SciELO - Scientific Electronic Library Online

 
vol.134 número7Prevalencia de anticuerpos contra Bartonella henselae en niños, en adolescentes y en una población de riesgo ocupacional en ChileEficacia del infliximab en pacientes con síndrome de Behçet portadores de úveo-retinitis grave índice de autoresíndice de materiabúsqueda de artículos
Home Pagelista alfabética de revistas  

Revista médica de Chile

versión impresa ISSN 0034-9887

Rev. méd. Chile v.134 n.7 Santiago jul. 2006

http://dx.doi.org/10.4067/S0034-98872006000700010 

 

Rev Méd Chile 2006; 134: 868-873

ARTÍCULO DE INVESTIGACIÓN

 

Identificación rápida de micobacterias no tuberculosas mediante análisis de patrones de restricción

Rapid identification of non tuberculous mycobacteria by restriction pattern analysis

 

Pamela Araya R1a, Maritza Velasco R2b, Jorge Fernández O1c.

1Unidad de Desarrollo y 2Sección Micobacterias, Instituto de Salud Pública de Chile. Santiago de Chile.
aBioquímico
bTecnólogo Médico
cPhD y Licenciado en biología

Dirección para correspondencia


Background: The frequency of diseases caused by non tuberculous mycobacteria has increased in the last years. Their clinical diagnosis is difficult, mainly in immunocompromised patients. The identification of these mycobacteria by traditional methods is based on phenotypic characteristics and the results are obtained two to four weeks after their isolation in primary cultures. Aim: To report a new identification method for non tuberculous mycobacteria. Material and methods: The restriction pattern analysis method was implemented. It is based on the amplification, using polymerase chain reaction (PCR), of a polymorphic region of 440 base pairs that codifies Hsp65 protein, followed by a digestion with BstE II and Hae III restriction enzymes. The results were compared with patterns established for each strain. Results: Sixty four strains of mycobacteria obtained from clinical samples and seven reference mycobacteria, were identified using the traditional methods and restriction pattern analysis. The latter method identified the same strain as the former in 87.5% of cases. In the remainder 12.5% of cases there was no agreement between both methods. In these, the sequencing of a fragment of a gene that codifies 16S ribosomal RNA, confirmed the correct identification by restriction patterns. Conclusions: Restriction pattern analysis is a rapid identification method for non tuberculous mycobaterial strains.

(Key words: Mycobacteria, atypical; Restriction enzyme analysis; RNA, ribosomal)


Las enfermedades producidas por micobacterias no tuberculosas, han tenido un importante incremento en los últimos años, debido particularmente a su asociación con el síndrome de inmunodeficiencia adquirida (SIDA) y con terapias immunosupresoras en pacientes trasplantados1-4. El aumento de los aislamientos de micobacterias no tuberculosas, también ha sido observado en nuestro país. Es así como el Laboratorio Nacional y de Referencia del Instituto de Salud Pública de Chile diagnosticó 15,8% de micobacterias no tuberculosas en 2002, 25,6% durante 2003, para alcanzar, durante el año 2004, 35% del total de cepas de micobacterias recibidas.

La identificación clásica de micobacteria, basada en morfología, cultivos y pruebas bioquímicas, puede demorar varias semanas después de la recepción de las muestras y, en algunos casos, no se logra identificar correctamente los microorganismos con los protocolos disponibles5. Métodos alternativos como cromatografía en capa fina, cromatografía gas-líquido, cromatografía líquida de alta resolución y secuenciamiento del gen 16S ARN, han sido utilizados en la identificación de las micobacterias. Sin embargo, su uso está limitado a los laboratorios de referencia, ya que requieren equipos muy sofisticados6,7. También se han desarrollado sistemas comerciales de identificación como AccuProbe (GenProbe, USA), INNO-LipA micobacterias (Innogenetics, Bélgica) y Genotype Mycobacterias (Hain Lifescience, Alemania), que tienen un alto costo para los países de pocos recursos económicos7.

