANP mRNA in the hearts of Dox-treated rats in comparison with the hearts of control rats (Fig. 5A). Normalizing the ANP values with respect to 18S band of RNA scanning densitometry gave the average ANP value from the hearts of the six control rats of 0.403 ± 0.067, whereas from Dox-treated rats it was 1.807 ± 0.044, indicating a 4.5-fold increase in ANP transcript after Dox treatment. This was in contrast to the level of cardiac a-actin mRNA, which showed a mild loss in Dox-treated animals.

ANF in Dox-treated Cardiac Cultures

Cardiac myocytes isolated from neonatal rat hearts grown on sterile cover slips were treated with 0.5 and 1.0 µM concentrations of Dox for 1-4 days. Parallel cultures were maintained as controls. On the first dayafter 0.5 or 1.0 µM of Dox treatment, there were no appreciable changes in the cultures. Both control and Dox-treated cultures showed sporadic beating. Relative decrease in beating rate of Dox-treated cultures in comparison with controls became noticeable on the second day and became very striking on the third day.

 

Immunocytochemistry : Control and Dox-treated cardiac cultures were examined by phase contrast and immunofluorescence with anti-myosin antibody for up to 3 days in culture. On the first day, the cardiocytes in both cultures showed well-preserved general morphology and striated myofibrils in the cytoplasm. On the second day Dox treated cultures had fewer myofibrils, and by the third day cardiocytes in Dox cultures were markedly atrophic and myofibrils could not be seen by phase-contrast or immunofluorescence. No hypertrophic cardiocytes were noted in any Dox-treated cultures. Similar results were previously described by Ito et al. (10) and Sussman et al. (24). With ANP antibody, control cultures consistently stained more strongly than Dox-treated cultures. Moreover, ANP staining was limited to cardiocytes; the fibroblasts remained negative in both control and Dox-treated cultures (Fig. 4E -H).

Northern Blots : Cardiac cultures for northern blots were treated with 0.5 µM and 1.0 µM Dox for one day only since at this time point phase microscopy and immunofluorescence showed minimal differences between treated and control cultures. The cardiac myocytes in these cultures were beating normally, as such non-specific and late degenerative changes that may affect mRNA analysis should be minimal. This was supported by the overall quality of RNA, judged by ethidium bromide staining and visualization of 28S and 18S RNA on formaldehyde-agarose gels, from control and Dox-treated cardiac cultures (Fig. 5B, bottom panel). However, in contrast to animal studies, a comparison of the northern blots of RNA from treated and control cultures showed a remarkable down-regulation of ANP transcripts in Dox-treated myocytes (Fig. 5B). From the four control cardiac cultures, the average ANP value was 0.920 ± 0.067, whereas after 0.5 mM Dox treatment it was 0.583 ± 0.09 and after 1.0 µM Dox was 0.566 ± 0.15, thus giving a significant decrease (p<0.01) of 37% and 39% respectively. The results from 1.0 µM Dox treatment exhibited more variability than from 0.5 µM Dox, but in each case the ANF message was decreased in comparison with controls. The level of GAPDH mRNA, used as control, remained unchanged.

 

Figure 5. Northern blot analysis of ANP mRNA. (A) RNA isolated from hearts of 2 control and 2 Dox-treated rats and (B) from representative control and 0.5 µM and 1µM Dox-treated cardiac cultures. The blots were hybridized with radiolabeled DNA probes specific for GAPDH, cardiac a-actin (CaA) and ANP. The bottom panels show 28 S and 18 S ribosomal RNA bands visualized by ethidium bromide staining to indicate the amount of RNA in each lane. The levels of GAPDH message corresponded to the amounts of RNA loaded in blots both from rat hearts (not shown) and cardiac cultures (Panel B).

