SciELO - Scientific Electronic Library Online

 
vol.127 número8Resistencia a antimicrobianos en diferentes biotipos de Acinetobacter baumannii aislados en el norte de ChileEl gen tax del virus linfotrópico humano tipo I en la identificación etiológica de la paraparesia espástica tropical: Estudio clínico, serológico y de polimerasa en cadena en 72 pacientes índice de autoresíndice de materiabúsqueda de artículos
Home Pagelista alfabética de revistas  

Revista médica de Chile

versión impresa ISSN 0034-9887

Rev. méd. Chile v.127 n.8 Santiago ago. 1999

http://dx.doi.org/10.4067/S0034-98871999000800007 

EXPERIENCIAS CLÍNICAS

Leucemia linfoma T del adulto en
Chile. Estudio clínico-patológico y
molecular de 26 pacientes

Adult T cell leukemia lymphoma in
Chile. A clinico pathological and
molecular study of 26 patients

M Elena Cabrera C, Silvia Labra G1, Pedro Meneses C,
Estella Matutes, Luis Cartier R, Anthony M Ford2 y Melvyn
F Greaves3

Background: Adult T cell leukemia lymphoma is a lymphoproliferative syndrome etiologically associated to human T cell lymphotropic virus type I. Aim: To describe the clinical and laboratory features of 26 Caucasian Chilean patients, with HTLV-I positive adult T-cell leukemia lymphoma (ATLL). Material and methods: Diagnostic criteria included clinical features, cell morphology, immunophenotype, HTLV-I serology and/or DNA analysis by Southern blot or PCR. Results: According to the clinical presentation, 12 cases had the acute ATLL form, 6 had a lymphoma, 4 the chronic form and 4 had smoldering ATLL. The median presentation age was 50 years, younger than the Japanese patients, but significantly older than patients from other South American countries (eg Brasil, Jamaica, Colombia). The main clinical features: lymphadenopathy, skin lesions and hepatosplenomegaly, were similar in frequency to those of patients from other countries, except for the high incidence of associated neurological disease. Tropical Spastic Paraparesis (TSP) in our series of ATLL, was seen in one third of the patients (8/26). A T-cell immunophenotype was shown in all 26 cases and HTLV-I serology was positive in 25/26 patients. Molecular analysis on the seronegative patient showed clonal integration of proviral HTLV-I DNA into the lymphocytes DNA, and thus he may have been a poor responder to the retroviral infection. Proviral DNA integration was also demonstrated in 15/16 patients being clonal in 10, polyclonal in 3 (all smoldering cases) and oligoclonal in one. Conclusions: ATLL in Chile has similar clinical and laboratory features than the disease in other parts of the world, except for a younger age than Japanese patients but older than those from other Latin American countries and a high incidence of patients with associated TSP. Detailed morphological and immunophenotypic analysis of the abnormal circulating lymphocytes, together with the documentation of HTLV-I by serology and/or DNA analysis are key tests for the identification of this disease.
(Key Words: Human T-cell Leukemia Lymphoma; HTLV-I antibodies; Immunophenotype)

Recibido el 9 de diciembre, 1998. Aceptado en versión corregida el 15 de junio, 1999.
Sección Hematología, Servicio y Departamento de Medicina, Facultad de Medicina, Universidad de Chile, Hospital del Salvador, Santiago de Chile. Sección Hematología, Servicio Medicina y Banco de Sangre, Hospital Van Buren, Valparaíso. The Royal Marsden Hospital, Londres, Inglaterra. Servicio y Departamento de Neurología, Hospital del Salvador, Santiago de Chile. Institute of Cancer Research, Londres, Inglaterra.
1 Tecnólogo Médico; 2 Bioquímico; 3 PhD, MRCPath

 

La leucemia/linfoma T del adulto (LLTA) es un síndrome linfoproliferativo T etiológicamente asociado al virus linfotrópico T humano tipo 1 (HTLV-I). Se han descrito 4 modalidades clínicas1: 1) leucemia, subtipo agudo caracterizado por un curso agresivo, presencia de células pleomórficas de estirpe T madura y frecuente compromiso cutáneo, organomegalia e hipercalcemia; 2) linfoma, también de curso agresivo pero sin evidencia de un cuadro leucémico y menor incidencia de hipercalcemia; 3) crónica, caracterizada por lesiones cutáneas y linfocitosis T, que suele mantenerse estable durante meses o años y 4) latente o "smoldering", generalmente asintomática o bien con manifestaciones cutáneas y/o pulmonares que frecuentemente se catalogan erróneamente como lesiones "inespecíficas" y recuentos en sangre periférica normales. Aunque la LLTA se describió originalmente en Japón2 y en el Caribe3, posteriormente se describieron casos en varios países latinoamericanos en especial Brasil, Colombia, Perú, Argentina y en emigrantes de origen afro-caribeño a Europa y Estados Unidos4-11. En Chile, el primer caso de LLTA en su modalidad aguda se documentó en 1985, pero sin confirmación virológica12 y posteriormente se publicó el caso de un chileno, oriundo de Valparaíso, que residía en España13. En la década del 90, nuestro grupo documentó 4 casos con leucemia/linfoma y compromiso neurológico asociado14,15, así como 9 casos de LLTA16.

