SciELO - Scientific Electronic Library Online

 
vol.127 número11Ética Médica y Medicina Molecular: dos nuevas Secciones en la Revista Médica de ChileEfecto inmunosupresor in vitro de las lipoproteínas de baja densidad índice de autoresíndice de materiabúsqueda de artículos
Home Pagelista alfabética de revistas  

Revista médica de Chile

versión impresa ISSN 0034-9887

Rev. méd. Chile v.127 n.11 Santiago nov. 1999

http://dx.doi.org/10.4067/S0034-98871999001100002 

TRABAJOS DE INVESTIGACION

Epidemiología molecular del virus
de inmunodeficiencia humana tipo 1
en Santiago, Chile

Molecular epidemiology of the
human immunodeficiency
virus tipe 1 in Santiago, Chile

Carlos Pérez C, Pablo Vial C, Karin S Dorman,
Greg Wang, Guangqiang Wang, Katia Abarca V,
Janet S Sinsheimer, Andrew H Kaplan.

Background: Most of the studies of HIV-1 infection in South America have been limited to Brazil and little is known about the viral variants that are causing disease elsewhere in the continent. Aim: To determine the characteristics of the viral variants present in Chile as well as patterns of viral transmission. Material and methods: Viral sequences were obtained from 21 HIV-1 infected people from Santiago, Chile who were infected either via sexual contact or intravenous drug use. Cloned sequences obtained from both the third variable and conserved regions of the envelope as well as the viral protease were evaluated. Results: We found only clade B subtype viruses in Santiago. An evaluation of the envelope gene revealed no evidence that the sequences were monophyletic by risk group. A number of the protease sequences were predicted to encode amino acid substitutions commonly found during selection for protease inhibitor resistance. Conclusions: The HIV-1 strains studied in Chile, belong to the subtype B. There is no molecular evidence of separate introductions of the virus into the different risk groups. A number of substitutions in the protease gene that may confer resistance to protease inhibitors were found in patients with no previous exposure to this class of drugs.
(Key Words: Acquired immunodeficiency syndrome; AIDS serodiagnosis; HIV-1; Virology)

Recibido el 25 junio, 1999. Aceptado el 23 noviembre, 1999.
Trabajo financiado parcialmente por proyecto FONDECYT # 1971213. JSS es financiada
parcialmente por CA16042 y 28697 de NCI y AIMH, respectivamente. KSD es financiada
por el fellowship predoctoral del NIH GM 08185. AHK es financiado por R29 AI36702.
Department of Medicine, Biomathematics and Microbiology and Immunology, University
of California at Los Angeles. Departamentos de Medicina y Pediatría, Pontificia Universidad
Católica de Chile.

La infección por el virus de inmunodeficiencia humana (VIH), se caracteriza por la presencia de una considerable heterogeneidad genética1-4. Dada la alta variabilidad del genoma del VIH, se requiere del uso de herramientas epidemiológicas tales como el análisis filogenético, para estudiar la diseminación del virus dentro de diferentes poblaciones. Los métodos filogenéticos han sido utilizados para caracterizar la transmisión del VIH-1 de persona a persona, dentro de algunas comunidades y entre países5-7. La mejor comprensión de las formas de transmisión, ha llevado al diseño de intervenciones para disminuir las tasas de infección dentro de grupos de alto riesgo8. Más aún, la vigilancia activa y la caracterización de los subtipos de VIH prevalentes en una comunidad, son esenciales para validar la sensibilidad de los prueba para VIH en la práctica clínica9,10. Finalmente, los estudios de epidemiología molecular tienen una gran importancia en el diseño de vacunas potencialmente efectivas11.

La heterogeneidad del VIH está presente en todo el genoma del virus, pero es mayor en el gen que codifica la envoltura (env)1-4 y se concentra en 5 regiones variables (V1 a V5)3-4. La tercera región hipervariable de la glicoproteína de superficie 120, que tiene una estructura en asa central (asa o "loop" V3), contiene el sitio más importante para la neutralización por anticuerpos12. El asa V3 también está involucrada en el tropismo celular13 y formación de sincicio14. El análisis filogenético de estas secuencias del gen de la envoltura ha llevado a la identificación de 3 grupos de VIH-1: M o principal, O o externo y el recientemente descrito grupo N15. Dentro del grupo M, se han identificado 8 subtipos o "clades" señalados con letras de la A a la J15. Se han obtenido resultados similares con análisis filogenético del gen gag16. El gene pol que codifica las enzimas transcriptasa reversa, integrasa y proteasa es más conservado del punto de vista genético, pero estudios recientes han demostrado que también puede tener una considerable heterogeneidad en sus secuencias17,18.

