SciELO - Scientific Electronic Library Online

 
vol.134 número7Tratamiento endovascular del síndrome de vena cava superiorCáncer colorrectal hereditario: análisis molecular de los genes APC y MLH1 índice de autoresíndice de materiabúsqueda de artículos
Home Pagelista alfabética de revistas  

Revista médica de Chile

versión impresa ISSN 0034-9887

Rev. méd. Chile v.134 n.7 Santiago jul. 2006

http://dx.doi.org/10.4067/S0034-98872006000700005 

  Rev Méd Chile 2006; 134: 833-840

ARTÍCULO DE INVESTIGACIÓN

 

Caracterización molecular de alelos ABO*O del locus de grupo sanguíneo ABO en tres poblaciones chilenas

Molecular Characterization of ABO*O Alleles at the ABO Group Locus in Three Chilean Populations

 

Elena Llop R1, Hugo Henríquez B1,5, Mauricio Moraga V1, Mario Castro D2,3, Francisco Rothhammer E4,1.

Programas de 1Genética Humana y de 2Morfología, Instituto de Ciencias Biomédicas (ICBM), Facultad de Medicina, Universidad de Chile, Santiago de Chile. 3Departamento de Antropología, Facultad de Ciencias Sociales, Universidad de Chile. Santiago de Chile. 4Universidad de Tarapacá, Arica, Chile.5Facultad de Ciencias de la Salud, Universidad Diego Portales, Santiago de Chile.

Dirección para correspondencia


Background: Among the allelic variants of blood groups, the molecular characterization of ABO blood group has clinical and anthropological importance. Aim: To perform a characterization of the molecular variants of the allele ABO*O of the ABO blood group. Material and methods: Eighty four subjects of Aymara origin, living in Northern Chile, 75 individuals of Huilliche origin, living in Southern Chile and 82 subjects living in Santiago (Central Chile), were studied. All individuals were of group O, homozygotes for G261- deletion, that defines O1 alleles. Mutations G188A, G261-, G542A, T646A and C771T, described for alleles O1, O1variant and G542A were determined by PCR-RFLP (polymerase chain reaction-restriction fragment lenght polymorphism). Results: Allele O1variant has frequencies of 0.65, 0.81 and 0.6 in Aymara, Huilliche and Santiago subjects, respectively. The figures for allele O1 are 0.35, 0.19 and 0.4, respectively and those for the allele with G542A mutation are 0.119, 0.113 and 0.079, respectively. Conclusions: These results are concordant with the reported higher frequency of allele O1variant in South American aboriginal populations. The frequencies of G542A allele in these Chilean individuals are lower than those described for Amazon aborigines.

(Key words: ABO blood-group system; Alleles; Indians, South American)


Con el advenimiento de nuevas técnicas y procedimientos en el campo de la biología molecular, se han abierto en genética humana nuevas vertientes de investigación con interesantes proyecciones. Entre ellas, cabe destacar la caracterización molecular de variantes alélicas de sistemas de grupos sanguíneos, dentro de las cuales destaca, por su distribución e importancia en clínica y bioantropología, el grupo sanguíneo ABO.

El sistema ABO, descubierto por Karl Landsteiner en 1900, es el sistema de grupo sanguíneo más importante en medicina transfusional. Sus características genéticas y serológicas, así como la biosíntesis de los antígenos ABO, han sido bien establecidas1-3.

La base genética que sustenta la existencia de distintas especificidades antigénicas (antígenos A, B y O) corresponde a mutaciones en la secuencia del gen que codifica para la glicosiltransferasa involucrada en la adición de un azúcar específico a la sustancia H, codificada por otro gen de la vía. Estos cambios se generan principalmente en los exones 6 y 7 de la secuencia del gen ABO, donde se codifica el 77% de la proteína y se encuentra el 91% del dominio catalítico de esta enzima.

El alelo ABO*O (O1) difiere de los alelos ABO*A y ABO*B, en una mutación en el exón 6 de la secuencia del gen ABO, que corresponde a una deleción de un nucleótido G (guanina), en la posición 261(G261-). Esta mutación, que genera un cambio en el marco de lectura de la proteína y, por ende, un producto no funcional, es característica de la gran mayoría de los alelos O descritos hasta ahora4. Existe una pequeña proporción de alelos O que no pueden ser definidos en base a la mutación presente en el nucleótido 261. De estas variantes, destaca el alelo O2, el que presenta algunas mutaciones que generarían un cambio aminoacídico en un dominio clave de la proteína, lo que en consecuencia produciría el alelo ya mencionado.