En este estudio referimos nuestra experiencia de la patología neoplásica asociada al retrovirus humano HTLV-I en Chile, describiendo los datos clínicos y de laboratorio en 26 pacientes diagnosticados de LLTA entre 1989 y 1998, las bases diagnósticas de la LLTA y la importancia de su identificación, por su significado pronóstico, patogénico, epidemiológico y preventivo.

MATERIAL Y MÉTODO

Pacientes. Se incluyen 26 pacientes con LLTA estudiados en el Laboratorio de Hematología del Hospital del Salvador, entre 1989 y 1998. El diagnóstico se realizó en base a las características clínicas y de laboratorio, serología para el virus HTLV-I y análisis de ADN, documentando la presencia de secuencias específicas del HTLV-I en las células neoplásicas. Los frotis de sangre periférica y/o médula ósea así como la citología ganglionar fueron revisados por 2 de los autores (MECC y EM) en todos los pacientes y la histología del tejido afectado en 12 de los mismos.

Inmunofenotipo. Las células mononucleares aisladas de sangre periférica, médula ósea o líquidos corporales mediante Ficoll-Hypaque, fueron estudiadas con un panel de anticuerpos monoclonales (Ac Mo) no conjugados mediante inmunofluorescencia indirecta, usando una inmunoglobulina (Ig) de cabra anti-ratón conjugada con fluoresceína isotiocianato (FITC, Ortho Diagnostics) como segunda capa, para visualizar las células positivas. La reactividad con el Ac Mo fue evaluada en un microscopio de inmunofluorescencia Leitz Laborlux K y el marcador se consideró positivo si un porcentaje >20% de las células mostraba reactividad con el anticuerpo respectivo. Se utilizó como control una Ig inespecífica de ratón (Southern Biotechnology Associates, SBA) en sustitución del Ac Mo. El panel de anticuerpos (no conjugados) fue el siguiente: HLA-DR, CD10, CD19, CD20, CD2, CD3, CD7, CD34 (Becton Dickinson, CA, USA); CD1, CD4, CD8, CD5, CD25 (Dako, Dinamarca); Ig sup (Ig cabra antihumano IgM-FITC, Kallestad y SBA); anti-Kappa FITC y anti-Lambda FITC (Dako, Dinamarca).

Detección de HTLV-I. a) Serología. Los anticuerpos para HTLV-I en el suero fueron investigados mediante técnica de ELISA (Biotech Research Laboratories) y por el método de aglutinación de partículas (AP) (Serodia, Fujirebio, Japón). b) ADN proviral. El estudio del HTLV-I proviral se realizó mediante 2 técnicas: b1. Southern blot en células mononucleares de sangre periférica (descrita previamente15). En suma, se digirió 5 ug de ADN con PST I para mostrar la presencia de las sequencias env-pol del virus o con EcoRI para mostrar la integración (clonalidad) del virus. Se realizó luego una electroforesis en agarosa 0,7%, transferido a nitrocelulosa Hybond N+ (Amersham) e hibridizado a la sonda pCH1 para el gen env-pol del HTLV-I de 2,3 kb (donación de M Reitz).

b2. Reacción de polimerasa en cadena (PCR) en tejidos fijados en parafina. El ADN se extrajo de un corte de tejido colocado en un portaobjeto, sobre el cual se colocó una pequeña porción (50 ul) de un tubo con 200 ul de TaKaRa Dexpat (BioWhitaker UK, Workinham), preincubado a 100ºC y luego retirado con la punta de una micropipeta. La mezcla se llevó al tubo preincubado y fue incubado por 10 min más. Los tubos fueron centrifugados por 10 min a 12000 rpm a 4ºC y se recuperó el sobrenadante. Después se efectuó el análisis de PCR. La amplificación se realizó en un volumen final de 25 ul de lo siguiente: buffer x 1 (50 mM KCl, 10 mM Tris Cl (ph 8,3), 1,5 mM MgCl2, 0,1% gelatina), 250 uM dNTPs y 10 pmol, cada partidor (o "primer") y 1 unidad de Amplitaq polimerasa ADN (Perkin Elmer, Warrington UK). El PCR doble (o "nested PCR") se realizó en un sistema GeneAmp PCR 2400, bajo las siguientes condiciones: después de desnaturalizar por 1 min a 94ºC, se realizó el primer ciclo de desnaturalización, hibridización y copia por 45 s a 94ºC, 30 s a 50ºC, 45 s a 72ºC respectivamente y luego por 30 ciclos. Dos ul del producto del primer ciclo, se sometió a una segunda reacción de PCR igual como se describió más arriba, también por 30 ciclos. Diez ul del producto del 2º ciclo fue analizado por electroforesis en un gel de agarosa 2% y las bandas visualizadas con tinción de bromuro de etidio. Los partidores y las sequencias de partidores utilizados, donadas por el Prof. T Schulz, fueron las siguientes:

1ª vuelta de PCR:

LTR101; 5'TTCCYAGGRTTTGGACAGAG 3'
(donde Y = C ó T, R = A ó G)
LTR102; 5'GGGTAAGGACCTTGAGGGTC 3'