La Organización Mundial de la Salud ha estimado en aproximadamente 1,7 millones el número de pacientes infectados con VIH-1 en Sudamérica y el Caribe19. El subtipo más prevalente en la región es el B20-22, sin embargo se han encontrado también subtipos C, F y recombinantes de éstos en Brasil11,23,24. Recientemente, varios casos de infección por VIH-1 subtipo E (actualmente considerado un recombinante AE15), fueron identificados en pacientes en Uruguay25. El primer caso de infección por VIH-1 en Chile se describió en 198426. En los últimos 14 años se han comunicado alrededor de 6.600 casos y se estima que el número total de infectados superaría los 15.000 pacientes27. Más del 70% de los pacientes infectados viven en Santiago, 90,3% son hombres y el factor de riesgo más importante es la homo/bisexualidad. Para el caso de las mujeres, la principal vía de adquisición son las relaciones heterosexuales. La transmisión sanguínea, que incluye preferentemente la drogadicción intravenosa, no representa más del 6% de los casos27. Un estudio reciente mostró que el subtipo prevalente en Chile sería el B28.

En el presente estudio, se efectuó una caracterización de la epidemiología molecular del VIH en Santiago de Chile. Para ello, analizamos secuencias de la región genética V3C3 y del gen de la proteasa de 21 pacientes chilenos pertenecientes a diferentes grupos de riesgo. Asimismo, comparamos la información obtenida, con los datos disponibles en las bases de datos, de secuencias conocidas del VIH-1.

MATERIAL Y MÉTODO

Muestras clínicas: Veintiún pacientes infectados con VIH-1, seguidos en el Hospital Clínico de la Pontificia Universidad Católica de Chile, Hospital Sótero del Río y Hospital San Borja-Arriarán en Santiago de Chile, fueron incluidos en el estudio. Los datos clínicos y epidemiológicos de los pacientes se muestran en la Figura 1. Las células mononucleares periféricas, fueron separadas por centrifugación en un gradiente de densidad de Ficoll-Hypaque y el DNA fue extraído con el kit sanguíneo QIAamp (Qiagen Inc, Chatsworth, CA) de acuerdo a las instrucciones del fabricante.

Reacción de polimerasa en cadena (PCR), amplificación, clonación y secuenciación: La región V3C3 fue amplificada mediante un protocolo de PCR anidado ("nested"), incorporando sitios de restricción que se indican con letras minúsculas. Los partidores río arriba ("upstream") para el primer round fueron (V3V4.6458) 5’CCCAACCCACCAGAAGTAGTATT3’ y río abajo ("downstream") (V3V4.7773) 5’CCCAAGAACCCAAGGAACAAAGC3’ (secuencia HXB2). Cuando no se obtuvo amplificación, se utilizó los partidores ED3 y ED1229. Los partidores para el segundo round fueron (V3V4. 6854) 5’TGAGCgaattcCCATACATTATT3’ (EcoR I) y (V3V4.7500) 5’GCTTTTCCTACTTTctgcagCAT3’ (Pst I), obteniéndose un producto de 646 pares de bases (pb). Las condiciones para la reacción de PCR fueron 10 mM Tris-HCL (pH 8,3), 50 mM KCl, 3 mM MgCl2, 200 µM de cada deoxinucleótido trifosfato, 50 pmol de cada partidor, 2,5 U of Taq DNA polymerase (Perkin-Elmer Cetus, Emeryville, CA), y cantidades variables de DNA templado (hasta 1 µg) en un volumen final de 100 µl. Las amplificaciones fueron efectuadas en un termociclador Perkin-Elmer, modelo 9600 (Norwalk, Conn). Las condiciones del primer round de PCR fueron: 5 min de denaturación a 95°C, seguido por 5 ciclos consistentes en 25 s de denaturación a 94°C, 25 s de annealing a 37°C y 25 s de extensión a 72°C. Finalmente 35 ciclos consistentes en 25 s de denaturación a 94°C, 50 s de annealing a 50°C y 50 s de extensión a 72°C para todos los ciclos excepto por el número 40 en el cual la extensión duró 5 min (el así llamado "step-up" PCR). Cuando se utilizó partidores ED3 y ED12, las condiciones de PCR fueron similares a lo descrito por Delwart et al29. Se utilizó cuatro µl del producto del primer round como templado para el segundo round de amplificación con V3V4.6854 y V3V4.7500 consistiendo en cinco min de denaturación a 94°C, seguido por 35 ciclos consistentes en 20 s de denaturación a 94°C, 25 s de annealing a 52°C y 25 s de extensión a 72°C para todos los ciclos excepto por el número 35 en el cual la extensión duró 5 min. El gen de la proteasa fue amplificado en 14 pacientes usando un protocolo ya descrito en la literatura17.