 

DISCUSSION

Dox induces cardiomyopathy in several animal species e.g., dogs (9), rabbits (7), mice (26) and rats (19, 22). The mechanism by which Dox causes irreversible myocardial injury, however, is not clear. Generally oxygen free-radical mediated damage is implicated (21); approaches to prevent Dox injury have, therefore, centered on use of antioxidants to minimize generation of free radicals. Recently, it was shown that a Dox-related anthracycline, Daunorubicin, induced apoptosis (presumably mediated through free-radicals) in rat cardiac myocytes and the apoptosis was inhibited by the iron chelator dexrazoxane (19), which has also been found to markedly reduce the risk of Dox cardiomyopathy in patients (23). An alternative mechanism to explain cardioselective Dox toxicity proposed by Ito et al. (10) is that Dox selectively inhibits the cardiac specific program of gene expression. Using mRNA differential display technique, a cardiac-restricted transcriptional regulatory protein, CARP (cardiac adriamycin responsive protein) was recently identified (11), which is extremely sensitive to Dox and which appears to function as a regulator of cardiac-specific gene expression e.g., of cardiac troponin C and ANP.

As a follow up to our work on the role of cardiac specific genes in development of cardiomyopathies (8), this report has examined the effects of Dox on dog and rat hearts in vivo and on neonatal rat ventricular cell cultures. Our study does not support the concept (10, 11) that Dox causes selective inhibition of cardiac-specific genes. Northern blots from rat hearts showed that although there was some decrease in cardiac a-actin transcripts, the cardiac ANP transcripts were increased 4.5-fold in Dox treated hearts. Similarly quantitative RT-PCR analysis from dog hearts showed 5-fold elevation of ANP mRNA but no significant change in the PLB message. Recently, Arai et al (1) have also demonstrated in rabbit hearts that Dox did not uniformly inhibit cardiac specific genes, reducing expression of CaATPase, PLB and calsequestrin but up-regulating ANP.

In the adult animal ANP is actively expressed in cardiac atria, but there is little expression in ventricles. Increase in ANP expression by ventricular cells is a hallmark of cardiac hypertrophy induced by pressure overload in vivo (15) or by stretch, a-adrenergic agonists or angiotensin II in vitro and is correlated with reactivation of fetal skeletal a-actin and ß-myosin heavy chain (ß-MHC) genes (4, 17). Increase of ANP expression by ventricle is also considered as a molecular marker of heart failure both in patients (3) and in experimental animals (1), but the precise significance of this is not clear. In the diseased heart, cardiocyte injury is usually patchy, inducing hypertrophy and growth of less injured cardiocytes; increased ANP expression may thus represent the response of the hypertrophic cardiocytes. Also, since there is much heterogeneity of cell types in the heart (ventricle), induction of ANP synthesis in a non-muscle cell type of ventricle maybe involved.

In order to address these questions, we have carefully examined Dox-induced ANP expression in both dogs and rats. ANP levels were measured in dogs at a time when ß-actin and PLB mRNA levels (as determined by quantitative RT-PCR) and CaATPase (by immunofluorescent staining) appear to be similar to controls. Arai et al. (1) have found significant reduction in mRNA levels of sarcoplasmic reticulum proteins (CaATPase, PLB and calsequestrin) after chronic exposure to Dox at 20 mg/kg body weight (a dose clinically relevant to cumulative dose for patients under Dox therapy). In the dogs in our study, CaATPase and PLB were in normal range and this coupled with lack of prominent histopathology indicates that the induced cardiomyopathy was at an early stage and up-regulation of ANP was an early indicator of Dox cardiotoxicity.

The question of whether increased ventricular ANP expression was in cardiocytes undergoing compensatory hypertrophy or whether a non-muscle cell type was involved was examined in the rat heart. It was clear by immunocytochemistry that ANP up-regulation was not related to hypertrophic response (no hypertrophic cells were seen after Dox treatment) or due to induction of ANP expression in a non-myocyte cell type. The up-regulation of ANP in rat hearts after Dox treatment was thus a response of the general cardiac myocyte population itself.

Ours is the first study to examine the effects of Dox treatment on ANP transcripts both in vivo and in vitro, and we observed a dramatic difference between the two situations. In tissue culture, unlike in intact animals, Dox down-regulated ANP expression, which shows that responses in tissue culture may not always parallel those in the in vivo state. It should be pointed out, however, that we used cardiac cultures from 1-2 day old rats so that down-regulation of ANP by Dox in cultures may reflect a difference in response of cardiocytes from neonatal and adult rats. Indeed, using transgenes different 5' - flanking regions of the ANP gene were shown to be involved in transcriptional signaling in neonatal and adult ventricular myocardium (13).