2ª vuelta de PCR:

LTR103; 5'CGGATACCCAGTCTAGGT 3'
LTR104; 5'GAGCCGATAACGCGTCCATCG 3'

RESULTADOS

Características clínicas, morfológicas e histológicas. Las principales características clínicas se describen en la Tabla 1. Todos eran chilenos y no habían viajado fuera del país. La mayoría residía en Santiago, 3 provenían del Norte Grande (Antofagasta e Iquique), 4 de la V Región (Valparaíso) y 2 del Norte Chico (La Serena). Cuatro pacientes habían sido transfundidos 5, 17, 21 y 25 años antes del diagnóstico de LLTA y 9 tenían antecedentes de infecciones oportunistas recurrentes, como neumonía por Pneumocistis carinii, por Hemophilus influenza, candidiasis orofaríngea, diarrea por Isospora belli, giardiasis recidivante. El promedio de edad fue de 50 años (rango 24-78) y existía igual número de varones y mujeres. Las modalidades clínicas de LLTA fueron las siguientes: aguda 12 (46%), linfoma 6 (23%), crónica 4 (15%), y latente o "smoldering" 4 (25%). Dos pacientes con la forma crónica y 2 con linfoma, manifestaron una agudización en su curso evolutivo.

Tabla 1. Características clínicas y de laboratorio de 26 casos de LLTA

Caso
Sexo/edad
Adeno-
patía
Hepatoesple-
nomegalia
Piel Leucocitos
(x109/1)
% Linfocitos Sobrevida
meses

1 M/51 + + + + +   25 90 4
2 F/66 - - -   36 94 3
3 F/59 + + + +  +* 48 50 3
4 M/43 - - -   44 62 5
5 M/41 - + +  +* 224   73 2
6 F/78 - - -   24 52 2
7 M/43 + + + -   26 56 3
8 F/73 + + + -   18 20 1
9 F/52 + - -   61 85 15  
10 M/48 + + + + +   29 42 2
11 F/34 + + + + +     9 34 2+  
12 F/62** + + + + 89 77 1
13 F/24 + + + + +   28 90 20  
14 M/52 - - -   18 71 18  
15 M/63** + - +*   8 60 16+  
16 F/51 - - -   16 43 1+ 
17 M/36 + + - -     5 25 8
18 M/39** + + + + +* 12 49 48  
19 M/27 - - -   15 57 54+  
20 F/53** + + + + -     4 28 60+  
21 F/63 + + +   11 46 5
22 M/53 + + + -     7 27 7
23 M/64** + - +* 14 15 60  
24 F/50 - - +     8 26 53+    
25 F/50** + - +   10 20 120    
26 M/32** + - +* 12 40 144+      

* Eritrodermia generalizada; ** LLTA + TSP
Casos 1-12 forma aguda, 13-16 crónica, 17-22 linfoma y 23-26 latente

Adenopatías, hepatoesplenomegalia y/o afectación cutánea fueron observadas en más de la mitad de los casos. El compromiso cutáneo se manifestó en forma de lesiones maculopapulares o nodulares en 7 pacientes y eritrodermia generalizada en los 5 restantes. Ocho pacientes (31%) presentaron un cuadro neurológico, que fue catalogado como característico de paraparesia espástica en 7 de ellos. El diagnóstico de LLTA y paraparesia se realizó simultáneamente en 3 de estos pacientes, en otros 2 la leucemia precedió por 1 y 7 años a las manifestaciones de paraparesia y en los 2 restantes la paraparesia precedió en 9 y 3 años a la leucemia, aguda y crónica respectivamente. El último paciente había recibido una transfusión 2 años antes del inicio de la paraparesia. Otras manifestaciones clínicas incluyeron: compromiso hepático con ictericia (4 casos), pulmonar (1 caso), intestino delgado (1 caso), parótida (1 caso), cerebro y meninges (1 caso).

La morfología de los linfocitos de sangre periférica fue la clave orientadora en los casos leucémicos (Figura 1). La mayoría de ellos poseían un tamaño variable y núcleo bi o polilobulado; un pequeño porcentaje de células eran de mayor tamaño, citoplasma basófilo y poseían 1 ó 2 nucléolos, rasgos que se observan en inmunoblastos. La médula ósea no estaba infiltrada en 12 de 19 casos estudiados y en 7 se documentó una infiltración linfocitaria poco marcada con hematopoyesis relativamente conservada. El estudio histológico del ganglio mostró infiltración por células linfoides atípicas con un patrón mixto difuso en 6 casos, pleomórfico en 3, de célula grande o inmunoblasto en 3 (Figura 2), predominio de células anaplásicas tipo Hodgkin en 2, y de células pequeñas hendidas en las dos restantes. La biopsia cutánea mostró infiltración dérmica linfoide por células de núcleo convoluto en dos casos y en otros 4, se evidenció junto a la infiltración dérmica, epidermotropismo con formación de microabcesos de Pautrier (Figura 3).

FIGURA 1. Frotis de sangre periférica de una paciente con LLTA aguda (caso 2), mostrando linfocitos leucémicos con núcleo irregular, polilobulado o en flor (flechas), característico de esta enfermedad (tinción Mary Grunwald Giemsa x 1000).