Los productos amplificados del PCR fueron purificados e insertados en el vector p Bluescript II SK (±) (Stratagene, La Jolla, CA) usando los sitios de restricción EcoR I y Pst I (V3V4) o BamH I y Pst I (proteasa) incorporados en los partidores internos del PCR. Tres a siete clones conteniendo insertos de cada paciente fueron secuenciados manualmente, utilizando el método de terminación de la dideoxicadena de acuerdo a las instrucciones del fabricante (Sequenase 2,0; United States Biochemical, Cleveland, OH).

Análisis de las secuencias: El alineamiento de las secuencias fue hecho con el paquete "Wisconsin Sequence Analysis Package GCG" (Genetic Computer Group, INC), utilizando el programa PILEUP con opciones de defecto. Se alineó las secuencias V3C3 de cada paciente para inferir una secuencia de consenso con nucleótidos ambiguos cuando era apropiado. La clasificación en subtipos o "clades" de las secuencias de consenso de los pacientes se obtuvo al construir los árboles filogenéticos de estas secuencias junto con secuencias de consenso de subtipos A-H de la base de datos VIH de Los Alamos. Se utilizó PHYLIP’s DNADIST30 para calcular las distancias Kimura de dos parámetros con un índice de transición/transversión de 2,031. Se utilizó sistema NEIGHBOR para inferir el árbol de proximidad de vecinos ("neighbor joining tree")32 (Figura 1). La topología del árbol filogenético se verificó realizando 1.000 bootstraps (utilizando PHYLIP’s SEQBOOT) con el análisis anterior y redibujando los árboles de proximidad de vecinos con la máxima probabilidad ("maximum likelihood") y distancias de Jukes-Cantor. Las distancias interpacientes fueron calculadas alineando las secuencias de pacientes y considerando todas las comparaciones en pares de distintos pacientes. Se hizo alineamiento de 2 pacientes al mismo tiempo, para minimizar los aumentos de distancia artefactuales. Se utilizó GCG’s DISTANCES con el algoritmo de Kimura. De manera similar, las secuencias de los pacientes fueron alineadas con secuencias representativas de los diferentes subtipos, para calcular las distancias de los pacientes a una determinada "clade". Todos los clones del paciente 9002 mostraron una débil evidencia de recombinación entre subtipo B y F, tanto en el gene protease como en el gene env. Ya que los recombinantes no cumplen con los criterios requeridos por los métodos filogenéticos, este paciente fue excluido del análisis filogenético y de distancias.

Figura 1. Arbol filogenético de secuencias pertenecientes a la región V3C3 de la envoltura del VIH-1 de pacientes chilenos. Se utilizó PHYLIP's NEIGHBOR para inferir el árbol de proximidad de vecinos de los pacientes y secuencias de consenso de subtipos A-H del VIH-1. Se utilizó método de distancias para 2 parámetros de Kimura. Se efectuaron 1.000 bootstraps y el árbol que se muestra corresponde al número de ensayos que mantuvo un grupo monofilético en más de 70% de las oportunidades.

Con el objeto de minimizar los potenciales efectos confundentes de la contaminación de la reacción de PCR, tanto de los clones moleculares como de otros sujetos, comparamos la secuencias obtenidas de nuestros sujetos con la de HXB2 y con las de otros pacientes. En el caso del paciente 3004, encontramos que las secuencias de los tres clones fueron idénticas y sólo 5% distintas del clone molecular HXB2. Aunque esto no prueba que halla ocurrido contaminación con HXB2, decidimos excluir del análisis a las secuencias del sujeto 3004. Todos los otros pacientes fueron al menos 9% diferentes de HXB2.

RESULTADOS

Características clínicas y epidemiológicas de los pacientes

El grupo estudiado consistió en 21 pacientes chilenos infectados con VIH-1, pertenecientes a diferentes grupos de riesgo (Tabla 1). El grupo incluyó a 15 hombres y 6 mujeres, cuyas edades fluctuaron entre 22 y 49 años. Los factores de riesgo para la infección por VIH-1 fueron homo/bisexualidad masculina (7 pacientes), contacto heterosexual con pacientes infectados (4 mujeres), uso de drogas intravenosas (UDIV) (9 pacientes) y desconocido en 1 paciente. Ocho pacientes tenían recuentos de linfocitos CD4 + <200 cel/mm3. El paciente 9007 residió por más de 10 años en Holanda, donde era usuario de heroína IV y donde probablemente adquirió la infección por VIH.

