EJBiotechnology logo
Electronic Journal of Biotechnology ISSN: 0717-3458
  © 2010 by Universidad Católica de Valparaíso -- Chile
Vol. 13 No. 5, Issue of September 15, 2010
 

Table 1. G. arboreum ESTs selected for SNPs study, their best blast homology, primer sequences, copy number of genes showing homology with ESTs and their position in Arabidopsis thaliana.



  

EST

Best Blast homology

Primer sequence

Copy number in Arabidopsis

Chromosomal
 position in Arabidopsis

 1

 CON_005_03587

 Histone H2B-3

 GCTTAGCCAATTCACCAGGC
 GCTCCAAGGTTGGTGAGAAG

 Single

 Chr.2

 2

 CON_001_09243

 NADPH-cytochrome P450  reductase

 CACCCATTTAACCCTTCTCGC
 TGTATGTGTGTGGTGATGCC

 Single

 Chr.4

 3

 CON_002_00475

 Werewolf

 AGGGATTATGGGCAATGGAG
 GTGGTTTCAGTGGTTGTTCC

 Single

 Chr.5

 4

 CON_003_03042

 Putative ATP binding protein

 GCCATGGTGAATACTCTGAG
 TCGCCTTCAGAGAAGATGA

 Single

 Chr.1

 5

 CON_003_02564

 Common regulatory factor

 CCATCTCTTTCGCTATCTGC
 AGATCGAAGTAAGCTCGGAC

 Single

 Chr.1

 6

 CON_004_03320

 Photolyase/blue light  photoreceptor PHR2

 AGCTCAACAAGGAGTGAG
 TGAACTGGCTGATGTTCG

 Single

 Ch.2

 7

 CON_031_04487

 S-adenosyl-L-homocysteine  hydrolase

 GTCAATGACTCTGTCACC
 GATGGTAATGCGCTTGAC

 Single

 Chr.4

 8

 CON_002_01213

 Mitochondrial small
 heat shock protein

 CTCTCCATCACCCTAAAG
 GTGGAACAGAACACACTC

 Single

 Mitochondrial

 9

 CON_001_10630

 S-adenosyl methionine  synthetase

 CCAATGTGATGAAGCTCC
 GGTGTACCTGAACCATTG

 Single

 Chr.1

 10

 CON_008_04131

 Histone H2B1

 AGAGAAGAAGCCTAAGGC
 TCACCAGGAAGTACAAGC

 Single

 Chr.1

 11

 CON_006_03927

 Actin-depolymerizing factor 2

 CAACCGAAAGCTATGAGG
 TGTAGGAAGGAAGGAAGC

 Single

 Chr.3

 12

 CON_001_11154

 CONSTANS-like
 protein 1

 ACCATGCTGGAGAAGACTGG
 AGACGGAAGTACGATGACGG

 Single

 Chr.5

 13

 CON_006_03877

 Profilin

 CTCCAGTTCTCAACGAATCC
 AGGTACAATCCAGTTGGAGC

 Single

 Chr.2

 14

 CON_002_01989

 60S ribosomal
 protein L24

 GCAAGAGGTACTTCCACAAC
 ACTTATCGCTTTCCACCACC

 Single

 Chr.2

 15

 CON_001_10272

 Similar to ATP-citrate-lyase

 CGAGATAACCACTACTCC
 CCTACACCACTTCAATGC

 Single

 Chr.1

 16

 CON_002_02239

 Contains similarity to protein  kinase~gene

 TGGCCGTAACAATCATGG
 TGCTTCCTTGCATCACAG

 Single

 Chr.1

 17

 CON_001_10467

 putative transcription factor  BHLH6

 CTTCATCTTCAAGCCCAC
 ACGAACACCTTCGAGAAG

 Single

 Chr.1

 18

 CON_002_00682

 60S ribosomal protein L4/L1

 ACATAGTCACCTTCGTCC
 CGTCAGATATGACCAGAG

 unknown

 Chr.3

 19

 CON_005_03604

 Histone H3.3

 TCCGAGTCGTATCAGAAG
 CAGTTTCCTGATGAGGAG

 Single

 Chr.4

 20

 CON_001_05388

 Luminal binding protein  (BiP)

 AGGATTGATGCTCGCAACAG
 CTCATCTCACCTACCTATGC

 Single

 Chr.5

 21

 CON_001_06492

 Cystein proteinase

 CCTCTTGTTGATGACTGG
 CATGTCTGGTTCAGTGTG

 Single

 Chr.2

 22

 CON_004_03318

 Outer membrane lipoprotein -  like

 ACATGGGAAAGTGGTACGAG
 CTCACATCATACCCCAAGTG

 Single

 Chr.5

 23

 CON_001_00045

 14-3-3-like protein

 CCATCTCTTTCGCTATCTGC
 AGATCGAAGTAAGCTCGGAC

 Single

 Chr.1

 24

 CON_001_10976

 Nucleotide-binding protein

 GCTAGATCTCATTGCTGC
 GACTGTAGGGTACTGAAC

 Single

 Chr.1

 25

 CON_002_02249

 RAD23 protein

 CATCCCTTGTCTCTACACC
 ACAAGCTGTGCAAGTCACAC

 Single

 Chr.1

 26

 CON_013_04353

 Elongation factor 1-gamma

 GGACCTTGGTTAATCAGC
 CCGATCACCAACATCTTC

 unknown

 Chr.1

 27

 CON_001_12763

 E2, Ubiquitin-conjugating enzyme, putative

 GATCGTAACGGAGGTGGTAG
 GCAGGCAATTGGATCCTTCC

 Single

 Chr.5

 28

 CON_003_02574

 Beta-galactosidase 1 like  protein

 GGCCATACTTGAACCTTG
 GTTAGGTTAGTGCCACAG

 unknown

 Chr.3

 29

 CON_009_04160

 Alcohol dehydrogenase

 TGTGGAGAGTGTAGGTGAGG
 GTGGACATTCCGCAGCTTAG

 Single

 Chr.1

 30

 CON_001_12406

 vacuolar H+-ATPase subunit  E

 CGAGTAGGAGTTCAACATCG
 GTGCCGCTTTGAAATCTGAC

 Single

 Chr. 4

 


Supported by UNESCO / MIRCEN network