FIGURA 2. Corte histológico de un ganglio de un paciente con LLTA agudo (caso 11) mostrando infiltración difusa por células grandes con irregularidad nuclear, algunas de ellas, con nucléolo prominente (flechas) (tinción Hematoxilina eosina x 1100).


FIGURA 3. Corte histológico de una biopsia de piel de un paciente con LLTA crónico y compromiso cutáneo (caso 15), que demuestra una infiltración linfocitaria en la dermis y evidencias de epidermotropismo, con formación de microabscesos de Pautrier en la epidermis (flechas) (tinción Hematoxilina eosina x 1100).


Los pacientes fueron tratados con diferentes esquemas de quimioterapia que se refieren a continuación. Sólo 4 con la forma de LLTA aguda no recibieron tratamiento, por la gravedad del caso (casos 2, 5 y 7) o diagnóstico post mortem (caso 8). Los restantes recibieron: CHOP (ciclofosfamida 750 mg/m2, doxorrubicina 50 mg/m2, vincristina 1,4 mg/m2, prednisona 100 mg) 3-6 ciclos en 9 casos, sólo prednisona en 8 casos, C-MOPP (ciclofosfamida 650 mg/m2, vincristina 1,4 mg/m2, procarbazina 100 mg/m2, prednisona 40 mg/m2) 8 ciclos en 1 caso, ProMACE-CytaBOM (prednisona 60 mg/m2, metotrexato 1500 mg/m2, rescate con leucovorina, adriamicina 25 mg/m2, ciclofosfamida 650 mg/m2, etopósido 120 mg/m2, citarabina 300 mg/m2, bleomicina 5 mg/m2, Oncovin 1,4 mg/m2, metotrexato 120 mg/m2) en 1 y clorambucil en 2 (10 mg/m2 por 5 días, mensual por 2 años en caso 19 y 4 mg/día continuo por 1 año en caso 15). La respuesta de los pacientes con la forma de LLTA aguda, fue escasa y transitoria. En cambio todos los pacientes con linfoma respondieron a quimioterapia, dos alcanzando una remisión completa y cuatro una remisión transitoria o parcial. En 3 pacientes, 2 de forma aguda y 1 linfoma, cuya respuesta fue transitoria con esquema CHOP o ProMACE-CytaBOM, se realizó quimioterapia con esquema ESHAP (etopósido 80 mg/m2, cisplatino 25 mg/m2, citarabina 2 g/m2, metilprednisolona 500 mg), fracasando en los 3 casos. La quimioterapia fue bien tolerada, sin necesidad de reducir dosis. Se observó sólo una sepsis a E coli durante la quimioterapia C-MOPP, resuelta favorablemente. La mayor dificultad fue la resistencia a la quimioterapia de los pacientes con la forma aguda o la refractariedad de la hipercalcemia en la recidiva. La sobrevida de los pacientes con la modalidad aguda de LLTA fue de 4 meses (<1-15 meses) y todos han fallecido. En la forma linfoma de LLTA, la media de supervivencia fue de 33 meses, hallándose dos pacientes vivos y en remisión completa a los 5 y 6 años del diagnóstico, los que fueron tratados con C-MOPP y clorambucil respectivamente. En la LLTA crónica, la supervivencia fue de 15 meses, uno se halla vivo con enfermedad cutánea activa a los 20 meses y otro recién diagnosticado bajo tratamiento. En la forma smoldering o latente, la sobrevida fue de 8 años, y dos pacientes están vivos a los 4 y 12 años, con enfermedad activa. Por lo tanto, la respuesta al tratamiento de nuestros pacientes estuvo más bien relacionada con la forma clínica de LLTA, que con el esquema de quimioterapia utilizado.

La causa de muerte más frecuente en las formas de LLTA aguda y linfoma fue la hipercalcemia refractaria a tratamiento, insuficiencia renal, infección de lesiones cutáneas generalizadas o insuficiencia hepática fulminante. Dos de 4 pacientes con la forma crónica se agudizaron y en la forma latente, los dos pacientes fallecidos sucumbieron a consecuencia de infecciones respiratorias intercurrentes.

Inmunofenotipo. El estudio mostró un fenotipo T maduro en los 26 casos, con expresión de CD3 en 19 de 21 y CD2 en dos tercios de los casos (Tabla 2). Las células en 16 de 19 pacientes poseían un fenotipo CD4+/CD8-, en 2 ambos marcadores fueron negativos y en el restante las células coexpresaban CD4/CD8. El CD25 fue positivo en 8 de 14 casos y las células de 7 de 19 expresaron HLA-DR. Las células de todos los casos fueron negativas para los marcadores de línea B (CD19 e Ig de superficie). Por consiguiente, el inmunofenotipo en la mayoría de los casos fue el que se observa con mayor frecuencia en la LLTA, correspondiendo a un linfocito T activado CD4+, CD8- con expresión de receptores para la Interleukina-2 (CD25+) y HLA-DR+. El estudio inmunohistológico de tejidos afectados en cuatro pacientes (casos 8, 18, 19, 20), demostró la expresión de CD45 RO (UCHL1) en la mayoría de las células linfoides y fue negativo en las células anaplásicas tipo Hodgkin en dos de ellos (casos 18 y 20). El CD20 fue negativo en los cuatro casos.