Secuencias nucleotídicas y predicción de secuencias aminoacídicas

a) Región V3C3: Se secuenció un fragmento del gen env que codifica la región variable V3 y la tercera región conservada (C3). Se obtuvo un total de 95 secuencias de 258 a 313 pb de 16 pacientes chilenos (Tabla 1). Las secuencias nucleotídicas fueron alineadas y comparadas con secuencias conocidas pertenecientes a subtipos del grupo M (A a H) como también a secuencias pertenecientes al grupo O. Se construyó una árbol filogenético con 15 pacientes más las secuencias de consenso de "clades" A a H (Figura 1). En el árbol filogenético óptimo de proximidad de vecinos ("neighbor-joining tree"), todas las secuencias chilenas formaron un grupo monofilético con la secuencia de consenso perteneciente al subtipo B. Esta agrupación se mantuvo en el 88,5% del análisis bootstrap. Más aún, el promedio de distancias de los pares ("pairwise distances") entre los clones chilenos y las secuencias de referencia del subtipo B, fue de 14% con un rango de 6,8% a 26,2%, cifra inferior a la distancia con cualquier otro subtipo de VIH-1. La secuencias del gen env obtenidas de los pacientes chilenos, no formaron grupos monofiléticos asociados al modo de transmisión del VIH-1. El promedio de divergencia genética intra-subtipo entre los pacientes estudiados fue de 18,8%, con un rango de 5,8% a 38,4%. Esta alta diversidad genética, se explicaría en parte por la divergencia genética observada en el paciente 9007.

Tabla 1. Datos clínicos y epidemiológicos de la muestra estudiada

Código Sexo Edad Estado clínico † Recuento CD4+ Factor de riesgo
Origen y número de secuencias
        (x 10/L)   Región V3C3 Proteasa

0009 M 34 a 630 Homosexual 5  
1004 F 39 A 404 Heterosexual   3
2003 M 36 B 371 Bisexual 7  
2006 M 42 A 841 UDIV 5 3
2012 M 34 A 189 Desconocido 5  
2013 F 34 A 122 Heterosexual 7  
2015 M 36 A     3 Homosexual   3
3006 M 34 A 373 Homosexual 6  
3008 M 37 A 443 Homosexual 6 3
3009 F 42 A 215 Heterosexual   4
3011 M 49 A 122 Homosexual 7  
5002 F 34 A   34 Heterosexual 7  
5005 M 22 A 858 Bisexual 6 3
9001 F 26 C 119 UDIV   3
9002 M 27 C 196 UDIV 5 3
9003 M 26 A 1054   UDIV 6 3
9004 F 30 A 635 UDIV   3
9005 M 31 A 329 UDIV 5 3
9006 M 21 A 157 UDIV 6 3
9007 M 34 B 235 UDIV 5 2
9008 M 22 C 302 UDIV 7 3

† CDC 1993

La predicción de secuencias aminoacídicas como la secuencia de consenso se muestran en la Figura 2. Se identificaron 6 sitios potenciales de N-glicosilación (NXT/S) en las posiciones 301, 335, 342, 362, 368 y 392. El primer y segundo sitio de glicosilación se encontró al comienzo y fin del asa V3 y fueron altamente conservados (94% y 97% respectivamente). En contraste los sitios de N-glicosilación de la región C3 fueron menos conservados (76%, 77%, 51% y 76% respectivamente). Los tetrapéptidos que se encontraron con mayor frecuencia en la punta del asa V3 loop fueron GPGR (65,3%), GPGS (12,9%), GWGR (6,9%), GPGK (6,9%) y GSGR (5%). De acuerdo al análisis genotípico la mayoría de las secuencias clonadas corresponderían a la variedad macrofagotrópica del virus.

Figura 2: Alineamineto de secuencias aminoacídicas de la región V3C3 del gen env de VIH-1 de pacientes chilenos. Cada paciente se identificó con un código consistente en las letras CH más cuatro dígitos, seguido por uno o dos números, representando el número del clon. La secuencia de consenso aparece al pie de la figura. Los puntos indican identidad de secuencias. Los guiones representan deleciones. Los asteriscos corresponden a codones de detención. El número de veces que un determinado clon aparece en el grupo de datos, se indica con un número al costado derecho de la figura.

b) Gen de la proteasa: Se obtuvo un total de 42 secuencias del gen de proteasa de 297 pb de longitud de 14 pacientes chilenos (Tabla 1). Las secuencias nucleotídicas fueron alineadas y comparadas con 7 secuencias de consenso (consensos A, B, C, D, F, G y H). Al igual que en el análisis de la región V3C3, las secuencias de proteasa analizadas formaron un grupo monofilético con la secuencia de consenso de la "clade" B (Figura 3). El promedio de distancia de los pares entre el grupo estudiado y el subtipo B fue menor (2,9%) que con el subtipo D (5,8%), subtipo A (10,4%), subtipo C (12,4%), subtipo F (11,1%), subtipo G (10,6%) y subtipo H (12,4%). El promedio de divergencia genética intra-subtipo entre los pacientes fue de 5,4% con un rango de 0,7% a 10,3%. La predicción de secuencias aminoacídicas como la secuencia de consenso se muestran en la Figura 4. La comparación entre las secuencias aminoacídicas encontradas en el grupo estudiado y la secuencia de consenso generada a partir de las secuencias de subtipo B publicadas, mostró variaciones en varias posiciones. Es un hecho conocido que el aminoácido 63 de la proteasa es polimórfico15,17. En nuestro estudio prolina fue el aminoácido más común en esta posición. Otras substituciones frecuentes fueron Leu por Ile en la posición 93 (35,7% de las secuencias), Thr por Ala en la posición 71 (28,6% de las secuencias), Ser por Asn en la posición 37 (28,6% de las secuencias) y Lys por Arg en la posición 41 (23,8% de las secuencias).