Un método rápido, que reduce el tiempo para la identificación de micobacterias no tuberculosas, fue desarrollado por Telenti8. Este método molecular se basa en la amplificación mediante la reacción en cadena de la polimerasa (PCR) de un fragmento polimórfico de 440 pb que codifica para la proteína del shock térmico Hsp65. El producto amplificado es digerido con las enzimas de restricción BstE II y Hae III y la interpretación de los patrones de restricción se realizan por la simple observación de los patrones y por algoritmos disponibles en la página de Internet (app.chuv.ch/prasite)9,10.

En este estudio se analizaron aislados primarios y cepas de referencia de micobacterias, para determinar si la identificación a nivel de especies de micobacterias no tuberculosas con los métodos tradicionales son concordantes con el análisis de los patrones de restricción (APR). Para confirmar la identificación de las muestras discordantes, se secuenció un fragmento del gen 16S ARN.

MATERIALES Y MÉTODOS

Cepas. Se analizaron 64 aislados primarios que fueron enviados desde los Laboratorios de Bacteriología de la Tuberculosis del país, al Laboratorio Nacional y de Referencia de Micobacterias del Instituto de Salud Pública de Chile entre los años 2002 y 2004. Se incluyeron, 7 cepas de referencia ATCC y CIPT (American Type Culture Collection USA y Collection Institute Pasteur Tuberculosis) como controles. Los aislados primarios fueron identificados a especies por métodos tradicionales11.

Extracción de ADN genómico. Se centrifugó una alícuota de 500 µl del cultivo de micobacteria a 9,500 g por 15 min, suspendiéndose el pellet resultante en tampón de lisis (Tris-HCl 10 mM pH 7,5, EDTA 1,0 mM y 1% Tritón X-100). Las células fueron inactivadas por calentamiento a 80°C por 10 min y mediante tres ciclos de ebullición-congelación por 10 min cada uno.

Amplificación del ADN mediante reacción en cadena de la polimerasa (PCR). Se amplificó un segmento de 440 pb del gen hsp 6512. La reacción de PCR fue efectuada en un volumen final de 50 µl consistente en 1,5 mM de MgCl2, 20 mM Tris, pH 8,4, 50 mM KCl, 10% glicerol, 2 pmoles de los partidores TB11 (5'ACCAACGATGGTGTGTCCAT3') y TB12 (5'CTTGTCGAACCGCATACCCT3'), 200 µM dNTP, 1U de Taq polimerasa y 5 µl de lisado celular como templado. El proceso de amplificación del ADN consistió en una etapa de denaturación inicial de 95°C por 5 min, seguida por 35 ciclos de amplificación que incluyeron 1 min de denaturación a 94°C, 1 min de hibridación a 60°C y 1 min de extensión a 72°C, para terminar con una etapa de extensión final de 5 min a 72°C. Los productos de la PCR fueron analizados por electroforesis en geles de agarosa al 2% y visualizados en transiluminador de luz UV.

Análisis de fragmentos de restricción. Los productos de la amplificación fueron digeridos separadamente con las enzimas de restricción BstE II y Hae III. Con posterioridad, los productos de la digestión fueron separados en geles de agarosa 4%, teñidos con bromuro de etidio (4 µg/ml) y visualizados en transiluminador UV. Los patrones de restricción obtenidos, fueron analizados en el programa computacional Quantity One de BIORAD e interpretados por patrones disponibles en el banco de datos. app.chuv.ch/prasite11,12.

Análisis de secuencia ARN ribosomal 16S. Un fragmento de 350 pb del gen que codifica para el 16S ARN fue amplificado de acuerdo a los procedimientos descritos en la literatura13. El secuenciamiento de los amplicones fue realizado en un secuenciador automático ABI PRISM 310 Applied BiosystemMR, de acuerdo a las instrucciones del fabricante. La secuencia nucleotídica generada fue comparada con las descritas en la base de datos de GenBank, utilizando la herramienta BLAST disponible en el National Center for Biotechnology (http://www.ncbi.nlm.nih.gov).

