SciELO - Scientific Electronic Library Online

 
vol.34 número1In situ hybridization of somatolactin transcripts in the pituitary glands from acclimatized carp (Cyprinus carpio)Genetic polymorphism in eight Chilean strains of the carotenogenic microalga Dunaliella salina Teodoresco (Chlorophyta) índice de autoresíndice de assuntospesquisa de artigos
Home Pagelista alfabética de periódicos  

Serviços Personalizados

artigo

Indicadores

Links relacionados

  • Não possue artigos similaresSimilares em SciELO

Bookmark

  • |

Biological Research

versão impressa ISSN 0716-9760

Biol. Res. v.34 n.1 Santiago  2001

doi: 10.4067/S0716-97602001000100011 

A segment and epithelium specific messenger ribonucleic
acid fragment up-regulated by estradiol in the rat oviduct

MARIANA RIOS, SUANY OJEDA, LUIS A VELASQUEZ1, KEVIN MAISEY1 AND
HORACIO B CROXATTO

Unidad de Reproducción y Desarrollo, Facultad de Ciencias Biológicas and MIFAB, Pontificia
Universidad Católica de Chile and 1Laboratorio de Inmunología de la Reproducción, Facultad de
Química y Biología, Universidad de Santiago de Chile, Santiago, Chile

ABSTRACT

Estradiol accelerates oviductal embryo transport in the rat through changes of genomic expression in oviductal cells. However, the genes involved are unknown. We used a differential display by reverse transcription-polymerase chain reaction to detect estradiol (E2)-dependent genes in the rat oviduct. Rats on day 2 of pregnancy were untreated or treated with 10 µg of E2 and the oviducts were extracted at 30, 180 and 360 min later and used to isolate RNA. Products of reverse transcriptase-PCR, made with pairs of arbitrary and oligo-deoxythymidine primers, were separated on denaturing polyacrylamide gels and candidate bands were excised and reamplified. Truly positive cDNA fragments determined by a single strand conformation polymorphism assay were cloned and sequenced. A ribonuclease protection assay confirmed that clone 25 is up-regulated by E2 in the oviduct at 30, 180 and 360 min. This clone exhibited no homology with known genes and in situ hybridization showed it is only expressed in the epithelial cells of the isthmic segment. Clone 25 is likely to represent a new gene, which is up-regulated by E2 in the epithelium of the isthmic segment of the rat oviduct. Its time frame of response is compatible with a mediator of the effect of E2 on oviductal embryo transport.

Key terms: differential display, estradiol, gene, mRNA, oviduct.

INTRODUCTION

The regulation of oviductal transport assures that embryos reach the uterus at the appropriate time for further development and to initiate either implantation or embryonic diapause. In the rat, the duration of oviductal egg transport is dependent on ovarian steroids and it is affected by exogenous estradiol (E2) and progesterone in a predictable and well-defined manner (Croxatto, 1996). In this species a single injection of E2 to mated rats during oviductal embryo transport accelerates their passage into the uterus with a latency period of 9-11 h (Ortiz et al, 1979). When non-mated rats are treated with E2 during oocyte transport, the same effect is observed, although it is through a non-genomic action of the hormone (Orihuela et al, 2000). In contrast, the effect of E2 on embryo transport in mated rats can be blocked by intraoviductal administration of inhibitors of RNA and protein synthesis, and there is indirect evidence that one or more RNA species induced by E2 in the oviduct mediate this effect (Rios et al, 1997). Furthermore, several oviductal proteins are up-regulated by exogenous E2, with a time course compatible with being causally related to the accelerated embryo transport that follows this treatment (Orihuela & Croxatto, 1998). Altogether, these observations led us to conclude that the effect of E2 on embryo transport in mated rats is mediated by changes in oviductal genomic expression. The way mating changes the mode of action of E2 on the oviduct may also involve genomic effects (Müller & Croxatto, 2000).