Figura 3. Arbol filogenético de secuencias pertenecientes al gen de la proteasa del VIH-1 de pacientes chilenos. Se utilizó las secuencias de consenso de los pacientes y subtipos A, B, C, D, E, F, G y H para dibujar el árbol filogenético tal como se describe en la Figura 1.

Es interesante notar que aunque ninguno de nuestros pacientes, al momento del estudio, había recibido inhibidores de proteasa, 6 de los 14 pacientes tenían mutaciones del gen de la proteasa que aparecen regularmente en virus expuestos a estos antirretrovirales33-36. Estas mutaciones fueron Ile por Met en la posición 36 (pacientes 9002 y 9005), Arg por Lys en la posición 20 (paciente 9007), Thr por Ala en la posición 71 (pacientes 9001, 9004, 9005 y 9008) e Ile por Val en la posición 82 (pacientes 9008). En total 6 de los 14 pacientes tenían alguna de estas mutaciones. A pesar de que las secuencias de la proteasa obtenidas de los pacientes chilenos no formaron un grupo monofilético asociado a la vía de transmisión, las substituciones asociadas con resistencia a inhibidores de proteasa, sólo se encontraron en los UDIV. Es interesante notar también que 4 de los 6 sujetos con mutaciones asociadas a resistencia, tenían una enfermedad más avanzada (clase B o C del CDC), comparada con pacientes sin mutaciones (8/8 clase A, p= 0,015).

DISCUSIÓN

Existen pocos datos publicados respecto a las variantes del VIH-1 más frecuentes en Chile28. La mayoría de los estudios de heterogeneidad genética, se han centrado en Brasil donde el subtipo prevalente es el B. Se han encontrado también en Brasil virus del subtipo C y F y recombinates de estos subtipos11,23,24. Estudios efectuados en Argentina20, Paraguay21 y Venezuela22 han demostrado sólo la presencia del subtipo B. En Uruguay se reportaron 5 casos de subtipo E (AE según la clasificación actual15), entre personal militar que habría adquirido la infección por VIH-1 en Camboya25.

En el presente estudio se evaluó la heterogeneidad genética del gen de la proteasa y región V3C3 de la envoltura en pacientes chilenos pertenecientes a distintos grupos de riesgo. Con la excepción de un paciente que pareciera estar infectado con una cepa recombinante B/F, nuestro análisis indica que todos los pacientes estudiados tienen infección por VIH-1 subtipo B. Este resultado apoya la hipótesis de que el VIH-1 fue probablemente introducido en Chile por personas que adquirieron la infección en Norteamérica, Brasil o Europa. En Chile la principal vía de transmisión es la sexual y la prevalencia de pacientes infectados pertenecientes al grupo de UDIV es aún baja27. Nosotros incluimos en este estudio a pacientes de diferentes grupos de riesgo que viven en Santiago. Los pacientes UDIV están sobrerrepresentados en la muestra estudiada, con el objeto de establecer si en ese grupo existía una introducción inicial única del VIH-1. Considerando que la mayoría de los pacientes infectados con VIH-1 en Chile viven en Santiago, pensamos que esta muestra es representativa de la realidad nacional. Encontramos una alta variabilidad intra-subtipo en la región V3C3 de las secuencias de los pacientes estudiados. Resultados similares han sido comunicados entre pacientes brasileños37. La tétrada más frecuente en la punta del asa V3 fue GPGR, que se encuentra ampliamente distribuida entre virus norte y sudamericanos. Es de interés señalar que un paciente (9008) tuvo el terapéptido GWGR que se ha encontrado en virus aislado en Brasil37. Este paciente era una UDIV que tenía el antecedente de frecuentes viajes a Argentina, donde puede haber adquirido la infección. No es de extrañar, que los dos sitios de N-glicosilación que se encuentran al comienzo y fin del asa V3 fueran altamente conservados, reforzando la idea de que ellos son muy importantes para el plegamiento de la glicoproteína 12038. La mayoría de los pacientes tenían un genotipo V3 de tipo macrófago-trópico.

Nuestro análisis de las secuencias de la envoltura y de la proteasa, no mostró que éstas pertenecieran a grupos monofiléticos distintos, agrupados por grupo de riesgo. Este hallazgo tiene varias explicaciones, pero la más plausible, es que exista un intercambio frecuente de VIH-1 entre los diferentes grupos de riesgo en nuestro país.