Se han descrito diferentes alelos ABO*O, en varias poblaciones, los dos más frecuentes corresponden a O1 y O1variant (O1v), ambos poseen la deleción G261-. El alelo O1 corresponde al alelo clásico, en tanto el O1v, además de presentar la mutación que define a los alelos O, exhibe otras 9 sustituciones nucleotídicas a lo largo de su secuencia, presentándose la mayoría de ellas en el exón 74 (Tabla 1). Este alelo, se encontraría presente en caucásicos y amerindios. En éstos últimos, se observan las frecuencias más altas de este alelo. En indígenas de la amazonia se han descrito frecuencias de 0,90 y 0,65 para el alelo O1v 5,6, en cambio en indígenas aymara de Bolivia, este alcanza una frecuencia de 0,60. Frecuencias un poco menores, pero igualmente significativas, se encontraron en indígenas de Ecuador y Bolivia7. En tanto, en poblaciones caucásicas se han observado frecuencias más bajas, tales como 0,40 y 0,29, en población de Suecia y población vasca, respectivamente5,7.


Por otra parte, se ha descrito un alelo variante de O1v, que tiene la mutación G542A. Este nuevo alelo se encontró en 43% de los indígenas de la Amazonia y en 4% en individuos caucásicos estudiados de Suecia5. No se encontró esta mutación en la población vasca estudiada7.

El presente trabajo tiene por objeto general la caracterización molecular de alelos ABO*O del grupo sanguíneo ABO, en poblaciones chilenas. Nos propusimos estudiar la frecuencia de los alelos O1, O1 variant y la mutación G542A, en tres poblaciones chilenas, a saber, indígenas aymaras residentes en la I región, indígenas huilliches residentes en la X región y una muestra de población de Santiago, constituida por dadores de sangre del Hospital Roberto del Río, del área norte de Santiago.

MATERIAL Y MÉTODO

Se incluyeron en este estudio 84 individuos de origen aymara, del interior de Arica, I región; 75 individuos de origen huilliche, de la localidad de San Juan de la Costa, X región y finalmente 82 individuos de la ciudad de Santiago. Todos los individuos que participaron en este estudio fueron de grupo sanguíneo O. La determinación de los alelos O1 y O1v y la mutación G542A, se realizó en muestras de ADN, obtenidas a partir de sangre periférica. Las muestras de sangre de las poblaciones aborígenes aymara y huilliche, fueron obtenidas hace más de una década, en el marco de proyectos bioantropológicos, que perseguían objetivos similares. La muestra de Santiago, se obtuvo de dadores de sangre del Hospital Roberto del Río, del área norte de Santiago, que autorizaron la toma y utilización de un espécimen de sangre, a través de la firma de un consentimiento informado, en el cual se explicaba claramente la investigación científica a realizar, la cual fue anónima y no perseguía fines de lucro. El grupo sanguíneo de cada individuo fue determinado por métodos serológicos y por métodos moleculares. El ADN genómico de los individuos aymara, huilliche y de Santiago, fue extraído de linfocitos de sangre periférica, según el protocolo descrito por Lahiri y Nurnberger8. Los polimorfismos que permiten la diferenciación molecular de los distintos alelos del grupo sanguíneo ABO, fueron los correspondientes a los exones IV, VI y VII (Tabla 2).


La determinación molecular de estos alelos se realizó mediante la técnica de PCR y posterior digestión de los productos de amplificación. Las parejas de partidores utilizadas, así como los protocolos de amplificación y digestión, fueron tomados de la literatura o adaptados de ésta2,4,5,9,10. Las parejas de partidores fueron las siguientes: Exón IV, E41 TAAATCCTGCTCCTAGACTAAAC, E42 GGACAATTCTGTGACATGGGAG; Exón VI, E61 CATGTGACCGCACGCCT, E62 TCGGCCACCTCACTGACTTA. Para el exón VII se utilizaron los partidores E73 CAGCTGTCAGTGCTGGAGGTG y E74 CCTGGTTCGACCATCATGGCCTG para los polimorfismos T646A y C771T. Para el polimorfismo G542A se utilizaron los partidores E71 CCGTCCGCCTGCCTTGCAG y E72 AAGTCACTGATCATCTCCAT.