Another potential explanation of the difference between the in vivo and in vitro response to Dox is the different time of exposure and concentration of the drug in the two situations. However, in both in vivo and in vitro experiments the rationale was to select conditions in which late degenerative changes, which may affect mRNA analysis, were minimal.

ANP expression is augmented in a wide variety of cardiovascular diseases, e.g., congestive heart failure, hypertension and acute myocardial infarction; complex molecular switches controlling its expression are probably involved. The differential effect of Dox in vivo and in vitro should be of value for understanding the molecular mechanisms regulating the expression of the important cardiac ANP gene in normal and diseased states.

REFERENCES

1. ARAI M, TOMARU K, TAKIZAWA T, SEKIGUCHI K, YOKOYAMA T, SUZUKI T, NAGAI R (1998) Sarcoplasmic reticulum genes are selectively down-regulated in cardiomyopathy produced by doxorubicin in rabbits. J Mol Cell Cardiol 30: 243-254         [ Links ]

2. BADER D, MASAKI T, FISCHMAN DA (1982) Immunochemical analysis of myosin heavy chain during avian myogenesis in vivo and in vitro. J Cell Biol 95: 763-70         [ Links ]

3. BAUCH M, ESTHER A, KIMURA B, VICTORIA BE, KEDAR A, PHILIPS I (1992) Atrial natriuretic peptide as a marker for doxorubicin-induced cardiotoxic effects. Cancer 69: 1492-1497         [ Links ]

4. CHIEN KR, ZHU H, KNOWLTON KU, MILLER-HANCE W, VAN-BILSEN M, OBRIAN TX, EVANS SM (1993) Transciptional regulation during cardiac growth and development. Ann Rev Physiol 55: 77-95         [ Links ]

5. DEBOLD AJ, BORENSTEIN HB, VERESS AT, SONNENBERG H (1981) A rapid and potent natriuretic response to intravenous injection of atrial myocardial extract in rats. Life Sci 28: 89-94         [ Links ]

6. DEVEREUX RB, ALONSO DR, LUTUS EM, GOTTLIEB GJ, CAMPA E, SACH I, REICHEK N (1986) Echocardiographic assessment of left ventricular hypertrophy: Comparison to necropsy findings. AMER J CARDIOL 57: 450-458         [ Links ]

7. DODD DA, ATKINSON JB, OLSON RD, BUCK S, CUSACK BJ, FLEISCHER S, BOUCEK RJ (1993) Doxorubicin cardiomyopathy is associated with a decrease in calcium release channel of the sacroplasmic reticulum in a chronic rabbit model. J Clin Invest 91: 1697-705         [ Links ]

8. GHATPANDE S, SHAFIQ S, SIDDIQUI MAQ (2001) Ventricular myosin light chain-2 gene expression in developing heart of chicken embryos. Biol Res 34:1-6         [ Links ]

9. HERMAN EH, FERRANS VJ, MYERS CE, VAN VLEET JF (1985) Comparison of effectiveness of ± - 1,2-Bis(3,5-dioxopiperazinyl-1-yl)propane (IRCF-187) and N-acetylcysteine in preventing chronic doxorubicin cardiotoxicity in beagles. Cancer Res 45: 276-281         [ Links ]

10. ITO H, MILLER SC, BILLINGHAM ME, AKIMOTO H, TORTI SV, WADE R, GAHLMANN R, LYONS G, KEDES L, TORTO FM (1990) Doxorubicin selectively inhibits muscle gene expression in cardiac muscle cells in vivo and in vitro. Proc Natl Acad Sci USA 87: 4275-79         [ Links ]

11. JEYASEELAN R, POIZAT C, BAKER RK, ABDISHOO S, ISTERABADI LB, LYONS GE, KEDES L (1997) A novel cardiac-restricted target for doxorubicin. J Biol Chem 272: 22800-22808         [ Links ]

12. KOLLS J, DEININGER P, COHEN JC, LARSON J (1993) cDNA equalization for reverse transcription-polymerase chain reaction quantitation. Anal Biochem 208: 264-69         [ Links ]