En el estudio de esta cohorte, también evaluamos la magnitud y el tipo de variabilidad encontrada en el gen de la proteasa. La comparación de las secuencias de nuestros pacientes con la secuencia del subtipo B (HXB), demostró varios cambios que conviene destacar. En general, las substituciones tendieron a agruparse evitando dominios de alta mutabilidad como el asa del sitio activo y la región "flap" de la enzima (Figura 4). Además varios residuos que se sabe que son críticos para la interacción entre enzima y substrato fueron altamente conservadas. Cada uno de los aminoácidos cuyas cadenas laterales tienen contacto directo con el substrato fueron absolutamente conservados con la excepción de la substitución de glicina por ácido aspártico, usualmente presente en posición 29 e isoleucina por valina en la posición 82. Es también de interés señalar que en el grupo estudiado se encontraron varias mutaciones que aparecen frecuentemente durante el uso de inhibidores de proteasa33-36. No es claro por qué estas substituciones sólo se encontraron en los UDIV. Considerando que los inhibidores de proteasa fueron aprobados para su uso en Estados Unidos y posteriormente en Chile tiempo después del momento en que se obtuvo las muestras de los pacientes, es prácticamente imposible que estos pacientes hallan utilizado este tipo de drogas. La presencia de estas substituciones sólo en los UDIV, podría reflejar una introducción del VIH-1 muy bien delimitada a este grupo de riesgo, sin embargo la ausencia de una agrupación filogenética definida de las secuencias de la envoltura y del gen de protesa descartaría esta posibilidad. Estos hallazgos apoyan la idea de que es necesario analizar secuencias de diferentes regiones del genoma viral, para obtener un cuadro completo de las relaciones entre las cuasiespecies que infectan a diferentes individuos.

FIGURA 4.Variación en las secuencias aminoacídicas del gen de la proteasa de VIH-1 de pacientes chilenos.
Cada paciente se identificó con un código consistente en las letras CH más cuatro dígitos, seguido por un
número, representando el número del clon. La secuencia de consenso aparece al pie de la figura. Los puntos
indican identidad de secuencias. Los asteriscos corresponden a codones de detención. Se incluyó a todos los
clones de cada paciente.

Varios grupos han comunicado la presencia de mutaciones habitualmente vistas durante la exposición a inhibidores de proteasa en pacientes que nunca han recibido estas drogas17-18. Mohri y cols, han encontrado variantes de VIH-1 resistentes a inhibidores de la transcriptasa reversa en pacientes que nunca han recibido estos tratamientos39. Nuestros datos confirman estos hallazgos, en pacientes sudamericanos. Dada la alta velocidad de replicación viral y la alta frecuencia de mutaciones asociadas con la infección por VIH-1 in vivo, no es de extrañar el hallazgo de mutaciones pre-existentes que se asocian con resistencia a antirretrovirales. Si la presencia de estas mutaciones pre-existentes podrían afectar la respuesta a inhibidores de proteasa, es un hecho que necesita ser aclarado.

Correspondencia a: Dr. Carlos Pérez C. Apoquindo 3990, oficina 408, Las Condes. Fax: 2070532. Correo electrónico: cape@med.puc.cl Departamento de Medicina, Pontificia Universidad Católica de Chile.

Agradecimientos: Deseamos expresar nuestro agradecimiento a los Drs Marcelo Wolff y Jeanette Dabanch, del Hospital San Borja-Arriarán, quienes gentilmente nos proveyeron de muestras provenientes de pacientes UDIV.

REFERENCIAS

1. HAHN BH, GONDA MA, SHAW GM, POPOVIC M, HOXIE JA, GALLO RC, WONG-STAAL F. Genomic diversity of the acquired immune deficiency syndrome virus HTLV-III: different viruses exhibit greatest divergence in their envelope genes. Proc Natl Acad Sci USA 1985; 82: 4813-7.        [ Links ]

2. COFFIN JM. Genetic variation in AIDS viruses. Cell 1986; 46: 1-14.        [ Links ]

3. STARCICH BR, HAHN BH, SHAW GM, MC NELLY PD, MODROWS S, WOLF H ET AL . Identification and characterization of conserved and variable regions in the envelope gene of HTLV-III/LAV, the retrovirus of AIDS. Cell 1986; 45: 637-48.        [ Links ]

4. SIMMONDS P, BALFE P, LUDLAM CA, BISHOP JO, LEIGH BROWN AJ. Analysis of sequence diversity in hypervariable regions of the external glycoprotein of human immunodeficiency virus type 1. J Virol 1990; 64: 5840-50.        [ Links ]

5. OU C-Y, CIESIELSKI CA, MYERS G, BANDEA CI, LUO CC, KORBER BT ET AL. Molecular epidemiology of HIV transmission in a dental practice. Science 1992; 256: 1165-71.        [ Links ]