RESULTADOS

Un fragmento de 440 pb del gen que codificaba para la proteína Hsp65 fue amplificado en todas las cepas estudiadas. Los fragmentos generados por la digestión con las enzimas Hae III y BstE II tuvieron un tamaño entre 50 a 440 pb (Figura 1). Los patrones de digestión obtenidos fueron comparados con las Tablas publicadas en el sitio de Internet http://www.app.chuv.ch/prasite.

Figura 1. Patrones de restricción de cepas de micobacterias en gel de agarosa al 4%, teñido con bromuro de etidio. Líneas 1, 3, 5, 7, 9, 11, 13, 15, 17 digestión con la enzima BstE II. Líneas 2, 4, 6, 8, 10, 12, 14, 16, 18 digestión con la enzima Hae III. Líneas 1 y 2 M triviale tipo 1, líneas 3 y 4 M fortuitum tipo 1, líneas 5 y 6 M terrae tipo 1, líneas 7 y 8 M chitae tipo 1 líneas 9 y 10 M chelonae, líneas 11 y 12 M kansasii tipo 1, líneas 13 y 14 M abscessus tipo 1, líneas 15 y 16 M kansasii tipo 1, líneas 17 y 18 M peregrinum tipo 1. Líneas M estándar de peso molecular 100 pb y 50 pb ADN ladder.  

En la Tabla 1, se muestran los resultados de la comparación de los métodos APR con los métodos tradicionales para la identificación de las cepas clínicas y cepas de referencia de Mycobacterium spp. El análisis de las cepas ATCC y CIPT mediante las pruebas clásicas, permitió la identificación de 5 de las 7 cepas de referencia. Las micobacterias M triviale y M chitae fueron identificadas en ambos casos como M fortuitum por las pruebas tradicionales, en cambio, todas las cepas de referencia fueron identificadas correctamente por APR.


En 56 (87,5%) de las cepas obtenidas desde muestras clínicas, se identificó la misma especie con ambos métodos (Tabla 2). La identificación mediante APR, permitió identificar en 12 especies los subtipos. M intracellulare fue identificado en 8 muestras, correspondiendo seis al subtipo 1, una al subtipo 2 y una al subtipo 4. Siete diferentes variantes de M avium fueron observadas mediante APR, correspondiendo 6 de ellas al subtipo 2 y una al subtipo 1. La especie M fortuitum fue identificada en 9 de las cepas, de las cuales 7 correspondieron al subtipo 1 y 2 al subtipo 2. Nueve de las cepas estudiadas fueron identificadas como M gordonae, correspondiendo 6 de ellas al subtipo 4, 2 al subtipo 1 y una al subtipo 8. Los subtipos 1 y 2 fueron identificados en M abscessus. Las micobacterias M kansasii, M chelonae, M marinum, M smegmatis, M peregrinum, M triviale, M scrofulaceum correspondieron al subtipo 1.


En 8 (12,5%) de las muestras clínicas no hubo concordancia entre los resultados obtenidos por las pruebas clásicas y el análisis de los patrones de restricción (Tabla 3). Para resolver esta discrepancia entre ambos métodos, se secuenció en las 8 cepas una región específica del gen 16S ARN, confirmándose la identificación obtenida mediante APR en las 8 cepas.


Las especies clínicas M terrae, M simiae y M noncromagenicum, sólo pudieron ser identificadas mediante APR y no por las pruebas tradicionales de identificación.

DISCUSIÓN

La identificación de especies en micobacterias no tuberculosas es una etapa crítica en el manejo de los pacientes infectados, ya que el resultado obtenido es importante para descartar o confirmar una patología concordante con micobacteriosis14-16. La identificación correcta de las micobacterias no tuberculosas, sumado al estudio de susceptibilidad, permite la elección de un esquema terapéutico adecuado, si se trata de una especie potencialmente patógena, aislada en forma repetida y en cantidad abundante.