La amplificación por PCR de los ADN extraídos desde las muestras, se realizó utilizando 1 unidad de TaqADN polimerasa (Fermentas), el tampón suministrado con la enzima, dNTPs 200 µM c/u y 25 pmoles de cada partidor en un volumen final de 25 µl. El ciclo de PCR considera denaturación inicial, 95°C por 5 min, 35 ciclos de: denaturación, 95°C por 1 min; apareamiento, 60°C por 1 min; elongación, 70° por 1 min; y elongación final a 70°C por 5 min. Las endonucleasas de restricción utilizadas fueron BstU I, para el amplificado del exón IV, Kpn I, para el amplificado del exón VI y NheI, MboI y DdeI para el exón VII. Los productos de las digestiones enzimáticas se resolvieron en geles de agarosa al 3% o acrilamida bisacrilamida 19:1 al 12% teñidos con bromuro de etidio.

Posteriormente, se calcularon las frecuencias genotípicas y génicas para los distintos genotipos y alelos encontrados, permitiendo de esta forma establecer posibles vinculaciones o diferencias en cuanto a la frecuencia de presentación y asociación de determinados alelos con alguna población en particular. La significancia estadística de las diferencias observadas, al realizar un análisis comparativo de las frecuencias génicas entre las poblaciones, se realizó utilizando el test de c2 11. Las distancias genéticas entre las distintas poblaciones se determinaron según Nei12, utilizando el programa BIOSYS. El dendrograma tipo Neighbor Joining fue constituido mediante el programa MEGA 2.112-14.

RESULTADOS

Todos los individuos incluidos en el presente estudio fueron de grupo sanguíneo O y homocigotos para la deleción G261-, que define a los alelos O1.

La Tabla 3, exhibe la distribución de individuos de acuerdo a su genotipo para los alelos O1 y O1v, en las poblaciones analizadas. Los resultados obtenidos, indican que el alelo O1v, exhibe frecuencias de 0,65, 0,81 y 0,60, en poblaciones aymaras, huilliches y población de la ciudad de Santiago, respectivamente, en tanto el alelo O1, muestra frecuencias de 0,35, 0,19 y 0,40 en las mismas poblaciones.


Por otra parte, la mutación G542A se encontró en individuos de genotipo O1/O1v y O1v/O1v. No se encontró, como era de esperar, en individuos de genotipo O1/O1. La frecuencia génica del alelo con la mutación G542A, se puede deducir de la Tabla 4 y corresponde a 0,119, 0,113 y 0,079, en aymaras, huilliches y población de Santiago, respectivamente. Cabe hacer notar que las frecuencias del alelo mutante G542A, en las poblaciones indígenas chilenas aymaras y huilliches son inferiores a las frecuencias de 0,43 y 0,22 descritas para poblaciones indígenas de la Amazonia5,6.


DISCUSIÓN

El sistema de grupo sanguíneo ABO, de gran importancia clínica, también es relevante en el área disciplinaria de la bioantropología. Para este sistema, el grupo sanguíneo O es el grupo más frecuente en todas las poblaciones y en particular en los indígenas sudamericanos, donde se fijó posiblemente por efecto fundador. Por esta razón, resulta interesante indagar si en la población chilena el alelo ABO*O, exhibe variantes o bien es homogéneo para un solo tipo molecular.

Nuestros hallazgos indican que las frecuencias de los dos alelos moleculares O1 y O1v, obtenidas en poblaciones chilenas, concuerdan con los resultados de otros autores, respecto a la mayor frecuencia del alelo O1v, en poblaciones indígenas sudamericanas (Tabla 5). Así, el alelo O1v, en la población huilliche, presenta una frecuencia alta (0,81), cercana a la descrita para algunas poblaciones amazónicas (0,91)5. Otras poblaciones amazónicas, en tanto, exhiben frecuencias menores para este alelo6. Llama la atención que los indígenas aymaras exhiben una frecuencia menor del alelo O1v (0,65), que los indígenas huilliches. Esta diferencia es estadísticamente significativa (X2= 10,73, p ­0,01). Por otra parte, la población de dadores de sangre, exhibe una frecuencia del alelo O1v similar a la frecuencia encontrada en la población aymara (Tabla 5).


En principio, este hallazgo podría indicar que los grupos andinos y los indígenas huilliches tienen un origen diferente. Sin embargo, información arqueológica, craneométrica y de marcadores genéticos proteicos, sugieren que el territorio actualmente chileno fue poblado de norte a sur16,17. Además, la distribución de haplogrupos de ADNmt para diferentes poblaciones chilenas ubicadas entre las latitudes 17° y 55° sur, indica que los haplogrupos A y B disminuyen en frecuencia de norte a sur, mientras que los haplogrupos C y D aumentan, dando origen a una gradiente de frecuencias que apoya este modelo18-21. Esta evidencia da respaldo a la hipótesis que la distribución heterogénea de los alelos O1 y O1V en Chile es el resultado de un proceso de microdiferenciación genética que ocurrió durante el poblamiento paleoindio, que sin duda fue un evento milenario.