The evolving model of E2 action in normal tissue requires the binding of the hormone to its receptor. This steroid-receptor complex interacts with E2 response elements that function as DNA enhancer and repressor elements to control transcription of specific genes and gene networks (Mangelsdorf et al, 1995, Spelsberg et al, 1989). The genes involved in this particular case and the ensuing molecular mechanisms involved in oviductal cells in the nine hours that elapse from the estrogenic signal to the onset of the mechanical event are largely unknown. Much understanding of the physiology of the oviduct could be gained through the identification of estradiol-responsive genes involved in the acceleration of egg transport through the rat oviduct. Here we report our initial effort in this direction. Since relatively few genes have been identified that are directly regulated by estradiol (Everett et al, 1997, Koike et al, 1996, Zhang et al, 1994), the differential display technique described by Liang and Pardee (1992) was utilized.

MATERIALS AND METHODS

Animals

Sprague-Dawley female rats weighing 200-260 g were used. Animals were kept under controlled temperature (21-24ºC) and lights were on from 0700 to 2100 h. Water and pelleted food were supplied ad libitum. Vaginal smears were taken daily, and each female found to be in proestrus was caged overnight with fertile males. The presence of spermatozoa in the vaginal smear the next morning was taken as evidence that insemination had occurred, and this was designated day 1 of pregnancy.

Treatment and RNA isolation

Estradiol-17ß 10 µg dissolved in 0.2 mL propylene glycol was injected s.c. the morning of day 2 of pregnancy. Rats were killed at 30, 180 or 360 min (10-15 rats per

time) after treatment. Untreated rats served as time 0 controls. Oviducts were dissected out and used to prepare RNA. The embryos were flushed out of each oviduct to avoid contamination with embryonic RNA during isolation of oviductal RNA. Total RNA was purified from organ pools, using the single-step method described by Chomczynski and Sacchi (1987). Afterward, RNA was digested with 1 unit/µg RNA of RNase-free DNase for 20 min at 37ºC to remove any trace of DNA contaminant. After phenol/chloroform extraction and ethanol precipitation, RNA was suspended in DEPC-treated water.

Differential Display RT-PCR (DDRT-PCR)

The DDRT-PCR used in this study is derived from that described by Liang and Pardee (1992) using the kit supplied by Display Systems Biotech (Vista, California). cDNA was synthesised from total oviductal RNA using 0.3 µg total RNA from each group in 50 mM Tris-HCl (pH 8.3), 3 mM MgCl2, 75 mM KCl, 10 mM DDT, 20 µM of deoxyribonucleoside triphosphates (dNTPs), 2.5 µM of each of three different primers (T11GG, T11GC, T11AG) and 9 units of RNasin. The reaction mixtures were incubated at 70ºC for 10 min, cooled, and the reverse transcription was initiated by the addition of 50 units of Reverse Transcriptase M-MuLV and incubation at 42ºC for 1 h. Following this period, the mixtures were incubated at 95ºC for 5 min.

The cDNA resulting from these reactions was then amplified and labelled in 10 mM Tris-HCl (pH 8.3), 50 mM KCl, 1.5 mM MgCl2, 0.1% Triton-X-100, 0.005% Gelatin, 1.2 µCi [a-33P]-dATP (Amersham Life Science, Cleveland, Ohio, USA), 4 µM of the dNTPs, 1 unit of display TAQ DNA Polymerase, 2.5 µM of the primers described above as the 3' primers and 0.5 µM of 12 different 5' primers with arbitrary sequences. The amplification protocol consisted of 30 s denaturation at 94ºC, followed by 90 s annealing at 40ºC and 30 s extension at 72ºC. After 40 cycles, the final product was extended for 5 min at 72ºC. Samples from each amplification reaction were loaded onto a 6% polyacrylamide-urea DNA sequencing gel and run at 100 watts for 2.5 or 16 h. The gel was dried, and an autoradiograph was made to locate bands that appeared to be differentially expressed in the E2-treated versus control lanes. Each PCR amplification reaction was performed three times, and only those bands that were consistently different were considered relevant.