Es por tanto, importante el desarrollo de métodos que proporcionen resultados rápidos y confiables, que puedan ser utilizados en los Laboratorios de Referencia de Micobacterias17.

En este trabajo se comparó la identificación de especies de micobacterias por métodos tradicionales y mediante el análisis de los patrones de restricción. En todas las cepas de micobacterias no tuberculosas analizadas, se amplificó un fragmento de 440 pb del gen que codifica para la proteína de shock térmico Hsp65. El análisis con ambos métodos de las 7 cepas de colección de micobacterias, demostró que las pruebas tradicionales identificaron erróneamente, las cepas de M triviale y M chitae, sin embargo, el método APR las identificó correctamente.

En 87,5% de las muestras clínicas hubo correlación en la identificación por ambos métodos. Sin embargo, una de las características más importante de la tipificación mediante APR, es que permitió identificar especies como M terrae, M chitae y M noncromagenicum, que no fueron identificadas correctamente por los métodos tradicionales. Este nuevo método, además, permitió diferenciar los complejos avium-intracelular y fortuitum-chelonae y clasificar las especies en subtipos. La subdivisión de las especies de micobacterias podría ser una herramienta epidemiológica importante para diferenciar aquellas especies que sean más patogénicas.

En 12,5% de las muestras no hubo una correlación entre los resultados obtenidos por ambos métodos. La identificación mediante el análisis genético del ARN ribosomal 16S de estas muestras, confirmó, los resultados obtenidos con el método APR.

La identificación mediante APR, también ha sido útil en la identificación del complejo tuberculosis, especialmente en muestras donde la identificación morfológica de la tuberculosis no es concluyente.

La principal desventaja en el uso en forma rutinaria de APR, se debe a diferencias en la interpretación de los patrones obtenidos en distintos laboratorios17. Esto se debe principalmente al tipo de agarosa utilizada y a diferencias en el tiempo de la electroforesis10,17. Por lo tanto, es fundamental que los laboratorios utilicen los mismos reactivos y las mismas condiciones de electroforesis. A su vez es importante el uso de programas bio-informáticos para corregir las diferencias en las condiciones de corrida, para facilitar la interpretación de los patrones de ADN obtenidos17.

El análisis de los patrones de restricción es un método alternativo, simple y económico, para una rápida identificación y podría ser implementado en forma rutinaria en los Laboratorios de Referencia de Micobacterias. El tiempo para completar la identificación mediante APR es de 48 h, mientras que en la metodología tradicional se requieren cuatro semanas o más para obtener resultados.

 

REFERENCIAS

1. Branger B, Gouby A, Oules R, Balducci JP, Mourad G, Fourcade J et al. Mycobacterium haemophilum and Mycobacterium xenopi associated infection in a renal transplant patient. Clin Nephrol 1985; 23: 46-9.         [ Links ]

2. Dever L, Martin JW, Seaworth B, Jorgensen JI. Varied presentations and responses to treatment of infections caused by Mycobacterium haemophilum in patients with AIDS. Clin Infect Dis 1992; 14: 1195-200.         [ Links ]

3. Straus WL, Ostroff SM, Jernigan DB, Kiehn TE, Sordillo E, Armstrong M et al. Clinical and epidemiological characteristics of Mycobacterium haemophilum, an emerging pathogen in immunocompromised patients. Ann Intern Med 1994; 120: 119-25.         [ Links ]

4. White MH, Papadopoulos EB, Small TN, Kiehn TE, Armstrong D. Mycobacterium haemophilum infections in bone marrow transplant recipients. Transplantation 1995; 60: 957-60.         [ Links ]

5. Devallois A, Seng K, Rasogi N. Rapid identification of Mycobacterium to species level by PCR-restriction fragment length polymorphism analysis of the hsp 65 gene and proposition of an algorithm to differentiate 34 Mycobacterial species. J Clin Microbiol 2002; 35: 2969-73.         [ Links ]