El hecho que la población de Santiago exhiba una frecuencia de O1v similar a aquella estimada para los grupos andinos, se puede explicar debido a que la población de Santiago se originó, como es sabido, de la mezcla de conquistadores europeos e indígenas picunches, pertenecientes a la Confederación Araucana y cuyo acervo genético, aún presente en la población mixta de la zona central, es más semejante a la de los grupos indígenas de las regiones IX y X.

Si suponemos que la frecuencia de O1v de los huilliches representa a los araucanos y que este mismo alelo tuvo una frecuencia de 0,35 en los inmigrantes españoles, podemos calcular la mezcla amerindia de la ciudad de Santiago, obteniendo 46% utilizando la formula de Bernstein22. Este porcentaje concuerda bastante bien con los estimadores obtenidos en base a marcadores proteicos23.

Se ha señalado que la mutación G542A es irrelevante, debido a que la mutación inactivadora en el gen O1v es la deleción en el nucleótido 261. No obstante este hecho, la mutación constituye un marcador polimórfico que puede ser utilizado para diferenciar entre sí poblaciones amerindias, que comparten el alelo ABO*O y que difieren en el grado de mezcla, debido a la baja frecuencia de la mutación G542A en africanos y europeos y la frecuencia relativamente alta en amerindios (Tabla 6). Por otra parte, resulta interesante destacar que si se subdivide a los individuos amerindios sudamericanos que comparten el alelo ABO*O en los subtipos moleculares descritos (O1, O1v, O1v(G542A)) y se calculan distancias genéticas entre ellos, estas distancias concuerdan bastante bien con un modelo de poblamiento de Sudamérica, que incluye una migración paleoindia de norte a sur por la región andina y otra a través de la foresta tropical (Tabla 7).



El dendrograma que representa gráficamente la variación observada señala, en forma más explícita, estas relaciones genéticas (Figura 1). Cabe mencionar que los indígenas Parakanã de Brasil, presentan características genéticas muy diferentes al resto de los amerindios de la Amazonia y, posiblemente, hayan llegado a esta región desde otro lugar, quizás de la región andina.

Figura 1. Dendrograma que representa las relaciones genéticas consignadas en la matriz de distancias.

Destacamos además, que hasta la fecha se han descrito más de 70 alelos de grupo sanguíneo ABO, definidos molecularmente. Estas aproximaciones han incluido metodologías tan diversas como PCR-RFLP, SSCP, ASP, secuenciación y otras. La variación exhibida por el alelo ABO*O, no es exclusiva de éste. Se han descrito también variantes moleculares de los alelos ABO*A y ABO*B24,25, abriendo sin duda interesantes perspectivas futuras de investigaciones en los campos de la genética molecular y poblacional del sistema de grupo sanguíneo ABO.

 

REFERENCIAS

1. Watkins W. Blood group substances. Science 1966; 152: 172-81.         [ Links ]

2. Yamamoto F, Clausen H, White T, Marken J, Hakomori S. Molecular basis of the histo-blood group ABO system. Nature 1990; 345: 229-33.         [ Links ]

3. Bennett E, Steffensen R, Clausen H, Weghuis D, Van Kessel A. Genomic cloning of the human histo-blood group ABO locus. Biochem Biophys Res Commun 1995; 206: 318-25.         [ Links ]

4. Olsson M, Chester M. Frequent occurrence of a variant O1 gene at the blood group ABO locus. Vox Sang 1996; 70: 26-30.         [ Links ]

5. Olsson M, Santos S, Guerreiro J, Zago M, Chester M. Heterogeneity of the O alleles at the blood group ABO locus in Amerindians. Vox Sang 1998; 74: 46-50.         [ Links ]

6. Barjas-Castro M, Soares M, Menezes R, Carvalho M, Costa F, Saad S. ABO Blood group in Amerindians from Brazilian Amazon. Ann Hum Biol 2003; 3: 220-4.         [ Links ]

7. Roubinet F, Kermarree N, Despiau S, Apoil P, Dugoujon J, Blancher A. Molecular polymorphism of O alleles in five populations of different ethnic origins. Immunogenetics 2001; 53: 95-104.         [ Links ]