cDNA reamplification, cloning and sequencing

Bands of interest were excised from the gel and the cDNA was eluted in water after heating at 95ºC for 5 min. Individual cDNA fragments were reamplified, using aliquots of the eluted gel slices as template, using the same primers and amplification parameters as above, except for the annealing temperature, which was 42ºC instead of 40ºC. Amplified products were purified using the kit Wizard PCR Preps (Promega, Madison, WI, USA) and were cloned using pGEM-T vector (Promega, Madison, WI, USA). Clones were isolated and sequenced with the Thermo Sequenase radiolabeled terminator cycle sequencing kit from Amersham Life Science (Cleveland, Ohio, USA) according to the manufacturer's recommendations. Sequence homology analysis against Gene Bank entries was then performed.

Single Strand Conformation Polymorphism (SSCP)

For identification of true positive cDNA fragments we screened the amplified cDNA fragments using SSCP gels (Orita et al, 1989). Individual cDNA fragments were reamplified using the same protocol described above but adding a trace of [a-33P]-dATP in the reamplification mix. Reamplification was performed for the gel region carrying the differentially expressed product and a corresponding region from an adjacent lane where the product was less prominent or not visible. PCR products were mixed with formamide dye solution, heated to 94ºC for 2 min and loaded into a 6% non-denaturing polyacrylamide gel using 0.5 x TBE buffer. After electrophoresis at 6 Watts the gels were dried and exposed to x-ray films.

Ribonuclease Protection Assay (RPA)

The expression level of clone 25 was examined using RPA (Zinn et al, 1983). Clone 25 was linearized with Nco I and used to synthesise a-32 P-labeled antisense RPA probe by SP6 RNA polymerase (Promega, Madison, WI, USA). For each assay, a total of 20 µg of RNA extract was dried in a 1.5 mL Eppendorf microcentrifuge tube and was then resuspended in 30 µL of hybridization buffer (50 mM PIPES, pH 6.4, 0.5 M NaCl, 1.25 mM EDTA in Formamide) containing clone 25 and p1B15 RPA probe (500.000 cpm for clone 25 and 15.000 cpm for p1B15). This solution was denatured at 85ºC for 5 min and was incubated overnight at 45ºC. After hybridization, 350 µL of 10 mM Tris HCl, pH 7.5, 300 mM NaCl, 5 mM EDTA containing 30 units RNase One (Promega, Madison, WI, USA), was added to each tube and the samples were incubated at 37ºC for 1 h. The ribonuclease digestion was terminated with 10 µL of 20% SDS and 6 µL of Proteinase k solution (10 mg/ml). One µL of tRNA (10 mg/mL), 70 µL 7.5 M ammonium acetate and 1 mL of 100% ethanol was added to aid in the precipation of RNA. After hybridization and RNase digestion, the protected hybrids were separated on a 6% polyacrilamide denaturing gel. The protected clone 25 mRNA fragment in the RPA was 364 bp long. The dried gel was then exposed to autoradiographic film and scanned with a Bio-Rad model GS-700 imaging densitometer. The optical density of the hybridization signals was quantified using the NIH Image 1.61 software. Values were normalized against p1B15.

Cyclophilin mRNA (Danielson et al, 1988) was measured using a 212 bp32P RPA probe that was transcribed from a rat p1B15 cyclophilin cDNA cloned into pGEM-T vector. The protected cyclophilin mRNA fragment in the RPA was 158 bp long.

