EJBiotechnology logo
Electronic Journal of Biotechnology ISSN: 0717-3458
  © 2011 by Universidad Católica de Valparaíso -- Chile
Vol. 14 No. 1, Issue of January 15, 2011
 

Table 1. Primer sequences, annealing temperatures and expected PCR product sizes for detecting alleles at major Vrn and Ppd-D1 loci in wheat. (No citada en texto)



Locus

Allele

Primers

Primer sequence
(5′─3′)

Expected PCR product size (bp)

Annealing Temperature (°C)

 

Vrn-A1a
Vrn-A1b
vrn-A1

VRN1AF
VRN1R

GAAAGGAAAAATTCTGCTCG
TGCACCTTCCC(C/G)CGCCCCAT

650+750
≈480
≈500

55

Vrn-A1

Vrn-A1c

Intr1/A/F2
Intr1/A/R3

AGCCTCCACGGTTTGAAAGTAA
AAGTAAGACAACACGAATGTGAGA

1170

57

 

 vrn-A1

Intr1/C/F
Intr1/AB/R

GCACTCCTAACCCACTAACC
TCATCCATCATCAAGGCAAA

1068

57

Vrn-B1

 Vrn-B1

Intr1/B/F
Intr1/B/R3

CAAGTGGAACGGTTAGGACA
CTCATGCCAAAAATTGAAGATGA

709

58

vrn-B1

Intr1/B/F
Intr1/B/R4

CAAGTGGAACGGTTAGGACA
CAAATGAAAAGGAATGAGAGCA

1149

58

 Vrn-D1

 Vrn-D1

Intr1/D/F
Intr1/D/R3

GTTGTCTGCCTCATCAAATCC
GGTCACTGGTGGTCTGTGC

1671

61

vrn-D1

Intr1/D/F
Intr1/D/R4

GTTGTCTGCCTCATCAAATCC
AAATGAAAAGGAACGGAGCG

997

56

Vrn-B3

Vrn-B3

VRN4-B-INS-F
VRN4-B-INS-R

CATAATGCCAAGCCGGTGAGTAC
ATGTCTGCCAATTAGCTAGC

≈1200

63

 vrn-B3

VRN4-B-NOINS-F
VRN4-B-NOINS-R

ATGCTTTCGCTTGCCATCC
CTATCCCTACCGGCCATTAG

≈1140

57

  

Ppd-D1a

Ppd-D1_F

ACGCCTCCCACTACACTG

414

 

Ppd-D1

 

Ppd-D1_R1

TTGGTTCAAACAGAGAGC

 

54

 

ppd-D1a

Ppd-D1_R2

CACTGGTGGTAGCTGAGATT

288

 

 


Supported by UNESCO / MIRCEN network