Tabla 2.- Marcadores inmunológicos y HTLV-I en 24 pacientes con LLTA

Caso
Marcadores T
Marcadores de
Serología
ADN
 
activación
HTLV-I
  CD2 CD3 CD4 CD8 CD7 CD5
DR
CD25
Elisa
Pa
 

1 0 86 99 0 0 NE 0 NE + + + + clonal
2 97 29 5 2 0 NE 21 37 + + + clonal
3 0 84 96 0 0 NE 0 0 + + + NE
4 0 95 94 6 0 NE 0 NE neg neg clonal
5 0 82 NE NE 0 NE 5 NE + + + + NE
6 96 95 97 0 0 90 1 0 NE + + oligoclonal
7 0 7 96 6 0 NE 43 NE + + + + policlonal
8 0 78 76 70 0 78 70 65 + + + + clonal
9 99 96 96 2 0 91 4 90 + + + + NE
10 40 38 80 0 3 87 2 3 + + + + NE
11 33 61 90 2 5 40 NE 78 + + + + NE
12 98 98 36 1 2 54 0 13 + + + + NE
13 NE 81 73 8 0 NE 0 NE + + + + clonal
14 80 98 90 0 4 NE 55 NE + + clonal
15 NE 77 78 17 75 88 66 70 + + + + NE
16 37 71 0 0 26 3 28 0 + + NE
17* 98 96 NE NE 40 96 0 90 + + + + clonal
19 96 96 97 0 43 94 95 92 + + + + clonal
22 35 69 94 15 17 63 18 47 + + + + NE
23 NE 94 80 16 46 NE NE NE + + + + policlonal
24 50 18 40 3 50 70 2 2 + + + NE

NE = no estudiado; * ascitis. Todos los casos tenían marcadores B negativos. Se observa que el inmunofenotipo predominante fué CD4+, CD8- y frecuentemente CD25+ y HLA DR+. Los casos que no aparecen en la tabla son los siguientes: Caso 18: linfoma T con TSP sero positivo, HTLV-I (-) por PCR en tejidos. Caso 20: linfoma con células tipo Hodgkin sero positivo y HTLV-I intensamente (+) por PCR en ganglio y bazo, el que se observa en la figura 4 con las iniciales RP. Caso 21: linfoma T seropositivo con lesiones extensas en la piel. Caso 25: leucemia latente con ADN viral policlonal en linfocitos periféricos y portadora de TSP y caso 26: leucemia latente con ADN viral clonal en linfocitos de sangre periférica y portador de TSP.

Estudio de HTLV-I. Se detectaron anticuerpos anti- HTLV-I en el suero de todos excepto un paciente mediante ELISA y AP. El análisis molecular mediante Southern blot, demostró la integración de ADN proviral en las células leucémicas de todos los casos estudiados, incluyendo el caso seronegativo. La integración proviral fue clonal en 9 de 13 (casos 1, 2, 4, 8, 13, 14, 17, 19, 26), policlonal en 3 (casos 7, 23 y 25), dos de estos últimos portadores de la forma latente con manifestaciones cutáneas y oligoclonal en otro (caso 6). El análisis mediante PCR y nested PCR con sondas que detectan secuencias específicas para el HTLV-I, mostró la presencia de éstas en todos los órganos estudiados, como ganglio, hígado, riñón, bazo y duodeno (Figura 4) en 3 de 4 pacientes (casos 8, 19 y 20). El análisis del caso 18 (Figura 4) no mostró secuencias virales en los órganos estudiados. El estudio serológico familiar en 12 pacientes, demostró la presencia de miembros seropositivos en 15 de 22 familiares sanos (68%). Estos correspondieron al esposo de los casos 3, 9, 11, 20 y 21, la esposa de los pacientes 7 y 22, 6 de 10 hijos de madres con leucemia y la madre de las pacientes 11 y 13. Los individuos seronegativos correspondieron a las esposas de los pacientes 4, 15 y 17. El esposo de la paciente N¼ 20 desarrolló una paraparesia espástica HTLV-I (+), mientras que no se han manifestado otros procesos derivados de la infección por HTLV-I, en los restantes individuos portadores.


FIGURA 4. Análisis de PCR para detección de frecuencias HTLV-1 proviral, usando partidores descritos en el texto (ver Material y Método) donación del Prof. T. Schulz. El ADN se obtuvo de muestra de tejido fijado en parafina., como se describe en dicha sección. MA (caso 8) muestra intensa positividad en bazo (S), hígado (L), riñón (K), ganglio (N). C es un control negativo de un paciente con leucemia mieloide aguda. RP (caso 20) muestra intensa positividad en gangio (N) y débil en bazo (S) y negatividad en hígado (L). CP (caso 18) muestra negatividad en pulmón (L) y ganglio (N). El ADN aislado de un paciente conocido como portador del virus (Cartier et al15) se usó como cntrol positivo (no se muestra). El tamaño es en pares de bases (bp).