In situ hybridization

The site of expression of clone 25 was further investigated by in situ hybridization (Gall and Pardue, 1971). Oviducts were obtained from control and E2-treated rats killed 30 min after treatment and were fixed in 4% paraformaldehyde in PBS buffer. This was followed by overnight incubation with PBS containing 30% sucrose. Oviducts were then frozen on dry ice and stored at -80ºC until sectioning. A cryostat was used to prepare sections 15 µm in thickness that were laid onto polylisine-coated slides and dried overnight under vacuum before hybridization. An oligonucleotide probe corresponding to the primer antisense of the clone was labeled by tailing with the DIG Oligonucleotide Tailing Kit (Roche, Germany).

Sections were overlaid with 30 µL hybridization buffer, consisting of 2X SSC, 1X Denhardt's, 10% dextran sulfate, 50 mM phosphate buffer, 50 mM DTT, 250 µg/mL yeast t-RNA, 5 µg/mL Poly (dA), 100 µg/mL Poly A, 500 µg/mL denatured and sheared salmon sperm DNA, 14% formamide and 30 ng digoxigenin-labeled oligonucleotide probe. The hybridization was carried out overnight at 37ºC in a humid chamber and was followed by several washings to a final stringency of 0,25X SSC. After washing, sections were covered with blocking buffer containing a 1:1000 dilution of sheep anti-DIG alkaline phosphatase. After washing, the slides were incubated with a colouring solution containing 45 µL NBT, 35 µL BCIP and 5 mM levamisole at room temperature in darkness. When color development was optimal, the reaction was stopped with buffer Tris-EDTA and sections were mounted using an aqueous mounting solution.

RESULTS AND DISCUSSION

Differential display PCR involving 36 different combinations of oligonucleotide primers was used as outlined above to analyze RNA samples. A portion of a representative gel from one such experiment utilizing oviductal RNA is shown in Figure 1. Each lane contained approximately 70 to 120 bands. Numerous changes are evident when different samples treated with a given primer set are compared. In order to examine genes regulated by E2, we selected bands that seemed to exhibit decreased or increased expression in response to E2.


Figure 1: Differential display PCR of mRNAs expressed in the oviduct of control rats (C) and of rats treated with 10 µg of E2 whose oviducts were extracted at 30, 180 and 360 min after treatment. Similar quantities of labeled cDNA were loaded in each lane of a 6% denaturing polyacrylamide gel. Following electrophoresis, the gel was dried and autoradiographed. The arrowhead indicates the position of clone 25

The bands of interest were cut from the gel, eluted, reamplified, cloned and sequenced. A total of 32 possible candidates were eluted and 21 of these could be amplified. For identification of true positive cDNA fragments, we screened the amplified cDNA fragments using SSCP gels. Following this analysis, 7 of the 21 fragments were eliminated because they were false positives. Finally, partial cDNA of 6 of the remaining 14 fragments was cloned. One of the largest fragments has been further investigated and is reported here in view of the specificity of its cell-type expression.

As the differential display PCR experiments employed degenerate primers and low stringency conditions, the apparent changes in the expression of the specific mRNAs under study required further confirmation. For this reason, the expression level was examined using RPA. This assay revealed that clone 25 was up-regulated by E2 at 30 (3-fold), 180 (2.5-fold) and 360 min (2-fold) after treatment (Fig. 2). The size and nucleotide sequence of clone 25 is presented in Table 1. Sequence analysis revealed that as of June 2000, this clone yielded no meaningful sequence homologies with Gene Bank entries.


Figure 2: Ribonuclease protection assay of oviductal mRNA for clone 25 and p1B15. Lane 1 (M): 100 bp DNA ladder. Lane 2: (-) incubated undigested probe. Lane 3: (+) incubated ribonuclease-digested probe. Lane 4: (C) control rats. Lanes 5-7: rats treated with 10 µg of E2 for 30, 180 or 360 min. The relative band intensities were estimated by densitometric analysis of autoradiographic film and were normalized to the p1B15 signal.