6. JAFFE HW, MCCURDY JM, KALISH ML, LIBERTI T, METELLUS G, BOWMAN BH ET AL. Lack of HIV transmision in the practice of a dentist with AIDS. Ann Intern Med 1994; 121: 855-9.        [ Links ]

7. HOLMES EC, ZHANG LQ, ROBERTSON P, CLELAND A, HARVEY E, SIMONDS P, LEIGH BROWN AJ. The molecular epidemiology of human immunodeficiency virus type-1 in Edinburg. J Infect Dis 1995; 171: 45-53.        [ Links ]

8. Community-level prevention of human immunodeficiency virus infection among high risk populations: The AIDS community demonstration projects. MMWR 1996; 45(RR-6): 1-16.        [ Links ]

9. OUSSERT-AJAKA I, LY TD, CHAIX ML, INGRAND D, SARAGOSTI S, COUROUCE AM ET AL. HIV-1/HIV-2 seronegativity in HIV-1 infected patients. Lancet 1994; 343: 1393-4.        [ Links ]

10. SCHABLEE C, ZEKENG L, PAU CP, HU D, KAPTUE L, GURTLER L ET AL. Sensitivity of United States HIV antibody tests for detection of HIV-1 group O infections. Lancet 1994; 344: 1333-4.        [ Links ]

11. WHO network for HIV isolation and characterization HIV type-1 variation in world health organization-sponsored vaccine evaluation sites: Genetic screening, sequence analysis and preliminary biological characterization of selected viral strains. AIDS Res Hum Retroviruses 1994; 10: 1327-43.        [ Links ]

12. JAVAHERIAN K, LANGLOIS AJ, MCDANAL C, ROSS KL, ECKLER LI, JELLIS CL ET AL. Principal neutralizing domain of the human immunodeficiency virus type 1 envelope protein. Proc Natl Acad Sci USA 1989; 86: 6768-72.        [ Links ]

13. HWANG SS, BOYLE TJ, LYERLY HK, CULLEN BR. Identification of the envelope V3 loop as the primary determinant of cell tropism in HIV-1. Science 1991; 253: 71-4.        [ Links ]

14. GRIMAILA RJ, FULLER BA, RENNERT PD, NELSON MB, HAMMARSKJOLD ML, POTTS B ET AL. Mutations in the principal neutralization determinant of human immunodeficiency virus type 1 affect syncytium formation, virus infectivity, growth kinetics, and neutralization. J Virol 1992; 66: 1875-83.        [ Links ]

15. Human retroviruses and AIDS 1998. Los Alamos National Laboratory, Los Alamos, New Mexico, 1998. (HIV sequence database. http://hiv-web.lanl.gov/).        [ Links ]

16. LOUWAGIE J, MCCUTCHAN FE, PEETERS M, BRENNAN TP, SANDERS-BUELL E, EDDY GA ET AL. Phylogenetic analysis of gag genes from 70 international HIV-1 isolates provides evidence for multiple genotypes. AIDS 1993; 7: 769-80.        [ Links ]

17. LECH WJ, WANG G, YANG YL, CHEE Y, DORMAN K, MC CRAE D ET AL. In vivo sequence diversity of the protease of human immunodeficiency virus type-1: Presence of protease inhibitor resistance variants in untreated subjects. J Virol 1996; 70: 2038-43.        [ Links ]

18. BARRIE KA, PÉREZ EE, LAMERS SL, FARMERIE WG, DUNN BM, SLEASMAN JW, GODENOW MM. Natural variation in HIV-1 protease, Gag p7 and p6, and protease cleavage sites within Gag/Pol polyproteins: Amino acid substitutions in the absence of protease inhibitors in mothers and children infected by human immunodeficiency virus type 1. Virology 1996; 219: 407-16.        [ Links ]

19. Joint United Nations Programme on HIV/AIDS (UNAIDS) and the World Health Organization (WHO). The AIDS epidemic update, December 1998.        [ Links ]

20. WARREN RQ, WONG MT, MELCHER GR, BLATT SP, CAHN P, PÉREZ H ET AL . Serologic evaluation of human immunodeficiency virus type-infected individuals from Argentina and the United States indicates a similar distribution of subgroup B isolates. J Clin Microbiol 1995; 33: 481-3.        [ Links ]

21. CABELLO A, CABRAL M, VERA ME, KIEFER R, AZORERO RM, EBERLE J ET AL. Analysis of the V3 loop sequences from 10 HIV type 1-infected AIDS patients from Paraguay. Aids Res Hum Retroviruses 1995; 11: 1135-7.        [ Links ]

22. QUIÑONES-MATEU ME, DOPAZO J, ESTE JA, ROTA TR, DOMINGO E. Molecular characterization of human immunodeficiency virus type-1 isolates from Venezuela. AIDS Res Hum Retroviruses 1995; 11: 605-16.        [ Links ]