 

DISCUSIÓN

Este estudio demuestra que la LLTA es un proceso linfoproliferativo T maduro que incide en la patología neoplásica linfoide en Chile y que es importante tener presente para diferenciarlo del resto de los procesos linfoproliferativos. La importancia de su detección radica en el pronóstico ominoso de las modalidades de LLTA aguda y de la mayoría de las formas de linfomas, y también por las implicancias epidemiológicas, debido a su asociación etiopatogénica a un agente viral. Las características clínicas y de laboratorio en nuestros pacientes con LLTA son similares a las descritas en Japón, Caribe y en otros países sudamericanos, a excepción de la edad de presentación que en Chile fue intermedia entre la observada en los japoneses y en el Caribe o inmigrantes del Caribe a Inglaterra y/o en los restantes países sudamericanos. Mientras que en nuestro grupo de pacientes la edad promedio fue de 50 años, en Japón es de alrededor de los 5917, y en el resto de Sudamérica entre 38 y 434-9. Asimismo destacó la elevada asociación de TSP y LLTA, la más elevada que se ha documentado en la literatura. Se desconoce si ello está asociado con factores genéticos y/o ambientales, o bien es resultado de un cuidadoso examen de los pacientes afectos de TSP.

El diagnóstico de LLTA se sospechó en la mayoría de los pacientes por la morfología celular, combinado con la evidencia de un inmunofenotipo T maduro. En los linfomas, el diagnóstico planteó más problemas y fue necesario realizar técnicas de laboratorio más especializadas para su diagnóstico. Entre las técnicas confirmatorias claves, destacaron la serología para la detección de anticuerpos anti-HTLV-I y estudios moleculares que permitieron demostrar la integración del HTLV-I en el ADN de las células leucémicas y/o en cortes histológicos de tejidos, incluyendo la técnica de PCR cuando las muestras son escasas o existen dudas diagnósticas. En dos de los casos de LLTA crónica, que manifestaron la enfermedad con lesiones cutáneas polimorfas e infecciones recurrentes, junto a la presencia de linfocitos anormales en sangre periférica, el diagnóstico se realizó de forma retrospectiva en la fase de agudización. Los casos latentes, que en general plantean mayores dificultades diagnósticas, fueron identificados en 3 pacientes portadores de TSP y lesiones cutáneas con presencia de una proporción mínima de linfocitos atípicos (1-5%) en sangre periférica y en otro portador sólo de lesiones cutáneas persistentes. En el caso 18, no fue posible detectar ADN proviral con las técnicas de PCR utilizadas, a pesar de tener una paraparesia espástica HTLV-I (+) y un cuadro característico de una LLTA tipo linfoma, con adenopatías generalizadas, compromiso pulmonar y lesiones cutáneas generalizadas. La biopsia ganglionar de este paciente mostró infiltración difusa por células linfoides medianas y grandes CD45 RO (UCHL1) positivas y CD20 negativas y presencia de células"tipo Hodgkin", que fueron negativas para CD45 RO. Es probable que en este caso un retrovirus defectuoso y por tanto no detectable en tejidos con las sondas disponibles, fuese el responsable de ambos cuadros.

El estudio epidemiológico familiar, mostró una alta incidencia de seropositividad en familiares cercanos a los pacientes, alcanzando a un 68%, mayor que en otros estudios, en los que oscila entre 17-40%18,19. Respecto de las vías de transmisión del HTLV-I, nuestro estudio sustenta que las 3 vías de transmisión descritas se hallan involucradas: de madre a hijo a través de células infectadas en la leche materna, la que se considera la principal ruta de infección y que presenta el más alto riesgo de desarrollo de LLTA; sexual de esposo a esposa y vice-versa (pricipalmente a través de células del semen infectadas) y por transfusión. Esta última vía explica el caso 15, quien desarrolló una paraparesia espástica previo a la manifestación de la LLTA. El desarrollo de una leucemia/linfoma post transfusional es un hecho excepcional20,21, a diferencia de la paraparesia, en la que alrededor de un tercio de los pacientes tienen el antecedente de una transfusión22. El nivel de seroconversión en receptores de componentes sanguíneos celulares infectados por HTLV-I es elevada, y fluctúa entre 20-63%23. Una explicación para el hecho de observar el desarrollo de una leucemia post transfusional en forma tan excepcional, es el largo período de latencia, varias décadas, necesarios entre la infección primaria y la transformación maligna. En cambio el período de latencia para el desarrollo de paraparesia es de alrededor de 3 años solamente.