TABLE I

The nucleotide sequence of clone 25 derived from differential display PCR

CCAAGGAGATGCAAAAGCCAGGCACCAAGGGTTACCTTGGAGTGTCTAACCCTC ATGCTTGTTTTACTGTAGTGCTGGCCCTGAACAACACACAAGGCAAGTATTCTA CCACTGAACTACATCCCAACCTCTCTTCTACGTTTTGAATTTTGTTACATATTCA
CACGCGACTTATTTAAATTTACTATAATTTAAAAATAATTTCAAGTAGTAGAAA
AGCTGGCTCTCACTCAGGCTAATCAATCATTATCATTTGCCATATTTAAAGTATC
AATCATCTCTCTGTGTATCTCACACTCATATACATTATATGTCATATATTACACC
TGGATACTTAGTGCTAAATAGTTCAAGGGTGGGGGAG (364pb)

The site of expression of clone 25 within the oviduct was further investigated by in situ hybridization. A positive hybridization signal was only seen in tissue sections hybridized with the antisense cDNA probe and was only expressed in the epithelium of the isthmic segment of the oviduct treated with E2 (Fig. 3).. Hybridization with the sense of clone 25 cDNA was negative. It has been shown that E2 accelerates oviductal embryo transport increasing the frequency of contractions of the smooth muscle of the ithmus (Moore & Croxatto 1988). The localization of clone 25 in the isthmus makes it a candidate molecule involved in this effect of E2. However, the fact that it is expressed in the endosalpinx instead of in the myosalpinx makes us speculate that, if involved, it would be as part of a signaling process from endosalpinx to myosalpinx.


Figure 3: Localization of mRNA of clone 25 in the rat oviduct by in situ hybridization. The hybridization was performed employing dioxigenin-labeled antisense oligonucleotide probes specific for clone 25 as described in Materials and Methods. A and I indicate the ampullary and isthmic segments of the oviduct, respectively. L indicates the lumen. Note positive staining of the epithelium of the isthmic segment and absence of staining in the adjacent ampullary segment.

The DDRT-PCR method applied here makes use of anchored poly-dT primers combined with arbitrary primers in the DDRT-PCR reaction. Although annealing of the primers can occur in any region of the mRNAs complementary to the primer sequence, the use of an anchor oligo-primer favours the amplification of the 3'end of the message. This represents a drawback for the identification of the sequences isolated, because these regions are the least conserved. This may explain why no significant homology with known genes was found. The complete characterization of the corresponding coding sequence will be necessary to allow its identification and experiments involving local administration of antisense probes may help reveal its function.

In conclusion, clone 25 is likely to correspond to a new gene that is up-regulated by E2 with segment and tissue layer specificity in the pregnant rat oviduct.

ACKNOWLEDGMENTS

This work received financial support from grants from the Rockefeller Foundation (RF 94025#15), FONDECYT # 8980008, Catedra Presidencial H Croxatto, PLACIRH PLI237/96, and the Ernst Schering Research Foundation. The Millennium Institute for Fundamental and Applied Biology (MIFAB) is financed in part by the Ministerio de Planificación y Cooperación (Chile). The authors thank M.Sc. Pedro A. Orihuela for his valuable suggestions in the preparation of the manuscript.

Correspondence to: H.B. Croxatto. Unidad de Reproducción y Desarrollo,Facultad de Ciencias Biológicas,Pontificia Universidad Católica de Chile, Casilla 114-D.Santiago, Chile.Fax: (56-2) 222-5515, e-mail: hbcroxat@genes.bio.puc.cl

Received: October 17, 2000. In revised form January 17, 2001. Accepted: January 19, 2001

REFERENCES

CROXATTO HB (1996) Gamete Transport. In: ELY ADASHI, JA ROCK, Z ROSENWAKS (Eds) Reproductive Endocrinology. Surgery and Technology, Philadelphia: Lippincott-Raven Publishers. pp 386-402         [ Links ]

CHOMCZYNSKI P, SACCHI N (1987) A single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Anal Biochem 72: 248-254         [ Links ]