13. KNOWLTON KU, ROCKMAN HA, ITANI M, VOVAN A, SEIDMAN CE, CHIEN KR (1995) Divergent pathways mediate the induction of ANF transgenes in neonatal and hypertrophic ventricular myocardium. J Clin Invest 96: 11311-1318         [ Links ]

14. NOOTER K, BOERSMA AWM, OOSTRUM RG, BURGER H, JOCHENSEN AG, STOTER G (1995) Constitutive expression of c-H-ras oncogene inhibits doxorubicin-induced apoptosis and promotes cell survival in rhabdomyosarcoma cell line. Brit J Cancer 71: 556-561         [ Links ]

15. PARKER TG, SCHNEIDER MD (1991) Growth factors, proto-oncogenes, and plasticity of the cardiac phenotype. Ann Rev Physiol 53: 179-200         [ Links ]

16. PRAGA C, BERETTA G, VIGO PL (1979) Adriamycin cardiotoxicity: A survey of 1273 patients. Cancer Treat Rep 63: 827-8334         [ Links ]

17. SADOSHIMA J, IZUMO S (1997) The cellular and molecular response of cardiac myocytes to mechanical stress. Ann Rev Physiol 59: 551-571         [ Links ]

18. SAMBROOK J, FRITSCH EF, MANIATIS T (1989) Molecular Cloning. A laboratory manual. 2nd edition. New York Cold Spring Harbor. pp E18-E19         [ Links ]

19. SAWYER DB, FUKAZAWA R, ARSSTALL MA, KELLY RA (1999) Daunorubicin-induced apoptosis in rat cardiac myocytes is inhibited by dexrazoxane. Cir Res 84: 257-265         [ Links ]

20. SHAH HR, VANYNBLAT M, RAMDEV G, CUNNINGHAM JN, CHIAVERELLI M (1995) Experimental cardiomyopathy as a model of chronic heart failure. J Invest Surg 10: 387-96         [ Links ]

21. SINGAL PK, DEALLY CMR, WEINBERG LE (1987) Subcellular effects of adriamycin in the heart. A concise review. J Mol Cell Cardiol 19: 817-828         [ Links ]

22. SOLEM LE, HELLER LJ, WALLACE KB (1996) Dose-dependent increase in sensitivity to calcium-induced mitochondrial dysfunction and cardiomyocyte cell injury by doxorubicin. J Mol Cell Cardiol 28: 1032-1032         [ Links ]

23. SPEYER JL, GREEN MD, KRAMER E, RAY M, SANGER J, WARD C, DUBIN N, FERRANS V, STECY P, ZELENIUCH-JACQUOTTE A, WERNZ J, FEIT F, SLATER W, BLUM R, MUGGIA F (1988) Protective effect of bispiperazinedione ICRF-187 against doxorubicin-induced cardiac toxicity in women with advanced breast cancer. N Engl J Med 319: 745-752         [ Links ]

24. SUSSMAN MA, HAMM-ALVAREZ SF, VILALTA PM, WELCH S, KEDES L (1997) Involvement of phosphorylation in doxorubicin-mediated myofibril degeneration. Circ Res 80: 52-61         [ Links ]

25. TORAASON M, LUKEN M E, BREITENSTEIN M, KRUEGER JA, BIAGNIN RE (1989) Comparative toxicity of allylamine and acrolein in cultured myocytes and fibroblasts from neonatal rat heart. Toxicol 56: 107-118         [ Links ]

26. VAN ACKER SA, VOEST EE, BEEMS DB, MADHUIZEN HT, DE JONG J, BAST A, VAN DER VIJGH WJ (1993) Cardioprotective properties of O-(beta-hydroxyethyl)-rutosides in doxorubicin-pretreated BALB/c mice. Cancer Res 53: 4603-4607         [ Links ]

27. WU JP, DESCHEPPER CF, GARDNER DG (1988) Perinatal expression of the atrial natriuretic factor gene in rat cardiac tissue. AMER J PHYSIOL 255:E388-E396         [ Links ]

28. WYATT H, HENG MK, MEERBAUM S, HESTENES JD, COBO JM, DAVIDSON RM, CORDAY E (1979) Cross-sectional echocardiography. Analysis of mathematic models for quantifying mass of the left ventricle in dogs. Circulation 60: 1104-13         [ Links ]