Los tratamientos utilizados están basados en: combinación de fármacos citotóxicos, inmunoterapia dirigida contra la interleukina 2 (IL-2) y la combinación de azidotimidina (AZT) e interferon alfa. Generalmente se obtiene una respuesta inicial, sin embargo las recidivas son muy frecuentes. La poliquimioterapia convencional es el tratamiento de elección para las formas aguda y linfomatosa de ATL. Sin embargo, la mayoría de los pacientes recaen a corto plazo, con una sobrevida inferior al 5% a los 4 años, en Japón como en otros lugares del mundo. Estos pacientes expresan altas concentraciones de IL-2 en el suero, así como en las células T malignas, a diferencia de las células T normales que no la expresan. Por este motivo se han intentado diversas estrategias, utilizando anticuerpos monoclonales anti-Tac, conjugados o no conjugados, dirigidos a eliminar las células T activadas anormalmente o las células leucémicas que expresan IL-2. Estos tratamientos parecen prometedores24. Por otra parte están en curso esquemas que combinan AZT e interferon, con resultados esperanzadores, aunque no confirmados a largo plazo25. Esta forma de tratamiento es más efectiva en la variedad aguda de ATL; sin embargo es de escasa eficacia en el tipo linfomatoso. En las variedades crónica y smoldering, puede reducir la inmunodepresión y prevenir la progresión hacia formas más agresivas de ATL.

Una medida preventiva que ya ha dado sus frutos, fue la implementada en Japón, al reducir la lactancia en madres infectadas por HTLV-I. El riesgo de transmisión vertical se redujo de 20 a 4% cuando la lactancia materna fue menor a 6 meses, período en que el niño probablemente está protegido por anticuerpos maternos26. Por último está en estudio el desarrollo de vacunas, que podrían ser efectivas en mujeres embarazadas infectadas por el HTLV-I, para inducir un mayor número de anticuerpos maternos y reducir la transmisión vertical del virus. Respecto a la prevención de la infección por vía sexual, la vacunación de mujeres adolescentes en zonas endémicas, podría prevenir la transmisión sexual del virus, más frecuente en sentido hombre a mujer y también podría romper el siguiente ciclo de transmisión vertical27.

En resumen, este estudio confirma la literatura precedente, acerca de la incidencia de la LLTA, HTLV-I (+) en nuestro medio, destacan las principales similitudes y diferencias con aquellas observadas en otras regiones endémicas, así como la problemática diagnóstica y las pruebas de laboratorio que deben aplicarse para su detección.

Agradecimientos
A los médicos hematólogos que confiaron en nuestro laboratorio y enviaron sus datos clínicos y muestras para su estudio. A la Dra. Rachel Pawson por sus valiosos comentarios sobre técnica de PCR.

Correspondencia a: Dra Maria Elena Cabrera C. Departamento de Medicina Interna, Facultad de medicina, Campus Oriente. Universidad de Chile, Santiago. Teléfono 3404347, Fax 2252031.

REFERENCIAS

1. SHIMOYANA M AND MEMBERS OF THE LYMPHOMA STUDY GROUP (1984-87). Diagnostic criteria and classification of clinical subtypes of adult T-cell leukaemia-lymphoma. Br J Haematol 1991; 79: 428-37.        [ Links ]

2. UCHIYAMA T, YODOI J, SAGAWA K, TAKATSUKI K, UCHINO H. Adult T-cell leukemia: clinical and hematologic features of 16 cases. Blood 1977; 50: 481-92.        [ Links ]

3. BLATTNER WA, KALYNARAMA VS, ROBERT-GUROFF M, LISTER TA, GALTON DAG, SARIN PS ET AL. The human type-C retrovirus, HTLV, in blacks from the Caribbean region and relationship to adult T-cell leukemia/lymphoma. Int J Cancer 1982; 30: 257-64.        [ Links ]

4. GIBBS WN, LOFTERS WS, CAMPBELL M, HANCHARD B, LAGRENADE L, CRANSTON B ET AL. Non-Hodgkin lymphoma in Jamaica and its relation to Adult T-cell leukamia-lymphoma. Ann Intern Med 1987; 106: 361-84.        [ Links ]

5. MANNS A, CLEGHORN FR, FALK RT, HANCHARD B, JAFFE ES, BARTHOLOMEW C ET AL. Role of HTLV-I in development of non-Hodgkin lymphoma in Jamaica and Trinidad and Tobago. The Lancet 1993; 342: 1447-50.        [ Links ]

6. POMBO DE OLIVEIRA MS, MATUTES E, SCHULTZ T, CARVALHO SM, NORONHA H, REAVES JD ET AL. T-cell malignancies in Brasil. Clinico-pathological and molecular studies of HTLV-I positive and negative cases. Int J Cancer 1995; 60: 823-7.        [ Links ]

7. BLANK A. Adult T-cell leukemia/lymphoma in Southwest Colombia. HTLV, Truths and Questions. Edit Zaninovic 1996; 266-71.        [ Links ]

8. RODRÍGUEZ W, MISAD O, GARCÍA J, CASTRO DE LA MATTA, VALLEJOS C, CASANOVA L ET AL. Síndrome leucemia/linfoma T del adulto (ATL) en el Perú. Acta Cancerológica 1994; 3: 7-20.        [ Links ]

9. GIOSEFFI ON, NUCIFORA E, FANTL D, DUFOUR C, MILONE J, DI PAOLO HD. Leucemia-linfoma T del adulto HTLV-I positiva en Argentina. Sangre 1995; 40: 421-4.        [ Links ]

10. CATOVSKY D, GREAVES MF, ROSE M, GALTON DAG, GOOLDEN AWG, McCLUSKEY DR ET AL. Adult T-cell lymphoma leukaemia in blacks from West Indies. Lancet 1982; i: 639-43.        [ Links ]