23. LOUWAGIE J, DELWART EL, MULLINS JI, MCCUTCHAN FE, EDDY G, BURKE DS. Genetic analysis of HIV-1 isolates from Brazil reveals presence of two distinct genetic subtypes. AIDS Res Hum Retroviruses 1994; 10: 561-7.        [ Links ]

24. RAMOS A, TANURI A, SCHECHTER M, RAYFIELD MA, HU DJ, CABRAL MC ET AL. Dual and recombinant infections: An integral part of the HIV-1 epidemic in Brazil. Emerg Infect Dis 1999; 5: 65-74.        [ Links ]

25. ARTENSTEIN AW, COPPOLA J, BROWN AE, CARR JK, SANDERS-BUELL E, GALBARINI E ET AL. Multiple introductions of HIV-1 subtype E into the western hemisphere. Lancet 1995; 346: 1197-8.        [ Links ]

26. FIGUEROA F, PALACIOS A, RIVERO S, ODDÓ D, ROA I, HONEYMAN J ET AL. Chronic diarrhea due to Isospora belli and Kaposi’s Sarcoma in a male homosexual. Report of the 1st case of acquired immunodeficiency syndrome in Chile. Rev Med Chile 1985; 113: 772-9.        [ Links ]

27. Boletín Epidemiológico CONASIDA. Marzo de 1999. Ministerio de Salud de Chile.        [ Links ]

28. DESGRANGES C, FILLON S, LETOUNEUR F, BUZELAY L, SEPÚLVEDA C, GUZMÁN MA ET AL. HIV-1 subtypes in Santiago, Chile (letter). AIDS 1998; 12: 1563-5.        [ Links ]

29. DELWART EL, SHPAER EG, LOUWAGIE J, MC CUTCHAN FE, GREZ M, RUBSAMENT-WAIGMAN H, MULLINS JI. Genetic relationship determined by a DNA heteroduplex mobility assay: Analysis of HIV-1 env genes. Science 1993; 262: 1257-61.        [ Links ]

30. FELSENSTEIN J. PHYLIP (phylogeny inference package) version 3,5. 1993. Department of Genetics. University of Washington, Seattle.        [ Links ]

31. KIMURA M. A simple method for estimating the evolutionary rate of base substitutions through comparative studies of nucleotide sequences. J Mol Evol 1980; 16: 111-20.        [ Links ]

32. SAITOU N, NEI M. The neighbor joining method: a new method for reconstructing phylogenetic trees. Mol Biol Evol 1987; 4: 406-25.        [ Links ]

33. CONDRA JH, SCHLEIF WA, BLAHY OM, GABRUELKI LJ, GRAHAM DJ, QUINTERO JC ET AL. In vivo emergence of HIV-1 variants resistant to multiple protease inhibitors. Nature (London) 1995; 374: 569-71.        [ Links ]

34. HO DD, TOYOSHIMA T, MO H, KEMPF , NORBECK D, CHEN CM ET AL. Characterization of human immunodeficiency virus type 1 variants with increased resistance to a C2-symmetric protease inhibitor. J Virol 1994; 68: 2016-20.13.        [ Links ]

35. KAPLAN AH, MICHAEL SF, WEBBIE RS, KNIGGE MF, PAUL DA, EVERITT L, KEMPF DJ, NORBECK DW, ERICKSON J, SWANSTROM R. Selection of multiple HIV-1 variants with decreased sensitivity to an inhibitor of the viral protease. Proc Natl Acad Sci (USA) 1994; 91: 5597-601.        [ Links ]

36. OTTO MJ, GARBER S, WINSLOW DL, REID CD, ALDRICH P, JADHAV PK, PATTERSON CE, HODGE CN, CHENG YS. In vitro isolation and identification of human immunodeficiency virus (HIV) variants with reduced sensitivity to C-2 symmetrical inhibitors of HIV type 1 protease. Proc Natl Acad Sci (USA) 1993; 90: 7543-7.        [ Links ]

37. POTTS KE, KALISH ML, LOTT T, ORLOFF G, LUO CC, NERNARD MA ET AL. Genetic heterogeneity of the V3 region of the HIV-1 envelope plycoprotein in Brazil. AIDS 1993; 7: 1191-7.        [ Links ]

38. LI Y, LOU L, RASOOL N, KANG CY. Glycosylation is necessary for the correct folding of human immunodeficiency virus gp120 in CD4. J Virol 1993; 67: 584-8.        [ Links ]

39. MOHRI H, SINGH MK, CHING WT, DD Ho. Quantitation of zidovudine-resistant human immunodeficiency virus type 1 in the blood of treated and untreated patients. Proc Natl Acad Sci (USA) 1993; 90: 25-9.        [ Links ]