8. Lahiri D, Nurnberger J. A rapid non-enzimatic method for the preparation of HMW DNA from blood for RFLP studies. Nucl Acids Res 1991; 19: 5444.         [ Links ]

9. Ogasawara K, Bannai M, Saitou N, Yabe R, Nakata K, Takenaka M et al. Extensive polymorphism of ABO blood group gene: three major lineages of the alleles for the common ABO phenotypes. Hum Genet 1996; 97: 777-83.         [ Links ]

10. Yip S. Sequence variation at the human ABO locus. Ann Hum Genet 2002; 66: 1-27.         [ Links ]

11. Taucher E. Prueba de Ji-cuadrado. En: Taucher E, Ed. Bioestadística. Santiago: Editorial Universitaria, 1997; 145-9.         [ Links ]

12. Nei M. Estimation of average heterozygosity and genetic distance from a small number of individuals. Genetics 1978; 89: 583-90.         [ Links ]

13. Swofford DL, Selander RB. Biosys: a fortran program for the comprehensive analysis of electrophoretic data in population genetics and systematics. Journal of Heredity 1981; 72: 281-7.         [ Links ]

14. Kumar S, Tamura K, Jakobsen IB, Nei M. Mega 2: Molecular evolutionary genetics analysis software. Bioinformatics 2001; 17: 1244-5.         [ Links ]

15. Henríquez H, Moraga M, Llop E, Rothhammer F. Caracterización genético molecular de Caleta Paposo, último reducto Chango en Chile. Rev Méd Chile 2004; 132: 663-72.         [ Links ]

16. Rothhammer F, Llop E, Acuña M, Apt W. Is chagasic cardiopathy associated with HLA haplotype? Parasitol Today 1986; 2: 76.         [ Links ]

17. Llop E. Genetic composifion of Chilean aboriginal populations: HLA and other genetic marker variation. Am J Phys Anthrop 1996; 101: 325-32.         [ Links ]

18. Moraga M, Aspillaga E, Carvallo P, Rothhammer F. Analyses of mitochondrial DNA polymorphisms in skeletal remains and extant populations of Northern Chile. Chungara Rev Antrop Chilena 2000; 32: 263-4.         [ Links ]

19. Rocco P, Morales C, Moraga M, Miquel JF, Nervi F, Llop E et al. Composición genética de la población chilena. distribución de polimorfismos de ADN mitocondrial en grupos originarios y en la población mixta de Santiago. Rev Méd Chile 2002; 130: 125-31.         [ Links ]

20. Moraga M, Santoro C, Standen V, Carvallo P, Rothhammer F. Microevolution in prehistoric Andean populations: Chronologic mtDNA variation in the Desert Valleys of Northern Chile. Am J Phys Anthropol 2005; 127: 170-81.         [ Links ]

21. García F, Moraga M, Vera S, Henríquez H, Llop E, Aspillaga E et al. mtDNA Microevolution in Southern Chile's Archipelagos. Am J Phys Anthropol (en prensa).         [ Links ]

22. Bernstein F. Die geograpnische Verteilung der Blutgruppen und ihre anthropologische Bedeutung. In: Comitato Italiano per lo studio dei problemi della populazione. Rome: Instituto Poligráfico dello Stato 1931; 227-43.         [ Links ]

23. Rothhammer F. Flujo génico y deriva genética. En: Curso Básico de Genética Humana. Rothhammer F y Cruz-Coke R. Editorial Universitaria 1983; 157-74.         [ Links ]

24. Yamamoto F, Mc Neill P, Hakomoris S. Human histo blood group A2 transferase coded by A2 allele, one of the A subtipes, is characterized by a single base deletion in the coding sequence, which results in an additional domain at the carboxil terminal. Biochem Biophys Res Commun 1992; 187: 366-74.         [ Links ]

25. Olsson M, Shaid A, Hosseini-Maaf B, Hellberg A, Moulds M, Saren H et al. Genomic analysis of clinical samples with serologic ABO blood grouping discrepancies. Identification of 15 novel A and B subgroup alleles. Blood 2001; 98: 1588-93.        [ Links ]

 

Correspondencia a: Elena Llop R. Programa de Genética Humana, Instituto de Ciencias Biomédicas, Facultad de Medicina, Universidad de Chile. Av. Independencia 1027. Casilla 70061- Santiago 7- Chile. E mail: ellop@med.uchile.cl

Recibido el 10 de agosto, 2005. Aceptado el 16 de enero, 2006.

Trabajo financiado parcialmente por los proyectos DID ETN 02/01-2 y proyectos Fondecyt Nº 1040155 y 1050595.