11. BUNN PA, SCHECHTER GP, JAFFE E, BLAYNEY D, YOUNG RC, MATHEWS MT ET AL. Clinical courses of retrovirus-associated adult T-cell lymphoma in the United States. N Engl J Med 1983; 309: 257-64.        [ Links ]

12. PEREIRA J, LIRA P, GREBE G, ROA I. Leucemia/linfoma del adulto. Rev Méd Chile 1985; 113: 41-4.        [ Links ]

13. MONTSERRAT E, LOZANO M, URBANO-ISPIZUA A, MATUTES E, FELIU E, ERCILLA G ET AL. Adult T-cell leukemia in a Chilean resident in Spain: long-lasting remission after 2-deoxycoformycin treatment. Leuk Lymphoma 1989; 1: 47-9.        [ Links ]

14. CABRERA ME, GRAY AM, CARTIER L, ARAYA F, HIRSH T, FORD AM, GREAVES MF. Simultaneous adult T-cell leukemia/lymphoma and sub-acute polyneuropathy in a patient from Chile. Leukemia 1991; 5: 350-3.        [ Links ]

15. CARTIER L, CASTILLO JL, CABRERA ME, ARAYA F, MATUTES E, FORD AM, GREAVES MF. HTLV-I positive progressive spastic paraparesis (TSP) associated with a lymphoid disorder in three chilean patients. Leukemia and Lymphoma 1995; 17: 459-64.        [ Links ]

16. CABRERA ME, LABRA S, CATOVSKY D, FORD AM, COLMAN SM, GREAVES MF, MATUTES E. HTLV-I positive adult T-cell leukaemia/lymphoma (ATLL) in Chile. Leukemia 1994; 8: 1763-7.        [ Links ]

17. YAMAGUCHI K. Human T-lymphotropic virus type in Japan. Review article. Lancet 1994; 343: 213-6.        [ Links ]

18. WILKS RJ, LA GRENADE L, HANCHARD B, CAMPBELL M, MURPHY J, CRANSTON B ET AL. Sibling adult T-cell leukemia/lymphoma and clustering of human T-cell lymphotropic virus type 1 infection in a Jamaican family. Cancer 1993; 72: 2700-4.        [ Links ]

19. IWANAGA M, FUJIWARAS, OIKAWA O, SUGIURA M, IMAI S, OSATO T ET AL. Prevalence of human T-cell leukemia virus 1 (HTLV-I) in family members of adult T-cell leukemia (ATL) patients in non-ATL endemic Hokkaido of Japan. In Vivo 1995; 9: 49-53.        [ Links ]

20. CHEN YC, WANG CH, SU IJ, HU CY, CHOU MJ, LEE TH et al. Infection of Human T-cell leukemia virus type 1 and development of Human T-cell leukemia/lymphoma in patients with hematologic neoplasms: a possible linkage to blood transfusion. Blood 1989; 74: 388-94.        [ Links ]

21. BRONISCER A, RIBEIRO RC, SRINIVAS RV, BEHM FG, HEAD DR, RAIMONDI SC ET AL. An adolescent with HTLV-I-associated adult T cell leukemia treated with interferon-alfa and zidovudine. Leukemia 1996; 10: 1244-8.        [ Links ]

22. DOMINGUES RB, MUÑIZ MR, JORGE ML, MAYO MS, SÁEZ AA, CHAMONE DF ET AL. Human T-cell lymphotropic virus type 1 associated myelopathy/tropical spastic paraparesis in Sao Paulo, Brazil: association with blood transfusion. Am J Trop Med Hyg 1997; 57: 56-9.        [ Links ]

23. GUIDELINES FOR COUNSELING PERSONS INFECTED WITH HUMAN T-LYMPHOTROPIC VIRUS TYPE 1 1(HTLV-I) AND TYPE 2 (HTLV-II). Center for Disease Control and USPHS working group. Ann Intern Med 1993; 118: 448-54.        [ Links ]

24. WALDMAN T. The promiscuous IL-2/IL-15 receptor: a target for immunotherapy of HTLV-I associated disorders. J AIDS Hum Retrovirol l996; 13 (Suppl 1): 179-85.        [ Links ]

25. GILL PS, HARRINGTON W, KAPLAN MH, RIBEIRO RC, BENNET JH, LIEBMAN HA ET AL. Treatment of Adult T-cell Leukemia-Lymphoma with a combination of Interferon Alfa and Zidovudine. N Engl J Med 1995; 332: 1744-8.        [ Links ]

26.TAKEZAKI T, TAJIMA K, ITO M, ITO S, KINOSHITA K, TACHIBANA K, MATSUSHITA Y AND THE TSUSHIMA ATL STUDT GROUP. Short-term breast-feeding may reduce the risk of vertical transmission of HTLV-I. Leukemia 1997; 11 (Suppl 3): 60-62.        [ Links ]

27. NYAMBI P, VILLE Y, LLOUWAGIE J ET AL. Mother to child transmision of human T-cell lymphotropic virus types I and II (HTLV-I/II in Gabon: a prospective follow-up of 4 years. J AIDS Hum Retrovirol 1996; 12: 187-92.        [ Links ]