6. Da Silva-Rocha A, Barreto W, Campos C, Villalobos M, Fonseca I, Saad M et al. Novel allelic variants of Mycobacterium isolates in Brazil as determined by PCR-restriccion enzyme analysis of hsp 65. J Clin Microbiol 2002; 40: 4191-6.         [ Links ]

7. Palomino JC, Martin A, Portaels F. New methods for the diagnosis and drug resistance detection in mycobacteria. Recent Res Devel Microbiol 2002; 2: 297-318.         [ Links ]

8. Telenti A, Marchesi F, Balz F, Bally E, Böttger E, Bodmer T. Rapid identification of mycobacteria to the species level by polymerase chain reaction and restriction enzyme analysis. J Clin Micribiol 1993; 31: 175-8.         [ Links ]

9. Devallois A, Goh KS, Rastogi N. Rapid identification of mycobacteria to species level by PCR-restriction fragment length polymorphism analysis of the hsp65 gene and proposition of an algorithm to differentiate 34 mycobacterial species. J Clin Microbiol 1997; 35: 2969-73.         [ Links ]

10. Brunello F, Ligozzi M, Cristelli E, Bonora S, Tortoli E, Fontana R. Identification of 54 mycobacterial species by PCR-restriction fragment length polymorphism analysis of the hsp 65 gene. J Clin Microbiol 2001; 39: 2799-806.         [ Links ]

11. Kent PT, Kubica GP. Public health mycobacteriology. A guide for the level III Laboratory Center for Disease Control. Atlanta. GA. 1985.         [ Links ]

12. Da Silva CF, Ueki M, Geiger D, Cardoso S. hsp 65 PCR-restriction enzyme analysis for identification of Mycobacterium in the clinical laboratory. Rev Inst Med trop 2001; 43: 1-9.         [ Links ]

13. Cobos-Marín L, Montes J, Rivera S, Licea A, González J, Estrada I. A novel multiplex-PCR for the rapid identification of Mycobacterium bovis in clinical isolates of both veterinary and human origin. Epidemiol Infect 2003; 130: 485-90.         [ Links ]

14. Matos DM, Santana MA, Santana MC, Mamede P, Becerra B, Pañao ED et al. Nontuberculosis micobacterias at a multiresistant tuberculosis reference center in Bahia: clinical epidemiological aspects. The Brazilian Journal of Infectious Diseases 2004; 8: 296-304.         [ Links ]

15. Wagner D, Young LS. Nontuberculous mycobacterium infections: a clinical review. Infection 2004; 32: 257-70.         [ Links ]

16. Ferreira RMC, Saad MHF, Da Silva MG, Foncesa LS. Non-tuberculous micobacteria I: One year clinical isolates identification in Tertiary Hospital Aids Reference Center, Rio de Janeiro, Brazil, In Pre Highly Active Antiretroviral Therapy Era. Mem Inst Osvaldo Cruz 2002; 97: 725-9.         [ Links ]

17. Leao SC, Bernardelli A, Cataldi A, Zumarraga M, Robledo J, Realpe T et al. Multicenter evaluation of mycobacterium identification by PCR restriction enzyme analysis in laboratories from Latin America and the Caribbean. Journal of Microbiological Methods 2005; 61: 193-9.         [ Links ]

 

Correspondencia a: Jorge Fernández Ordenes. Unidad de Desarrollo, Departamento Laboratorios de Salud, Instituto de Salud Pública de Chile. Maratón 1.000, Ñuñoa, Santiago de Chile. Fax: 3507573. E mail: jfernand@ispch.cl

Recibido el 12 de julio, 2005. Aceptado el 5 de diciembre, 2005.

Trabajo financiado con fondos INCO-CA Nº ICA4-CT-2001-10087 y del Instituto de Salud Pública.