DANIELSON PE, FORSS-PETTER S, BROW MA, CALAVETTA L, DOUGLASS J, MILNER RJ, SUTCLIFFE JG (1988) p1B15: a cDNA clone of the rat mRNA encoding cyclophilin. DNA 7: 261-267         [ Links ]

EVERETT LM, LI A, DEVARAJU G, CAPERELL-GRANT A, BIGSBY RM (1997) A novel estrogen-enhanced transcript identified in the rat uterus by differential display. Endocrinology 138: 3836-3841         [ Links ]

GALL JG, PARDUE ML (1971) Nucleic acid hybridization in cytological preparations. Meth Enzymol 38: 470-480         [ Links ]

KOIKE H, KARAS RH, BAUR WE, ODONNELL TF, MENDELSOHN ME (1996) Differential-display polymerase chain reaction identifies nucleophosmin as an estrogen-regulated gene in human vascular smooth muscle cells. J Vasc Surg 23: 477-482         [ Links ]

LIANG P, PARDEE AB (1992) Differential display of eukaryotic messenger RNA by means of the polymerase chain reaction Science 257: 967-971         [ Links ]

MANGELSDORF DJ, THUMMEL C, BEATO M, HERRLICH P, SCHUTZ G, UMESONO K, BLUMBERG B, KASTNER P, MARK M, CHAMBON P, EVANS RM (1995) The nuclear receptor superfamily: the second decade. Cell 83: 835-839         [ Links ]

MOORE GD, CROXATTO HB (1988) Effects of delayed transfer and treatment with oestrogen on the transport of microspheres by the rat oviduct. J Reprod Fertil 83: 795-802         [ Links ]

MÜLLER A, CROXATTO HB (2000) Effect of mating on the expression of calbindin-D 9k, GM-CSF, cox-2 and matrilisin mRNA in the rat uterus. Biol Res 33: R83         [ Links ]

ORIHUELA PA, CROXATTO HB (1998) Estradiol and progesterone change the protein synthesis pattern in the oviduct of pregnant but not cyclic rats. Biol Reprod 56 (suppl 1): 88 (abstract 55)         [ Links ]

ORIHUELA PA, PARADA A, CROXATTO (2000) Estradiol-induced ovum transport acceleration requires activation of protein kinase A in the rat oviduct. Biol Res 33: R45         [ Links ]

ORITA M, IWAHANA H, KANAZAWA H, HAYASHI K, SEKIYA T (1989) Detection of polymorphisms of human DNA by gel electrophoresis as single-strand conformation polymorphisms Proc Natl Acad Sci USA 86: 2766-2770         [ Links ]

ORTIZ ME, VILLALÓN M, CROXATTO HB (1979) Ovum transport and fertility following postovulatory treatment with estradiol in rats Biol Reprod 21: 1163-1167         [ Links ]

RÍOS M, ORIHUELA PA, CROXATTO HB (1997) Intraoviductal administration of ribonucleic acid from estrogen-treated rats mimics the effect of estrogen on ovum transport Biol Reprod 56: 279-283         [ Links ]

SPELSBERG TC, RORIES C, REJMAN JJ, GOLDBERGER A, FINK K, LAU CK, COLVARD DS, WISEMAN G (1989) Steroid action on gene expression: possible roles of regulatory genes and nuclear acceptor sites Biol Reprod 40: 54-69         [ Links ]

ZHANG Z, FUNK C, ROY D, GLASSER S, MULHOLLAND J (1994) Heparin-binding epidermal growth factor-like growth factor is differentially regulated by progesterone and estradiol in rat uterine epithelial and stromal cells. Endocrinology 134: 1089-1094         [ Links ]

ZINN K, DIMAIO D, MANIATIC T (1983) Identification of two distinct regulatory regions adjacent to the human b-interferon gene. Cell 34: 865-879         [ Links ]